Starting /dee2/code/volunteer_pipeline.sh SRR5578460 current disk space = 1522792624128 free memory = 1571175412 SRR5578460 SRAfilesize fd2996314a10da22909da64aea3cf07c SRR5578460.sra SRR5578460.sra file validated SRR5578460 is paired end SRR5578460 is conventional basespace SRR5578460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3965 34.0 33.0 34.0 33.0 34.0 2 33.365 34.0 34.0 34.0 33.0 34.0 3 33.4405 34.0 34.0 34.0 33.0 34.0 4 33.52375 34.0 34.0 34.0 33.0 34.0 5 33.53675 34.0 34.0 34.0 33.0 34.0 6 37.18625 38.0 38.0 38.0 36.0 38.0 7 37.4765 38.0 38.0 38.0 37.0 38.0 8 37.59325 38.0 38.0 38.0 38.0 38.0 9 37.5995 38.0 38.0 38.0 38.0 38.0 10-14 37.62295 38.0 38.0 38.0 38.0 38.0 15-19 37.5938 38.0 38.0 38.0 38.0 38.0 20-24 37.63595 38.0 38.0 38.0 38.0 38.0 25-29 37.58895 38.0 38.0 38.0 38.0 38.0 30-34 37.5859 38.0 38.0 38.0 38.0 38.0 35-39 37.47955 38.0 38.0 38.0 38.0 38.0 40-44 37.407650000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.348 38.0 38.0 38.0 37.0 38.0 50-54 37.29655 38.0 38.0 38.0 37.0 38.0 55-59 37.2565 38.0 38.0 38.0 36.8 38.0 60-64 37.1863 38.0 38.0 38.0 36.2 38.0 65-69 37.14635 38.0 38.0 38.0 36.0 38.0 70-74 37.02995 38.0 38.0 38.0 36.0 38.0 75-79 37.022000000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.83905 38.0 38.0 38.0 35.0 38.0 85-89 36.8146 38.0 38.0 38.0 35.0 38.0 90-94 36.676750000000006 38.0 38.0 38.0 34.8 38.0 95-99 36.5495 38.0 38.0 38.0 34.2 38.0 100-104 36.39565 38.0 38.0 38.0 34.0 38.0 105-109 36.265299999999996 38.0 38.0 38.0 33.8 38.0 110-114 36.118100000000005 38.0 37.8 38.0 33.4 38.0 115-119 35.9157 38.0 37.2 38.0 32.8 38.0 120-124 35.664699999999996 38.0 36.0 38.0 32.2 38.0 125-129 35.411449999999995 38.0 36.0 38.0 31.2 38.0 130-134 35.108399999999996 38.0 35.4 38.0 29.4 38.0 135-139 34.777750000000005 38.0 35.0 38.0 28.0 38.0 140-144 34.3532 38.0 35.0 38.0 26.2 38.0 145-149 33.48545 38.0 34.2 38.0 20.4 38.0 150-151 29.14625 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 6.0 18 2.0 19 5.0 20 1.0 21 5.0 22 5.0 23 6.0 24 13.0 25 13.0 26 13.0 27 16.0 28 25.0 29 17.0 30 32.0 31 39.0 32 71.0 33 80.0 34 149.0 35 261.0 36 743.0 37 2487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.39434793881255 10.707803992740473 8.711433756805807 33.18641431164117 2 25.424999999999997 12.6 32.625 29.349999999999998 3 22.366775081310983 16.437327995997 23.817863397548162 37.378033525143856 4 30.3 22.225 19.975 27.500000000000004 5 27.450000000000003 28.249999999999996 22.675 21.625 6 25.25 29.125 23.05 22.575 7 19.675 22.125 36.725 21.475 8 21.925 22.325 28.9 26.85 9 22.1 19.75 32.4 25.75 10-14 24.959999999999997 24.705 24.375 25.96 15-19 24.7 23.945 24.615000000000002 26.740000000000002 20-24 25.25 23.895 24.884999999999998 25.97 25-29 24.775 24.145 24.765 26.314999999999998 30-34 24.6 24.310000000000002 24.165 26.924999999999997 35-39 24.985 24.015 24.435000000000002 26.565 40-44 25.11 24.07 24.4 26.419999999999998 45-49 25.415 23.61 23.775 27.200000000000003 50-54 24.965 24.05 23.865 27.12 55-59 25.4 23.810000000000002 24.42 26.369999999999997 60-64 25.290000000000003 23.53 24.44 26.740000000000002 65-69 25.435000000000002 24.11 23.955000000000002 26.5 70-74 25.814999999999998 23.57 23.849999999999998 26.765 75-79 25.415 23.665 23.990000000000002 