Starting /dee2/code/volunteer_pipeline.sh SRR5578461 current disk space = 1522718572544 free memory = 1570962848 SRR5578461 SRAfilesize d6b90994140aeeda58d30aaac479ce25 SRR5578461.sra SRR5578461.sra file validated SRR5578461 is paired end SRR5578461 is conventional basespace SRR5578461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0945 34.0 33.0 34.0 33.0 34.0 2 33.39625 34.0 33.0 34.0 33.0 34.0 3 33.41225 34.0 34.0 34.0 33.0 34.0 4 33.37925 34.0 34.0 34.0 33.0 34.0 5 33.384 34.0 34.0 34.0 33.0 34.0 6 37.1735 38.0 38.0 38.0 36.0 38.0 7 37.378 38.0 38.0 38.0 37.0 38.0 8 37.3985 38.0 38.0 38.0 37.0 38.0 9 37.47625 38.0 38.0 38.0 37.0 38.0 10-14 37.492000000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.489 38.0 38.0 38.0 37.8 38.0 20-24 37.491099999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4412 38.0 38.0 38.0 37.6 38.0 30-34 37.44185 38.0 38.0 38.0 37.4 38.0 35-39 37.39985 38.0 38.0 38.0 37.2 38.0 40-44 37.329 38.0 38.0 38.0 37.0 38.0 45-49 37.338499999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.2919 38.0 38.0 38.0 37.0 38.0 55-59 37.281 38.0 38.0 38.0 37.0 38.0 60-64 37.21575 38.0 38.0 38.0 37.0 38.0 65-69 37.18255 38.0 38.0 38.0 36.4 38.0 70-74 37.15445 38.0 38.0 38.0 36.6 38.0 75-79 37.1325 38.0 38.0 38.0 36.2 38.0 80-84 37.0984 38.0 38.0 38.0 36.0 38.0 85-89 36.97955 38.0 38.0 38.0 36.0 38.0 90-94 36.92595 38.0 38.0 38.0 35.4 38.0 95-99 36.87625 38.0 38.0 38.0 35.2 38.0 100-104 36.72795 38.0 38.0 38.0 35.0 38.0 105-109 36.62195 38.0 38.0 38.0 34.2 38.0 110-114 36.51155 38.0 38.0 38.0 34.0 38.0 115-119 36.324400000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.3323 38.0 38.0 38.0 34.0 38.0 125-129 36.18305 38.0 38.0 38.0 33.8 38.0 130-134 36.02295 38.0 38.0 38.0 33.2 38.0 135-139 35.78095 38.0 37.0 38.0 33.0 38.0 140-144 35.605850000000004 38.0 36.2 38.0 32.2 38.0 145-149 34.923449999999995 38.0 36.0 38.0 30.2 38.0 150-151 31.767000000000003 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 2.0 20 4.0 21 3.0 22 6.0 23 9.0 24 7.0 25 15.0 26 13.0 27 7.0 28 16.0 29 24.0 30 35.0 31 45.0 32 53.0 33 84.0 34 99.0 35 171.0 36 443.0 37 2952.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.23790322580645 9.652217741935484 9.450604838709678 38.659274193548384 2 25.75 14.799999999999999 31.4 28.050000000000004 3 22.0 18.425 23.400000000000002 36.175000000000004 4 27.474999999999998 25.374999999999996 20.125 27.025 5 28.175 29.125 21.75 20.95 6 22.075 34.150000000000006 22.625 21.15 7 18.079519879969993 22.380595148787197 39.634908727181795 19.904976244061015 8 21.575 23.325000000000003 27.35 27.750000000000004 9 20.525 21.0 34.150000000000006 24.325 10-14 23.794999999999998 25.685000000000002 25.590000000000003 24.93 15-19 23.255 25.35 25.36 26.035000000000004 20-24 23.49 25.669999999999998 24.925 25.915 25-29 23.51 25.36 25.335 25.795 30-34 23.86 24.665 25.740000000000002 25.735000000000003 35-39 23.799999999999997 25.27 24.735 26.195 40-44 24.07 25.36 24.709999999999997 25.86 45-49 23.89 24.975 25.330000000000002 25.805 50-54 23.915 25.235000000000003 24.779999999999998 26.07 55-59 24.05 