Starting /dee2/code/volunteer_pipeline.sh SRR5578459 current disk space = 1522763485184 free memory = 1568062980 SRR5578459 SRAfilesize eb51bb6c390a73d40b24414d433a5bc5 SRR5578459.sra SRR5578459.sra file validated SRR5578459 is paired end SRR5578459 is conventional basespace SRR5578459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8135 34.0 34.0 34.0 33.0 34.0 2 33.36325 34.0 34.0 34.0 33.0 34.0 3 33.475 34.0 34.0 34.0 33.0 34.0 4 33.534 34.0 34.0 34.0 33.0 34.0 5 33.3375 34.0 34.0 34.0 33.0 34.0 6 37.11275 38.0 38.0 38.0 36.0 38.0 7 37.45 38.0 38.0 38.0 37.0 38.0 8 37.54625 38.0 38.0 38.0 38.0 38.0 9 37.61525 38.0 38.0 38.0 38.0 38.0 10-14 37.633700000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.60335 38.0 38.0 38.0 38.0 38.0 20-24 37.60335 38.0 38.0 38.0 38.0 38.0 25-29 37.608000000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.554249999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.5267 38.0 38.0 38.0 38.0 38.0 40-44 37.424549999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.3762 38.0 38.0 38.0 37.0 38.0 50-54 37.385400000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.337450000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.2826 38.0 38.0 38.0 36.8 38.0 65-69 37.21840000000001 38.0 38.0 38.0 36.4 38.0 70-74 37.18415 38.0 38.0 38.0 36.0 38.0 75-79 37.09045 38.0 38.0 38.0 36.0 38.0 80-84 37.05005 38.0 38.0 38.0 36.0 38.0 85-89 36.9473 38.0 38.0 38.0 35.6 38.0 90-94 36.8575 38.0 38.0 38.0 35.2 38.0 95-99 36.725249999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.5992 38.0 38.0 38.0 34.2 38.0 105-109 36.46915 38.0 38.0 38.0 34.0 38.0 110-114 36.3077 38.0 38.0 38.0 34.0 38.0 115-119 36.11945 38.0 37.6 38.0 33.4 38.0 120-124 35.91245 38.0 37.0 38.0 33.0 38.0 125-129 35.55625 38.0 36.2 38.0 31.4 38.0 130-134 35.37095000000001 38.0 36.0 38.0 31.0 38.0 135-139 35.04205 38.0 35.6 38.0 29.2 38.0 140-144 34.74065 38.0 35.0 38.0 28.0 38.0 145-149 34.0827 38.0 35.0 38.0 25.0 38.0 150-151 30.166875 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 3.0 16 1.0 17 3.0 18 0.0 19 6.0 20 4.0 21 4.0 22 2.0 23 7.0 24 5.0 25 15.0 26 11.0 27 13.0 28 19.0 29 24.0 30 40.0 31 34.0 32 46.0 33 89.0 34 120.0 35 248.0 36 651.0 37 2650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.159672466734904 12.18014329580348 7.9068577277379735 32.75332650972365 2 25.174999999999997 13.15 33.225 28.449999999999996 3 22.9057264316079 20.030007501875467 24.406101525381345 32.65816454113528 4 27.500000000000004 25.85 21.95 24.7 5 25.521750062861454 30.349509680663818 23.736484787528287 20.39225546894644 6 23.849999999999998 31.275 23.325000000000003 21.55 7 17.8 22.05 38.75 21.4 8 20.75 22.375 28.349999999999998 28.525 9 20.9 21.575 31.05 26.474999999999998 10-14 23.98 25.724999999999998 24.43 25.865 15-19 23.955000000000002 24.995 25.095 25.955000000000002 20-24 23.41 25.41 25.080000000000002 26.1 25-29 24.27 24.91 25.27 25.55 30-34 23.64 24.615000000000002 25.259999999999998 26.484999999999996 35-39 23.669999999999998 25.03 25.36 25.94 40-44 24.005000000000003 24.59 25.64 25.765 45-49 24.52 24.175 25.169999999999998 26.135 50-54 24.085 24.79 24.775 26.35 55-59 24.185000000000002 24.560000000000002 24.88 26.375 60-64 24.25 24.255 25.319999999999997 26.174999999999997 65-69 23.73 24.795 24.865000000000002 26.61 70-74 24.295 25.09 24.26 26.355 75-79 24.12 24.86 24.9 26.119999999999997 80-84 25.195 23.974999999999998 24.93 25.900000000000002 85-89 24.83 24.215 24.495 26.46 