26.93 80-84 25.650000000000002 23.65 23.97 26.729999999999997 85-89 26.245 23.3 23.695 26.76 90-94 25.974999999999998 23.345 24.13 26.55 95-99 25.27 23.405 24.48 26.845000000000002 100-104 26.06 23.97 23.855 26.115 105-109 26.235000000000003 24.26 23.25 26.255 110-114 25.94 23.380000000000003 23.325000000000003 27.355 115-119 25.45 23.615 23.74 27.195000000000004 120-124 26.555 24.205 23.06 26.179999999999996 125-129 25.795 24.01 22.645 27.55 130-134 26.06 24.11 22.919999999999998 26.91 135-139 25.06 24.235 23.235 27.47 140-144 25.89 23.82 23.48 26.810000000000002 145-149 26.41 24.325 22.765 26.5 150-151 26.0375 23.45 23.0625 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 2.5 29 2.5 30 6.0 31 15.5 32 15.5 33 17.0 34 25.5 35 30.5 36 37.0 37 63.5 38 88.0 39 92.5 40 90.0 41 97.0 42 116.5 43 134.0 44 139.0 45 143.5 46 159.5 47 157.5 48 143.5 49 134.5 50 137.0 51 146.0 52 151.0 53 134.0 54 120.0 55 116.0 56 104.0 57 105.0 58 102.5 59 99.0 60 92.0 61 88.0 62 85.0 63 80.5 64 85.5 65 83.0 66 71.0 67 62.0 68 66.0 69 57.5 70 55.5 71 54.5 72 38.5 73 31.5 74 29.0 75 20.0 76 15.0 77 17.5 78 16.0 79 9.5 80 4.0 81 2.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.93761278680073 94.975 2 1.4694508894044858 2.85 3 0.3866976024748647 1.125 4 0.07733952049497293 0.3 5 0.07733952049497293 0.375 6 0.0 0.0 7 0.025779840164990978 0.17500000000000002 8 0.025779840164990978 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 8 0.2 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 7 0.17500000000000002 No Hit GGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATT 5 0.125 No Hit CTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGT 5 0.125 No Hit GGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 90-91 1.4375 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 2.0875000000000004 0.0 0.0 0.0 0.0 96-97 2.5625 0.0 0.0 0.0 0.0 98-99 2.925 0.0 0.0 0.0 0.0 100-101 3.4124999999999996 0.0 0.0 0.0 0.0 102-103 3.9125 0.0 0.0 0.0 0.0 104-105 4.612500000000001 0.0 0.0 0.0 0.0 106-107 5.0875 0.0 0.0 0.0 0.0 108-109 5.6875 0.0 0.0 0.0 0.0 110-111 6.3 0.0 0.0 0.0 0.0 112-113 7.1625 0.0 0.0 0.0 0.0 114-115 8.0125 0.0 0.0 0.0 0.0 116-117 8.8 0.0 0.0 0.0 0.0 118-119 9.525 0.0 0.0 0.0 0.0 120-121 10.35 0.0 0.0 0.0 0.0 122-123 11.0125 0.0 0.0 0.0 0.0 124-125 11.975 0.0 0.0 0.0 0.0 126-127 12.7625 0.0 0.0 0.0 0.0 128-129 13.5625 0.0 0.0 0.0 0.0 130-131 14.5 0.0 0.0 0.0 0.0 132-133 15.3 0.0 0.0 0.0 0.0 134-135 16.2 0.0 0.0 0.0 0.0 136-137 17.0125 0.0 0.0 0.0 0.0 138-139 18.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTGGA 10 0.006836113 144.9625 8 >>END_MODULE SRR5578460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.991 33.0 33.0 34.0 32.0 34.0 2 33.0415 34.0 33.0 34.0 32.0 34.0 3 33.0645 34.0 33.0 34.0 33.0 34.0 4 32.9285 34.0 33.0 34.0 32.0 34.0 5 33.0705 34.0 33.0 34.0 33.0 34.0 6 37.18125 38.0 38.0 38.0 37.0 38.0 7 37.1815 38.0 38.0 38.0 37.0 38.0 8 37.17675 38.0 38.0 38.0 37.0 38.0 9 37.21025 38.0 38.0 38.0 37.0 38.0 10-14 37.158950000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.1568 38.0 38.0 38.0 37.0 38.0 20-24 37.128049999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.10844999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.16459999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.15815 