25.014999999999997 24.525 26.41 60-64 24.145 24.68 24.91 26.265 65-69 23.595 25.230000000000004 24.98 26.195 70-74 24.335 24.725 25.069999999999997 25.869999999999997 75-79 24.02 24.560000000000002 24.465 26.955000000000002 80-84 25.119999999999997 25.055 24.169999999999998 25.655 85-89 24.44 24.565 24.474999999999998 26.52 90-94 24.135 25.259999999999998 24.775 25.83 95-99 24.755 24.92 24.36 25.965 100-104 24.945 24.585 24.38 26.090000000000003 105-109 24.495 24.91 24.73 25.865 110-114 25.009999999999998 25.11 24.085 25.795 115-119 24.798719807971196 25.448817322598387 23.268490273541033 26.483972595889384 120-124 24.47 24.89 24.115000000000002 26.525 125-129 24.22 24.95 24.224999999999998 26.605 130-134 24.675 24.709999999999997 23.73 26.884999999999998 135-139 24.48 24.825 23.955000000000002 26.740000000000002 140-144 24.7 24.39 24.32 26.590000000000003 145-149 24.295 25.245 24.01 26.450000000000003 150-151 25.21565195649456 23.8404800600075 24.16552069008626 26.778347293411674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 3.0 29 5.5 30 9.0 31 14.0 32 14.0 33 15.0 34 20.5 35 35.5 36 61.5 37 77.5 38 83.5 39 93.5 40 112.5 41 143.0 42 159.5 43 171.5 44 189.5 45 179.5 46 179.0 47 192.5 48 173.0 49 156.0 50 164.5 51 156.5 52 128.0 53 107.5 54 96.0 55 85.0 56 80.5 57 90.5 58 98.5 59 83.0 60 69.0 61 66.0 62 62.5 63 67.5 64 76.5 65 66.0 66 54.5 67 52.5 68 47.0 69 47.0 70 45.5 71 37.5 72 24.5 73 23.5 74 24.5 75 17.0 76 11.5 77 7.5 78 6.5 79 4.5 80 1.5 81 1.0 82 1.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.5249999999999999 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.8999999999999999 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.5499999999999998 0.0 0.0 0.0 0.0 96-97 1.975 0.0 0.0 0.0 0.0 98-99 2.3 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 3.075 0.0 0.0 0.0 0.0 104-105 3.5374999999999996 0.0 0.0 0.0 0.0 106-107 4.125 0.0 0.0 0.0 0.0 108-109 4.637499999999999 0.0 0.0 0.0 0.0 110-111 5.05 0.0 0.0 0.0 0.0 112-113 5.7125 0.0 0.0 0.0 0.0 114-115 6.425000000000001 0.0 0.0 0.0 0.0 116-117 6.9375 0.0 0.0 0.0 0.0 118-119 7.65 0.0 0.0 0.0 0.0 120-121 8.325 0.0 0.0 0.0 0.0 122-123 8.8875 0.0 0.0 0.0 0.0 124-125 9.537500000000001 0.0 0.0 0.0 0.0 126-127 10.3125 0.0 0.0 0.0 0.0 128-129 10.9625 0.0 0.0 0.0 0.0 130-131 11.7 0.0 0.0 0.0 0.0 132-133 12.325 0.0 0.0 0.0 0.0 134-135 13.087499999999999 0.0 0.0 0.0 0.0 136-137 13.825 0.0 0.0 0.0 0.0 138-139 14.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTATCT 10 0.006830828 145.0 3 GCTCTGT 10 0.006830828 145.0 1 >>END_MODULE SRR5578461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76 33.0 32.0 33.0 28.0 34.0 2 31.96875 33.0 33.0 34.0 30.0 34.0 3 31.89725 33.0 33.0 34.0 29.0 34.0 4 31.87875 33.0 33.0 34.0 30.0 34.0 5 31.825 33.0 33.0 34.0 30.0 34.0 6 35.82275 38.0 37.0 38.0 31.0 38.0 7 35.753 38.0 37.0 38.0 31.0 38.0 8 35.819 38.0 37.0 38.0 31.0 38.0 9 35.6605 38.0 37.0 38.0 29.0 38.0 10-14 35.7298 38.0 37.0 38.0 29.8 38.0 15-19 35.55745 38.0 37.0 38.0 29.8 38.0 20-24 35.39835000000001 38.0 37.0 38.0 28.8 38.0 25-29 35.26715 38.0 37.0 38.0 28.6 38.0 