90-94 25.290000000000003 25.264999999999997 24.169999999999998 25.275 95-99 25.245 24.195 24.75 25.81 100-104 24.765 25.174999999999997 24.099999999999998 25.96 105-109 25.295 24.875 23.965 25.865 110-114 24.465 24.765 24.29 26.479999999999997 115-119 25.230000000000004 24.165 24.490000000000002 26.115 120-124 24.9499799919968 24.98499399759904 23.82953181272509 26.23549419767907 125-129 24.724779823859087 25.335268214571656 23.94915932746197 25.990792634107287 130-134 25.06757433176494 25.052557813594955 23.455801381519674 26.424066473120433 135-139 24.834834834834833 24.85985985985986 23.45845845845846 26.846846846846844 140-144 24.445 25.369999999999997 23.305 26.88 145-149 24.29 25.124999999999996 23.86 26.724999999999998 150-151 24.786860581745234 24.937311935807422 22.881143430290873 27.39468405215647 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 5.5 28 4.0 29 3.0 30 5.0 31 11.0 32 16.0 33 24.0 34 31.5 35 42.5 36 63.5 37 69.5 38 75.0 39 102.5 40 123.0 41 134.5 42 142.5 43 151.0 44 163.0 45 174.0 46 188.0 47 180.5 48 157.5 49 148.5 50 137.5 51 121.0 52 120.5 53 118.5 54 115.5 55 110.0 56 92.0 57 85.5 58 91.5 59 96.5 60 98.0 61 91.0 62 86.5 63 70.0 64 60.5 65 59.0 66 51.5 67 55.5 68 52.0 69 49.0 70 51.5 71 41.0 72 30.0 73 27.5 74 23.0 75 17.5 76 11.0 77 4.0 78 3.0 79 4.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.025 4 0.0 5 0.575 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.08 130-134 0.11 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03991915108641 98.0 2 0.8842849924204144 1.7500000000000002 3 0.05053057099545225 0.15 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.6124999999999998 0.0 0.0 0.0 0.0 94-95 1.9125 0.0 0.0 0.0 0.0 96-97 2.2125 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 2.8625 0.0 0.0 0.0 0.0 102-103 3.225 0.0 0.0 0.0 0.0 104-105 3.625 0.0 0.0 0.0 0.0 106-107 4.0375 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 5.0 0.0 0.0 0.0 0.0 112-113 5.5875 0.0 0.0 0.0 0.0 114-115 6.2875 0.0 0.0 0.0 0.0 116-117 7.012499999999999 0.0 0.0 0.0 0.0 118-119 7.762499999999999 0.0 0.0 0.0 0.0 120-121 8.5125 0.0 0.0 0.0 0.0 122-123 9.25 0.0 0.0 0.0 0.0 124-125 10.075 0.0 0.0 0.0 0.0 126-127 10.925 0.0 0.0 0.0 0.0 128-129 11.925 0.0 0.0 0.0 0.0 130-131 12.7375 0.0 0.0 0.0 0.0 132-133 13.4875 0.0 0.0 0.0 0.0 134-135 14.0625 0.0 0.0 0.0 0.0 136-137 15.05 0.0 0.0 0.0 0.0 138-139 15.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98675 33.0 33.0 34.0 32.0 34.0 2 33.08075 34.0 33.0 34.0 32.0 34.0 3 33.14225 34.0 33.0 34.0 32.0 34.0 4 33.09175 34.0 33.0 34.0 32.0 34.0 5 33.0705 34.0 33.0 34.0 32.0 34.0 6 37.2805 38.0 38.0 38.0 37.0 38.0 7 37.251 38.0 38.0 38.0 37.0 38.0 8 37.2015 38.0 38.0 38.0 37.0 38.0 9 37.26075 38.0 38.0 38.0 37.0 38.0 10-14 37.22855 38.0 38.0 38.0 37.0 38.0 15-19 37.17274999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.13785 38.0 38.0 38.0 37.0 38.0 25-29 37.120799999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.1305 38.0 38.0 38.0 36.8 38.0 35-39 37.135299999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.113800000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.09475 38.0 38.0 38.0 36.6 38.0 50-54 37.0261 38.0 38.0 38.0 36.2 38.0 55-59 36.9285 38.0 38.0 38.0 36.0 38.0 60-64 36.8295 38.0 38.0 38.0 35.6 38.0 65-69 36.7667 38.0 38.0 38.0 35.0 38.0 70-74 36.618700000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.58245 38.0 38.0 38.0 35.0 38.0 80-84 36.51375 38.0 38.0 38.0 34.4 38.0 85-89 