38.0 38.0 38.0 37.0 38.0 40-44 37.1264 38.0 38.0 38.0 37.0 38.0 45-49 37.078199999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.067099999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.0005 38.0 38.0 38.0 36.6 38.0 60-64 36.94655 38.0 38.0 38.0 36.2 38.0 65-69 36.899150000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.70345 38.0 38.0 38.0 35.4 38.0 75-79 36.5907 38.0 38.0 38.0 35.0 38.0 80-84 36.64815 38.0 38.0 38.0 35.0 38.0 85-89 36.493900000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.4489 38.0 38.0 38.0 34.4 38.0 95-99 36.24395 38.0 38.0 38.0 34.0 38.0 100-104 36.09125 38.0 38.0 38.0 34.0 38.0 105-109 35.86355 38.0 38.0 38.0 33.0 38.0 110-114 35.681349999999995 38.0 37.8 38.0 32.8 38.0 115-119 35.376099999999994 38.0 36.6 38.0 31.2 38.0 120-124 35.15465 38.0 36.0 38.0 30.2 38.0 125-129 34.72930000000001 38.0 35.6 38.0 27.4 38.0 130-134 34.1672 38.0 35.0 38.0 24.2 38.0 135-139 33.573249999999994 38.0 33.4 38.0 21.8 38.0 140-144 32.8521 38.0 33.0 38.0 14.6 38.0 145-149 31.4606 38.0 32.2 38.0 7.6 38.0 150-151 26.264 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 3.0 5 1.0 6 2.0 7 1.0 8 3.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 6.0 15 7.0 16 8.0 17 11.0 18 6.0 19 8.0 20 14.0 21 12.0 22 7.0 23 13.0 24 11.0 25 9.0 26 17.0 27 25.0 28 21.0 29 24.0 30 43.0 31 59.0 32 73.0 33 100.0 34 174.0 35 301.0 36 708.0 37 2318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6 18.55 10.549999999999999 29.299999999999997 2 29.74731048286215 22.792094070552913 23.942957217913435 23.517638228671505 3 24.36827620715537 24.69352014010508 25.143857893420062 25.794345759319487 4 27.195396547410557 30.472854640980735 18.689016762571928 23.642732049036777 5 28.271203402551915 31.523642732049034 18.58894170627971 21.61621215911934 6 24.525 33.025 19.425 23.025000000000002 7 23.95 19.775000000000002 32.324999999999996 23.95 8 23.35 23.150000000000002 22.775000000000002 30.725 9 24.375 23.625 24.85 27.150000000000002 10-14 26.109360148081446 24.42843563960178 21.69693331332233 27.765270898994448 15-19 26.591910292350825 24.053864637565077 22.76231477773328 26.591910292350825 20-24 26.738074978727667 24.465688973422093 22.53366034336053 26.262575704489716 25-29 27.394242803504383 23.749687108886107 22.65331664580726 26.20275344180225 30-34 26.960048062481224 24.046260138179633 22.449183939120857 26.544507860218285 35-39 26.942330796956348 23.868642370845013 22.777332799359232 26.411694032839407 40-44 27.57982183965569 24.116705034531076 22.169952957661895 26.133520168151335 45-49 27.206765412329865 23.49379503602882 22.813250600480384 26.486188951160926 50-54 26.714042638374536 22.760484435992392 23.58122310079071 26.94424982484236 55-59 26.7017017017017 23.683683683683686 23.16816816816817 26.446446446446448 60-64 26.79849812265332 23.038798498122652 23.714643304130163 26.448060075093867 65-69 26.53817271589487 24.11013767209011 22.828535669586984 26.523153942428035 70-74 27.15894868585732 22.943679599499376 23.364205256570713 26.533166458072593 75-79 26.561169813210476 23.861986078421555 22.97060443687716 26.606239671490812 80-84 26.33450175262894 23.770655983975963 23.405107661492238 26.489734601902853 85-89 26.65398858973076 