30-34 35.1466 38.0 36.6 38.0 28.0 38.0 35-39 34.97924999999999 38.0 36.0 38.0 27.8 38.0 40-44 34.82715 38.0 36.0 38.0 27.0 38.0 45-49 34.66475 38.0 36.0 38.0 26.6 38.0 50-54 34.2273 38.0 35.0 38.0 23.0 38.0 55-59 33.98905 38.0 34.4 38.0 21.2 38.0 60-64 33.61925 38.0 34.0 38.0 16.0 38.0 65-69 33.366499999999995 38.0 33.8 38.0 16.0 38.0 70-74 32.918899999999994 38.0 33.0 38.0 16.0 38.0 75-79 32.56515 37.6 32.2 38.0 15.4 38.0 80-84 32.068799999999996 37.0 30.6 38.0 15.0 38.0 85-89 31.3867 37.0 28.8 38.0 14.8 38.0 90-94 30.614050000000002 36.2 27.0 38.0 13.8 38.0 95-99 29.971600000000002 35.8 25.4 38.0 13.0 38.0 100-104 29.32435 35.0 23.4 38.0 13.0 38.0 105-109 28.3793 34.4 21.0 38.0 4.2 38.0 110-114 27.4075 34.0 15.0 38.0 2.0 38.0 115-119 26.3644 33.8 15.0 38.0 2.0 38.0 120-124 25.122949999999996 32.2 13.8 37.4 2.0 38.0 125-129 23.808550000000004 30.2 13.0 36.6 2.0 38.0 130-134 22.21825 26.6 2.0 36.0 2.0 38.0 135-139 20.72965 23.0 2.0 35.0 2.0 38.0 140-144 18.8628 19.6 2.0 34.6 2.0 38.0 145-149 16.017000000000003 6.6 2.0 33.4 2.0 38.0 150-151 11.873750000000001 2.0 2.0 27.0 2.0 35.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 11.0 4 8.0 5 6.0 6 8.0 7 8.0 8 6.0 9 20.0 10 8.0 11 13.0 12 14.0 13 21.0 14 21.0 15 33.0 16 32.0 17 34.0 18 42.0 19 59.0 20 59.0 21 69.0 22 70.0 23 80.0 24 97.0 25 89.0 26 123.0 27 116.0 28 170.0 29 168.0 30 245.0 31 214.0 32 318.0 33 348.0 34 405.0 35 431.0 36 426.0 37 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 17.549999999999997 12.6 32.125 2 30.077635862759827 23.26571500125219 25.118958176809414 21.537690959178562 3 23.50288148333751 25.60761713856176 26.13380105236783 24.7557003257329 4 27.600902481825017 30.584106292303836 20.030082727500627 21.78490849837052 5 28.252694911005268 31.687139633993482 18.65129105038857 21.408874404612686 6 24.355444305381727 33.7171464330413 19.424280350438046 22.503128911138923 7 22.163786626596544 19.233658903080393 34.31004257450538 24.292511895817682 8 24.442774855997996 22.063611319809667 23.040320560981716 30.453293263210618 9 23.791635361883294 22.063611319809667 26.84698221888305 27.29777109942399 10-14 26.15122513403818 25.464749210803227 22.613619281455126 25.770406373703462 15-19 25.903825903825904 24.991224991224993 23.30642330642331 25.7985257985258 20-24 25.748683220466518 25.13167795334838 23.6568848758465 25.462753950338602 25-29 26.396627014003915 25.16689253626462 23.319781157456205 25.116699292275257 30-34 26.2962405260252 24.890829694323145 23.726346433770015 25.086583345881646 35-39 26.83954456538095 24.908461654210765 23.438832321813713 24.813161458594575 40-44 26.84883429430935 25.058912008022062 23.073451992980697 25.018801704687892 45-49 26.734857601283597 24.313076614520657 24.052346570397113 24.899719213798637 50-54 26.52692809146525 24.731721993781967 23.15214120950757 25.58920870524521 55-59 26.337964588453627 24.627576867131467 23.64949591212319 25.384962632291717 60-64 26.266425920353093 23.999398134216072 24.30534657438058 25.428829371050256 65-69 25.927040995534146 24.71774800541924 24.030307591951427 25.32490340709519 