36.4202 38.0 38.0 38.0 34.0 38.0 90-94 36.265600000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.09755 38.0 38.0 38.0 33.6 38.0 100-104 35.86130000000001 38.0 37.8 38.0 33.0 38.0 105-109 35.544200000000004 38.0 37.0 38.0 31.2 38.0 110-114 35.33820000000001 38.0 36.6 38.0 30.2 38.0 115-119 35.017799999999994 38.0 36.0 38.0 28.8 38.0 120-124 34.65915 38.0 35.2 38.0 26.8 38.0 125-129 34.2076 38.0 35.0 38.0 24.6 38.0 130-134 33.7087 38.0 34.4 38.0 20.6 38.0 135-139 32.59654999999999 38.0 32.4 38.0 15.0 38.0 140-144 31.870000000000005 38.0 31.6 38.0 13.2 38.0 145-149 30.238599999999998 36.4 30.2 38.0 4.2 38.0 150-151 24.467875 31.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 1.0 6 2.0 7 0.0 8 3.0 9 2.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 3.0 16 10.0 17 9.0 18 8.0 19 10.0 20 5.0 21 11.0 22 14.0 23 12.0 24 16.0 25 23.0 26 20.0 27 24.0 28 27.0 29 49.0 30 49.0 31 78.0 32 99.0 33 129.0 34 198.0 35 392.0 36 789.0 37 2001.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4 18.525 10.25 27.825 2 29.43235808952238 22.280570142535634 26.456614153538382 21.8304576144036 3 25.124999999999996 24.55 26.0 24.325 4 28.832208052013 29.857464366091524 18.3295823955989 22.980745186296573 5 26.863431715857928 33.74187093546773 17.75887943971986 21.635817908954476 6 22.925 34.150000000000006 20.125 22.8 7 22.725 18.575 34.050000000000004 24.65 8 24.15 21.575 23.7 30.575000000000003 9 24.625 22.25 24.875 28.249999999999996 10-14 26.5 24.265 22.6 26.634999999999998 15-19 25.775 24.86 23.580000000000002 25.785000000000004 20-24 25.88 24.725 23.69 25.705 25-29 26.745 24.529999999999998 23.35 25.374999999999996 30-34 26.340000000000003 24.044999999999998 24.099999999999998 25.515 35-39 26.32 24.32 23.35 26.009999999999998 40-44 26.729999999999997 24.13 23.965 25.174999999999997 45-49 27.12 24.11 23.87 24.9 50-54 26.22 24.87 23.65 25.259999999999998 55-59 26.424999999999997 24.895 23.830000000000002 24.85 60-64 26.69 24.07 24.075 25.165 65-69 26.19 24.38 23.549999999999997 25.88 70-74 27.185 23.955000000000002 23.515 25.345000000000002 75-79 26.41 24.52 23.54 25.53 80-84 26.365 24.16 24.485 24.990000000000002 85-89 26.805 25.15 23.205000000000002 24.84 90-94 25.865 24.815 24.145 25.174999999999997 95-99 26.865 24.34 23.849999999999998 24.945 100-104 26.85 25.14 23.665 24.345 105-109 27.235 24.555 23.51 24.7 110-114 27.134999999999998 25.540000000000003 23.119999999999997 24.205 115-119 27.76 25.014999999999997 23.064999999999998 24.16 120-124 28.060000000000002 25.264999999999997 22.945 23.73 125-129 27.534999999999997 25.11 23.44 23.915 130-134 28.7 25.424999999999997 22.935 22.939999999999998 135-139 28.13 25.88 23.330000000000002 22.66 140-144 28.62 25.424999999999997 23.29 22.665 145-149 29.095 25.955000000000002 22.96 21.990000000000002 150-151 28.26222945076942 26.6733391717753 22.594770424121105 22.469660953334166 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 4.5 29 3.5 30 3.0 31 5.5 32 9.0 33 17.5 34 26.5 35 30.5 36 38.0 37 52.5 38 74.0 39 90.5 40 98.5 41 110.5 42 125.5 43 131.5 44 138.0 45 157.0 46 173.5 47 165.0 48 153.0 49 148.0 50 139.5 51 140.0 52 135.0 53 138.5 54 124.5 55 104.5 56 99.5 57 97.5 58 106.0 59 104.0 60 100.5 61 95.0 62 91.5 63 87.5 64 79.0 65 80.0 66 80.5 67 78.0 68 74.0 69 63.5 70 51.0 71 40.5 72 35.5 73 29.5 74 22.0 75 15.5 76 13.0 77 7.5 78 2.0 79 2.5 80 2.