23.93654288859974 22.91061955760184 26.498848964067662 90-94 27.105328996747563 24.26820115086315 22.65699274455842 25.969477107830873 95-99 27.291385092856785 24.172798718526305 23.2567452570456 25.279070931571308 100-104 27.54805766920304 24.769723668402083 22.552062474969965 25.130156187424912 105-109 27.764705882352942 24.6558197747184 22.087609511889863 25.491864831038797 110-114 27.44116174261392 24.952428642964446 22.12819228843265 25.478217325988982 115-119 28.11795924498072 24.803484704350872 22.57047013468182 24.508085915986584 120-124 28.862521277660957 24.90737959347151 21.768298788424953 24.461800340442576 125-129 28.946182728410513 24.77596996245307 21.947434292866085 24.330413016270338 130-134 28.691560716788466 24.827310041045152 22.830113124436878 23.651016117729505 135-139 29.120384268988293 25.182627839487644 22.11548083658561 23.58150705493846 140-144 29.069534767383693 25.897948974487246 22.321160580290144 22.71135567783892 145-149 29.44708531398549 25.559169377032774 22.596947710783088 22.39679759819865 150-151 29.694923730932732 25.506376594148538 21.767941985496375 23.030757689422355 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 1.5 29 3.5 30 6.5 31 6.5 32 7.0 33 11.0 34 15.5 35 22.0 36 29.5 37 35.0 38 49.5 39 65.5 40 100.5 41 120.0 42 110.0 43 104.0 44 110.0 45 130.5 46 150.5 47 159.0 48 149.0 49 152.0 50 142.5 51 121.5 52 127.5 53 128.0 54 126.0 55 126.0 56 117.0 57 112.5 58 120.0 59 129.0 60 117.5 61 103.0 62 101.0 63 106.0 64 93.5 65 77.5 66 74.5 67 77.5 68 75.5 69 72.5 70 63.5 71 57.0 72 53.0 73 41.5 74 28.5 75 19.0 76 13.5 77 8.0 78 8.0 79 4.5 80 3.0 81 2.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.12 20-24 0.105 25-29 0.125 30-34 0.13 35-39 0.12 40-44 0.09 45-49 0.08 50-54 0.09 55-59 0.1 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.155 80-84 0.15 85-89 0.09 90-94 0.075 95-99 0.11499999999999999 100-104 0.12 105-109 0.125 110-114 0.15 115-119 0.135 120-124 0.13 125-129 0.125 130-134 0.11 135-139 0.06999999999999999 140-144 0.05 145-149 0.075 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.50584567420108 93.825 2 1.7926734216679656 3.45 3 0.3897116134060795 1.125 4 0.10392309690828788 0.4 5 0.10392309690828788 0.5 6 0.0 0.0 7 0.10392309690828788 0.7000000000000001 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 7 0.17500000000000002 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 7 0.17500000000000002 No Hit TAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGT 7 0.17500000000000002 No Hit ATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAG 7 0.17500000000000002 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 5 0.125 No Hit CGGCAACTCTCCCGGGTACTACGACGGCAGGTACTGGACAATGTGGAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.375 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.5375 0.0 0.0 0.0 0.0 98-99 2.925 0.0 0.0 0.0 0.0 100-101 3.4375 0.0 0.0 0.0 0.0 102-103 3.975 0.0 0.0 0.0 0.0 104-105 4.7125 0.0 0.0 0.0 0.0 106-107 5.2125 0.0 0.0 0.0 0.0 108-109 5.7875 0.0 0.0 0.0 0.0 110-111 6.425 0.0 0.0 0.0 0.0 112-113 7.275 0.0 0.0 0.0 0.0 114-115 8.1 0.0 0.0 0.0 0.0 116-117 8.8625 0.0 0.0 0.0 0.0 118-119 9.600000000000001 0.0 0.0 0.0 0.0 120-121 10.475 0.0 0.0 0.0 0.0 122-123 11.1875 0.0 0.0 0.0 0.0 124-125 12.162500000000001 0.0 0.0 0.0 0.0 126-127 12.95 0.0 0.0 0.0 0.0 128-129 13.725000000000001 0.0 0.0 0.0 0.0 130-131 14.7125 0.0 0.0 0.0 0.0 132-133 15.5875 0.0 0.0 0.0 0.0 134-135 16.5 0.0 0.0 0.0 0.0 136-137 17.325 0.0 0.0 0.0 0.0 138-139 18.