70-74 26.80272791094173 24.646474776852873 23.513188245913145 25.037609066292248 75-79 26.05117912694431 24.8469643753136 24.17962870045158 24.922227797290518 80-84 26.073865917302285 24.779205138498593 23.64010437575271 25.506824568446408 85-89 26.224407868325972 24.4731031714171 23.95624247290245 25.346246487354474 90-94 26.522218878523425 24.5310462433544 23.77369846524225 25.173036412879927 95-99 26.54964894684052 24.70912738214644 23.8716148445336 24.86960882647944 100-104 26.557015344499046 25.223147126667335 23.46805736636245 24.751780162471164 105-109 26.472949914684328 25.35380909364649 23.461808692160997 24.71143229950818 110-114 26.65127484440875 25.180686609114634 22.851836980526 25.316201565950614 115-119 27.445570382261465 25.1630380254841 22.910604996488413 24.480786595766027 120-124 27.169602971440042 25.55338051498268 23.144104803493452 24.132911710083825 125-129 28.004415675648552 25.896934116112195 22.800943348888556 23.297706859350694 130-134 28.398715762014646 25.820206682050767 22.825323567773655 22.955753988160932 135-139 28.056615137522584 25.7679180887372 22.575787994378636 23.599678779361575 140-144 28.09191711404345 26.546585720736545 22.216647433646077 23.14484973157393 145-149 28.734710246641264 26.669340284740322 21.515941447764185 23.08000802085422 150-151 29.061756231992987 26.706751847676312 21.35788550670174 22.87360641362896 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 3.0 2 2.0 3 0.5 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 0.5 26 1.0 27 3.0 28 3.5 29 6.5 30 7.5 31 5.0 32 7.5 33 14.5 34 21.5 35 25.0 36 38.5 37 55.0 38 67.0 39 84.0 40 101.0 41 119.0 42 149.0 43 156.5 44 149.5 45 163.5 46 182.0 47 174.0 48 159.0 49 159.0 50 141.0 51 130.5 52 124.0 53 115.0 54 124.0 55 111.5 56 92.5 57 92.0 58 93.5 59 96.0 60 98.0 61 89.0 62 91.0 63 87.5 64 74.5 65 74.0 66 69.5 67 68.5 68 62.5 69 59.0 70 52.5 71 46.5 72 39.0 73 28.5 74 24.5 75 18.0 76 10.5 77 7.0 78 6.0 79 2.0 80 1.0 81 1.0 82 0.5 83 0.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.22499999999999998 4 0.27499999999999997 5 0.27499999999999997 6 0.125 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.215 15-19 0.28500000000000003 20-24 0.325 25-29 0.385 30-34 0.385 35-39 0.315 40-44 0.27499999999999997 45-49 0.27999999999999997 50-54 0.29 55-59 0.315 60-64 0.31 65-69 0.35500000000000004 70-74 0.29 75-79 0.35000000000000003 80-84 0.36 85-89 0.36 90-94 0.31 95-99 0.3 100-104 0.29 105-109 0.37 110-114 0.38 115-119 0.33 120-124 0.385 125-129 0.35500000000000004 130-134 0.33 135-139 0.38 140-144 0.345 145-149 0.26 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8852292880669 97.575 2 0.9374208259437548 1.8499999999999999 3 0.12667848999239928 0.375 4 0.05067139599695972 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.475 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.2875 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.6375 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.5125 0.0 0.0 0.0 0.0 126-127 6.949999999999999 0.0 0.0 0.0 0.0 128-129 7.3875 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.162500000000001 