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67919735839472 97.125 2 1.1938023876047752 2.35 3 0.05080010160020319 0.15 4 0.025400050800101596 0.1 5 0.025400050800101596 0.125 6 0.025400050800101596 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.6000000000000001 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.3375 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.8875 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.675 0.0 0.0 0.0 0.0 106-107 4.0875 0.0 0.0 0.0 0.0 108-109 4.4875 0.0 0.0 0.0 0.0 110-111 4.949999999999999 0.0 0.0 0.0 0.0 112-113 5.5625 0.0 0.0 0.0 0.0 114-115 6.237500000000001 0.0 0.0 0.0 0.0 116-117 6.9125 0.0 0.0 0.0 0.0 118-119 7.6875 0.0 0.0 0.0 0.0 120-121 8.4625 0.0 0.0 0.0 0.0 122-123 9.2 0.0 0.0 0.0 0.0 124-125 9.962499999999999 0.0 0.0 0.0 0.0 126-127 10.8 0.0 0.0 0.0 0.0 128-129 11.7625 0.0 0.0 0.0 0.0 130-131 12.575 0.0 0.0 0.0 0.0 132-133 13.287500000000001 0.0 0.0 0.0 0.0 134-135 13.850000000000001 0.0 0.0 0.0 0.0 136-137 14.825 0.0 0.0 0.0 0.0 138-139 15.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890134 spots for SRR5578459.sra Written 890134 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra Read 890128 spots for SRR5578459.sra Written 890128 spots for SRR5578459.sra SRR ids: ['SRR5578459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kxsn1cr2 SRR5578459.sra spots: 17802566 blocks: [[1, 890128], [890129, 1780256], [1780257, 2670384], [2670385, 3560512], [3560513, 4450640], [4450641, 5340768], [5340769, 6230896], [6230897, 7121024], [7121025, 8011152], [8011153, 8901280], [8901281, 9791408], [9791409, 10681536], [10681537, 11571664], [11571665, 12461792], [12461793, 13351920], [13351921, 14242048], [14242049, 15132176], [15132177, 16022304], [16022305, 16912432], [16912433, 17802566]] SRR5578459 file size 6011005 SRR5578459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578459 SRR5578459_1.fastq SRR5578459_2.fastq Input file: SRR5578459_1.fastq Paired file: SRR5578459_2.fastq trimmed: SRR5578459-trimmed-pair1.fastq, SRR5578459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:40:29 2024 >> started Mon Dec 9 18:40:49 2024 >> done (20.411s) 17802566 read pairs processed; of these: 25927 ( 0.15%) short read pairs filtered out after trimming by size control 44196 ( 0.25%) empty read pairs filtered out after trimming by size control 17732443 (99.61%) read pairs available; of these: 10026509 (56.54%) trimmed read pairs available after processing 7705934 (43.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 20 0.00% 20 18 0.00% 21 18 0.00% 22 26 0.00% 23 16 0.00% 24 22 0.00% 25 25 0.00% 26 31 0.00% 27 21 0.00% 28 32 0.00% 29 27 0.00% 30 38 0.00% 31 20 0.00% 32 40 0.00% 33 37 0.00% 34 40 0.00% 35 53 0.00% 36 34 0.00% 37 66 0.00% 38 77 0.00% 39 71 0.00% 40 105 0.00% 41 96 0.00% 42 125 0.00% 43 122 0.00% 44 149 0.00% 45 132 0.00% 46 131 0.00% 47 157 0.00% 48 200 0.00% 49 236 0.00% 50 289 0.00% 51 334 0.00% 52 358 0.00% 53 406 0.00% 54 415 0.00% 55 480 0.00% 56 504 0.00% 57 530 0.00% 58 706 0.00% 59 768 0.00% 60 967 0.01% 61 1094 0.01% 62 1305 0.01% 63 1505 0.01% 64 1607 0.01% 65 1826 0.01% 66 2072 0.01% 67 2362 0.01% 68 2832 0.02% 69 3924 0.02% 70 4565 0.03% 71 4435 0.03% 72 4853 0.03% 73 5429 0.03% 74 5920 0.03% 75 6527 0.04% 76 6903 0.04% 77 7696 0.04% 78 8503 0.05% 79 9416 0.05% 80 10601 0.06% 81 12128 0.07% 82 13466 0.08% 83 15099 0.09% 84 17398 0.10% 85 18592 0.10% 86 19286 0.11% 87 20588 0.12% 88 21718 0.12% 89 22895 0.13% 90 24447 0.14% 91 26544 0.15% 92 28620 0.16% 93 30788 0.17% 94 32456 0.18% 95 