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGGG 10 0.006830828 145.0 2 AGAGGCG 10 0.006830828 145.0 2 AATTAGG 10 0.006830828 145.0 1 TTAGGGC 10 0.006830828 145.0 3 >>END_MODULE Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra Read 895615 spots for SRR5578460.sra Written 895615 spots for SRR5578460.sra Read 895608 spots for SRR5578460.sra Written 895608 spots for SRR5578460.sra SRR ids: ['SRR5578460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k5sjsu34 SRR5578460.sra spots: 17912167 blocks: [[1, 895608], [895609, 1791216], [1791217, 2686824], [2686825, 3582432], [3582433, 4478040], [4478041, 5373648], [5373649, 6269256], [6269257, 7164864], [7164865, 8060472], [8060473, 8956080], [8956081, 9851688], [9851689, 10747296], [10747297, 11642904], [11642905, 12538512], [12538513, 13434120], [13434121, 14329728], [14329729, 15225336], [15225337, 16120944], [16120945, 17016552], [17016553, 17912167]] SRR5578460 file size 6048145 SRR5578460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578460 SRR5578460_1.fastq SRR5578460_2.fastq Input file: SRR5578460_1.fastq Paired file: SRR5578460_2.fastq trimmed: SRR5578460-trimmed-pair1.fastq, SRR5578460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:42:02 2024 >> started Mon Dec 9 18:42:23 2024 >> done (20.602s) 17912167 read pairs processed; of these: 34159 ( 0.19%) short read pairs filtered out after trimming by size control 70204 ( 0.39%) empty read pairs filtered out after trimming by size control 17807804 (99.42%) read pairs available; of these: 10542411 (59.20%) trimmed read pairs available after processing 7265393 (40.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 22 0.00% 21 23 0.00% 22 28 0.00% 23 22 0.00% 24 28 0.00% 25 30 0.00% 26 24 0.00% 27 33 0.00% 28 30 0.00% 29 26 0.00% 30 45 0.00% 31 41 0.00% 32 59 0.00% 33 37 0.00% 34 49 0.00% 35 80 0.00% 36 70 0.00% 37 81 0.00% 38 84 0.00% 39 77 0.00% 40 89 0.00% 41 97 0.00% 42 95 0.00% 43 124 0.00% 44 128 0.00% 45 166 0.00% 46 191 0.00% 47 219 0.00% 48 221 0.00% 49 290 0.00% 50 343 0.00% 51 392 0.00% 52 357 0.00% 53 404 0.00% 54 486 0.00% 55 585 0.00% 56 569 0.00% 57 724 0.00% 58 827 0.00% 59 905 0.01% 60 1012 0.01% 61 1216 0.01% 62 1377 0.01% 63 1570 0.01% 64 1862 0.01% 65 2100 0.01% 66 2446 0.01% 67 3009 0.02% 68 3797 0.02% 69 6055 0.03% 70 6042 0.03% 71 4682 0.03% 72 5180 0.03% 73 5541 0.03% 74 6475 0.04% 75 7247 0.04% 76 7914 0.04% 77 8811 0.05% 78 9745 0.05% 79 11385 0.06% 80 12257 0.07% 81 13521 0.08% 82 15641 0.09% 83 16990 0.10% 84 19701 0.11% 85 22070 0.12% 86 23614 0.13% 87 25048 0.14% 88 27336 0.15% 89 28246 0.16% 90 30096 0.17% 91 32440 0.18% 92 34644 0.19% 93 37147 0.21% 94 39656 0.22% 95 41659 0.23% 96 43389 0.24% 97 45922 0.26% 98 47668 0.27% 99 49569 0.28% 100 51970 0.29% 101 54036 0.30% 102 56226 0.32% 103 59316 0.33% 104 61592 0.35% 105 63487 0.36% 106 65814 0.37% 107 67828 0.38% 108 69016 0.39% 109 69195 0.39% 110 71150 0.40% 111 74015 0.42% 112 76704 0.43% 113 79527 0.45% 114 82550 0.46% 115 85326 0.48% 116 86165 