0.0 0.0 0.0 0.0 134-135 8.6 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGTT 10 0.006830828 145.0 1 >>END_MODULE Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292971 spots for SRR5578461.sra Written 1292971 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra Read 1292956 spots for SRR5578461.sra Written 1292956 spots for SRR5578461.sra SRR ids: ['SRR5578461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsdiuqmy SRR5578461.sra spots: 25859135 blocks: [[1, 1292956], [1292957, 2585912], [2585913, 3878868], [3878869, 5171824], [5171825, 6464780], [6464781, 7757736], [7757737, 9050692], [9050693, 10343648], [10343649, 11636604], [11636605, 12929560], [12929561, 14222516], [14222517, 15515472], [15515473, 16808428], [16808429, 18101384], [18101385, 19394340], [19394341, 20687296], [20687297, 21980252], [21980253, 23273208], [23273209, 24566164], [24566165, 25859135]] SRR5578461 file size 8741111 SRR5578461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578461 SRR5578461_1.fastq SRR5578461_2.fastq Input file: SRR5578461_1.fastq Paired file: SRR5578461_2.fastq trimmed: SRR5578461-trimmed-pair1.fastq, SRR5578461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:50:31 2024 >> started Mon Dec 9 18:51:02 2024 >> done (30.714s) 25859135 read pairs processed; of these: 72231 ( 0.28%) short read pairs filtered out after trimming by size control 101575 ( 0.39%) empty read pairs filtered out after trimming by size control 25685329 (99.33%) read pairs available; of these: 14288896 (55.63%) trimmed read pairs available after processing 11396433 (44.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 14 0.00% 21 12 0.00% 22 17 0.00% 23 18 0.00% 24 18 0.00% 25 17 0.00% 26 29 0.00% 27 34 0.00% 28 23 0.00% 29 31 0.00% 30 31 0.00% 31 41 0.00% 32 41 0.00% 33 43 0.00% 34 42 0.00% 35 48 0.00% 36 46 0.00% 37 58 0.00% 38 60 0.00% 39 82 0.00% 40 104 0.00% 41 95 0.00% 42 110 0.00% 43 129 0.00% 44 131 0.00% 45 163 0.00% 46 191 0.00% 47 230 0.00% 48 228 0.00% 49 292 0.00% 50 335 0.00% 51 405 0.00% 52 483 0.00% 53 495 0.00% 54 588 0.00% 55 635 0.00% 56 646 0.00% 57 772 0.00% 58 953 0.00% 59 1084 0.00% 60 1278 0.00% 61 1367 0.01% 62 1684 0.01% 63 1873 0.01% 64 2036 0.01% 65 2308 0.01% 66 2494 0.01% 67 3006 0.01% 68 3258 0.01% 69 3937 0.02% 70 4452 0.02% 71 4823 0.02% 72 5554 0.02% 73 6388 0.02% 74 7035 0.03% 75 7768 0.03% 76 8538 0.03% 77 9569 0.04% 78 10570 0.04% 79 11945 0.05% 80 13730 0.05% 81 15220 0.06% 82 16943 0.07% 83 19024 0.07% 84 23019 0.09% 85 25501 0.10% 86 26826 0.10% 87 28119 0.11% 88 30704 0.12% 89 32218 0.13% 90 34539 0.13% 91 36919 0.14% 92 39426 0.15% 93 41658 0.16% 94 44546 0.17% 95 46903 0.18% 96 48801 0.19% 97 51088 0.20% 98 53424 0.21% 99 55860 0.22% 100 58514 0.23% 101 61902 0.24% 102 65103 0.25% 103 68281 0.27% 104 70770 0.28% 105 73114 0.28% 106 76588 0.30% 107 78797 0.31% 108 81029 0.32% 109 84128 0.33% 110 86319 0.34% 111 89518 0.35% 112 92444 0.36% 113 96782 0.38% 114 100156 0.39% 115 103917 0.40% 116 106382 0.41% 117 109153 0.42% 118 111142 0.43% 119 112829 0.44% 120 116541 0.45% 