34479 0.19% 96 35148 0.20% 97 36396 0.21% 98 37093 0.21% 99 38973 0.22% 100 40213 0.23% 101 43041 0.24% 102 45237 0.26% 103 48088 0.27% 104 50348 0.28% 105 51052 0.29% 106 53628 0.30% 107 53965 0.30% 108 54538 0.31% 109 56016 0.32% 110 56950 0.32% 111 60201 0.34% 112 62428 0.35% 113 64832 0.37% 114 67857 0.38% 115 70216 0.40% 116 71100 0.40% 117 72167 0.41% 118 72368 0.41% 119 73170 0.41% 120 75117 0.42% 121 76144 0.43% 122 78803 0.44% 123 82446 0.46% 124 85556 0.48% 125 87435 0.49% 126 89856 0.51% 127 90354 0.51% 128 90744 0.51% 129 91565 0.52% 130 92391 0.52% 131 93728 0.53% 132 97252 0.55% 133 100599 0.57% 134 103017 0.58% 135 107594 0.61% 136 109447 0.62% 137 111765 0.63% 138 115331 0.65% 139 118358 0.67% 140 121936 0.69% 141 127712 0.72% 142 137252 0.77% 143 147311 0.83% 144 163679 0.92% 145 186406 1.05% 146 220627 1.24% 147 280893 1.58% 148 404617 2.28% 149 788637 4.45% 150 3795079 21.40% 151 7705934 43.46% 17732443 reads passed initial QC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=13 prefix-density=1.12 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=13.23 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=10 prefix-density=1.01 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=20.77 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.8 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATATCAAAGC SRR5578459 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:41:44 Started mapping on | Dec 09 18:41:44 Finished on | Dec 09 18:45:25 Mapping speed, Million of reads per hour | 288.85 Number of input reads | 17732443 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 16012078 Uniquely mapped reads % | 90.30% Average mapped length | 285.94 Number of splices: Total | 16532794 Number of splices: Annotated (sjdb) | 15600476 Number of splices: GT/AG | 16310666 Number of splices: GC/AG | 201091 Number of splices: AT/AC | 8075 Number of splices: Non-canonical | 12962 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301885 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 59209 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.00% % of reads unmapped: other | 1.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1433979 1433979 1433979 N_multimapping 301885 301885 301885 N_noFeature 587631 15538298 744802 N_ambiguous 373773 2225 57512 UnstrandedReadsAssigned:15050674 PositiveStrandReadsAssigned:471555 NegativeStrandReadsAssigned:15209764 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR5578459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578459-trimmed-pair1.fastq SRR5578459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,732,443 reads, 15,337,505 reads pseudoaligned [quant] estimated average fragment length: 224.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 SRR5578459.ke.tsv 35125 SRR5578459.se.tsv 88098 total ==> SRR5578459.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.074 0 0 PNS24247 1044 820.74 36.6945 3.86482 PNS24249 1928 1704.74 88.6593 4.49574 PNS24246 1044 820.74 36.6945 3.86482 PNS24248 1044 820.74 36.6945 3.86482 PNS24244 1471 1247.74 63.2573 4.38249 PNS24243 293 114.995 0 0 KQK14069 1603 1379.74 499.835 31.3158 KQK14071 474 266.011 10.4281 3.38877 ==> SRR5578459.se.tsv <== BRADI_1g14170v3 527 BRADI_1g53295v3 51 BRADI_1g59795v3 275 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 2246 BRADI_1g74790v3 271 BRADI_1g09890v3 5 BRADI_1g77505v3 236 BRADI_1g48960v3 0 SRR5578459 completed mapping pipeline successfully