0.48% 117 87272 0.49% 118 87525 0.49% 119 87738 0.49% 120 89448 0.50% 121 90167 0.51% 122 92320 0.52% 123 95697 0.54% 124 98563 0.55% 125 99443 0.56% 126 101798 0.57% 127 101645 0.57% 128 100773 0.57% 129 103147 0.58% 130 103707 0.58% 131 104477 0.59% 132 107305 0.60% 133 109538 0.62% 134 111077 0.62% 135 112986 0.63% 136 115536 0.65% 137 116289 0.65% 138 120844 0.68% 139 124253 0.70% 140 128442 0.72% 141 133076 0.75% 142 143684 0.81% 143 152080 0.85% 144 167382 0.94% 145 186922 1.05% 146 221396 1.24% 147 280168 1.57% 148 399844 2.25% 149 770720 4.33% 150 3711021 20.84% 151 7265393 40.80% 17807804 reads passed initial QC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=17 prefix-density=1.15 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=21.52 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=TTTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTTAGAGG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=25 prefix-density=0.84 prefix-fanout=2.1 sequence=CCCATGTTCGGGTGCACCGACGCCACGCAGGTGCTAAAGGAGCTGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=30.28 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5578460 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:43:14 Started mapping on | Dec 09 18:43:14 Finished on | Dec 09 18:50:52 Mapping speed, Million of reads per hour | 139.97 Number of input reads | 17807804 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 15284686 Uniquely mapped reads % | 85.83% Average mapped length | 283.42 Number of splices: Total | 14309042 Number of splices: Annotated (sjdb) | 13487984 Number of splices: GT/AG | 14139547 Number of splices: GC/AG | 154543 Number of splices: AT/AC | 5856 Number of splices: Non-canonical | 9096 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144080 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 18531 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.78% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2392338 2392338 2392338 N_multimapping 144080 144080 144080 N_noFeature 308355 14864141 437068 N_ambiguous 348443 1613 56902 UnstrandedReadsAssigned:14627888 PositiveStrandReadsAssigned:418932 NegativeStrandReadsAssigned:14790716 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=135 echo kmer=131 SRR5578460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578460-trimmed-pair1.fastq SRR5578460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,807,804 reads, 14,842,006 reads pseudoaligned [quant] estimated average fragment length: 216.457 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR5578460.ke.tsv 35125 SRR5578460.se.tsv 88098 total ==> SRR5578460.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 720.888 17.2038 2.00292 PNS24247 1044 828.543 20.3001 2.05632 PNS24249 1928 1712.54 109.47 5.36487 PNS24246 1044 828.543 20.3001 2.05632 PNS24248 1044 828.543 20.3001 2.05632 PNS24244 1471 1255.54 20.426 1.3654 PNS24243 293 118.468 0 0 KQK14069 1603 1387.54 459.266 27.7795 KQK14071 474 269.979 6.5492 2.03594 ==> SRR5578460.se.tsv <== BRADI_1g14170v3 512 BRADI_1g53295v3 12 BRADI_1g59795v3 101 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1674 BRADI_1g74790v3 277 BRADI_1g09890v3 15 BRADI_1g77505v3 259 BRADI_1g48960v3 0 SRR5578460 completed mapping pipeline successfully