121 119633 0.47% 122 122334 0.48% 123 126925 0.49% 124 130541 0.51% 125 135106 0.53% 126 139076 0.54% 127 142020 0.55% 128 144170 0.56% 129 148293 0.58% 130 151400 0.59% 131 155381 0.60% 132 161122 0.63% 133 165594 0.64% 134 170253 0.66% 135 175233 0.68% 136 182389 0.71% 137 188419 0.73% 138 194638 0.76% 139 203873 0.79% 140 213982 0.83% 141 225704 0.88% 142 244162 0.95% 143 263137 1.02% 144 290384 1.13% 145 329878 1.28% 146 380685 1.48% 147 481046 1.87% 148 656085 2.55% 149 1127770 4.39% 150 4483110 17.45% 151 11396433 44.37% 25685329 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=12 prefix-density=0.91 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.20 sequence-density-rank=26 fanout-score=20.91 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=8.3 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=4.87 fanout-score-rank=14 prefix-density=0.80 prefix-fanout=3.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=31.73 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578461 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:51:52 Started mapping on | Dec 09 18:51:53 Finished on | Dec 09 18:55:48 Mapping speed, Million of reads per hour | 393.48 Number of input reads | 25685329 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 23911769 Uniquely mapped reads % | 93.10% Average mapped length | 285.59 Number of splices: Total | 23355424 Number of splices: Annotated (sjdb) | 22116015 Number of splices: GT/AG | 23056065 Number of splices: GC/AG | 272837 Number of splices: AT/AC | 10915 Number of splices: Non-canonical | 15607 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363990 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 51401 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 1.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1448412 1448412 1448412 N_multimapping 363990 363990 363990 N_noFeature 774647 23213404 983361 N_ambiguous 574385 2505 85588 UnstrandedReadsAssigned:22562737 PositiveStrandReadsAssigned:695860 NegativeStrandReadsAssigned:22842820 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5578461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578461-trimmed-pair1.fastq SRR5578461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,685,329 reads, 22,966,983 reads pseudoaligned [quant] estimated average fragment length: 231.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR5578461.ke.tsv 35125 SRR5578461.se.tsv 88098 total ==> SRR5578461.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.873 0 0 PNS24247 1044 813.603 47.2323 3.41995 PNS24249 1928 1697.6 78.7354 2.73229 PNS24246 1044 813.603 47.2323 3.41995 PNS24248 1044 813.603 47.2323 3.41995 PNS24244 1471 1240.6 104.568 4.96544 PNS24243 293 110.881 0 0 KQK14069 1603 1372.6 497.172 21.338 KQK14071 474 258.608 26.9922 6.14877 ==> SRR5578461.se.tsv <== BRADI_1g14170v3 628 BRADI_1g53295v3 75 BRADI_1g59795v3 758 BRADI_1g07683v3 2 BRADI_1g00485v3 47 BRADI_1g20270v3 2889 BRADI_1g74790v3 57 BRADI_1g09890v3 4 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR5578461 completed mapping pipeline successfully