Starting /dee2/code/volunteer_pipeline.sh SRR5578462 current disk space = 1522718572544 free memory = 1570965700 SRR5578462 SRAfilesize 6912f3918dbf7fa481b65d23279636df SRR5578462.sra SRR5578462.sra file validated SRR5578462 is paired end SRR5578462 is conventional basespace SRR5578462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18175 34.0 33.0 34.0 33.0 34.0 2 33.45075 34.0 34.0 34.0 33.0 34.0 3 33.4565 34.0 34.0 34.0 33.0 34.0 4 33.45075 34.0 34.0 34.0 33.0 34.0 5 33.39475 34.0 34.0 34.0 33.0 34.0 6 37.08175 38.0 38.0 38.0 36.0 38.0 7 37.355 38.0 38.0 38.0 37.0 38.0 8 37.3625 38.0 38.0 38.0 37.0 38.0 9 37.48525 38.0 38.0 38.0 37.0 38.0 10-14 37.428450000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.43730000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.4803 38.0 38.0 38.0 37.8 38.0 25-29 37.433550000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.4813 38.0 38.0 38.0 37.6 38.0 35-39 37.45125 38.0 38.0 38.0 37.4 38.0 40-44 37.369550000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3434 38.0 38.0 38.0 37.0 38.0 50-54 37.32365 38.0 38.0 38.0 37.0 38.0 55-59 37.24915 38.0 38.0 38.0 37.0 38.0 60-64 37.26105 38.0 38.0 38.0 37.0 38.0 65-69 37.25085 38.0 38.0 38.0 36.8 38.0 70-74 37.23805 38.0 38.0 38.0 37.0 38.0 75-79 37.19315 38.0 38.0 38.0 36.6 38.0 80-84 37.11005 38.0 38.0 38.0 36.0 38.0 85-89 37.040800000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.99105 38.0 38.0 38.0 36.0 38.0 95-99 36.8703 38.0 38.0 38.0 35.2 38.0 100-104 36.81949999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.7795 38.0 38.0 38.0 35.0 38.0 110-114 36.70264999999999 38.0 38.0 38.0 34.8 38.0 115-119 36.526650000000004 38.0 38.0 38.0 34.4 38.0 120-124 36.3738 38.0 38.0 38.0 34.0 38.0 125-129 36.33985 38.0 38.0 38.0 34.0 38.0 130-134 35.937850000000005 38.0 37.8 38.0 33.2 38.0 135-139 35.94535 38.0 38.0 38.0 33.0 38.0 140-144 35.555600000000005 38.0 36.8 38.0 31.2 38.0 145-149 35.0792 38.0 36.0 38.0 31.0 38.0 150-151 31.235375 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 2.0 19 3.0 20 4.0 21 2.0 22 4.0 23 4.0 24 10.0 25 11.0 26 11.0 27 18.0 28 28.0 29 26.0 30 32.0 31 38.0 32 65.0 33 58.0 34 98.0 35 172.0 36 435.0 37 2973.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.40967498110356 11.589821113630636 3.6029226505416982 38.39758125472411 2 20.25 13.325000000000001 40.825 25.6 3 20.8 17.7 26.950000000000003 34.55 4 27.675 24.224999999999998 21.85 26.25 5 26.424999999999997 29.625 23.0 20.95 6 21.475 32.65 23.674999999999997 22.2 7 17.95 22.275 40.75 19.025 8 18.25 21.925 31.525 28.299999999999997 9 20.474999999999998 19.925 32.9 26.700000000000003 10-14 23.24 26.07 25.2 25.490000000000002 15-19 23.32 25.230000000000004 25.21 26.240000000000002 20-24 23.445 25.21 25.7 25.645 25-29 23.26 25.840000000000003 25.105 25.795 30-34 23.615 25.825 25.174999999999997 25.385 35-39 23.65 24.875 25.795 25.679999999999996 40-44 23.335 24.98 25.385 26.3 45-49 23.375 25.715 24.995 25.915 50-54 23.599999999999998 24.645 25.735000000000003 26.02 55-59 23.935000000000002 25.35 25.180000000000003 25.535000000000004 60-64 23.549999999999997 25.25 25.119999999999997 26.08 65-69 24.044999999999998 25.124999999999996 25.45 25.380000000000003 70-74 23.48 25.505 25.035 25.979999999999997 75-79 24.265 25.385 24.88 25.47 80-84 24.099999999999998 25.185000000000002 25.155 25.56 85-89 24.42 24.805 25.11 25.665 90-94 23.845 24.465 25.45 26.240000000000002 95-99 23.525 24.75 26.07 25.655 100-104 23.985 25.669999999999998 24.725 25.619999999999997 105-109 23.95 25.185000000000002 25.155 25.71 110-114 24.325 24.91 25.224999999999998 25.540000000000003 115-119 24.404999999999998 24.745 24.845 26.005 120-124 24.185000000000002 25.61 24.72 25.485000000000003 125-129 23.89 25.040000000000003 24.58 26.490000000000002 130-134 24.64 25.205 24.89 25.264999999999997 135-139 24.62 25.330000000000002 24.42 25.629999999999995 140-144 24.555 25.069999999999997 24.654999999999998 25.72 145-149 24.2 25.405 24.795 25.6 150-151 25.112499999999997 25.025 24.3 25.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 1.0 25 1.5 26 2.0 27 3.0 28 2.5 29 3.5 30 8.5 31 12.5 32 15.0 33 20.0 34 28.5 35 36.0 36 40.0 37 59.0 38 75.0 39 89.5 40 126.5 41 155.5 42 185.5 43 192.0 44 191.0 45 208.0 46 195.5 47 176.5 48 183.5 49 191.5 50 175.0 51 150.5 52 121.5 53 108.5 54 99.5 55 87.5 56 80.0 57 72.0 58 75.5 59 78.0 60 79.0 61 72.5 62 59.0 63 57.0 64 62.0 65 60.0 66 56.0 67 49.0 68 44.0 69 42.0 70 42.5 71 37.5 72 22.5 73 18.5 74 16.0 75 9.5 76 6.0 77 4.5 78 4.0 79 2.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.77094542659492 95.39999999999999 2 1.9984627209838586 3.9 3 0.20497053548552396 0.6 4 0.025621316935690495 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.65 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.9625 0.0 0.0 0.0 0.0 136-137 8.537500000000001 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACAT 10 0.006830828 145.0 3 TTCGACA 10 0.006830828 145.0 2 AAATAAC 10 0.006830828 145.0 3 ACACGTC 40 0.005621335 54.375 145 >>END_MODULE SRR5578462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.783 33.0 32.0 33.0 28.0 34.0 2 32.01275 33.0 32.0 34.0 30.0 34.0 3 31.79575 33.0 33.0 34.0 29.0 34.0 4 31.87925 33.0 33.0 34.0 30.0 34.0 5 31.73975 33.0 33.0 34.0 29.0 34.0 6 35.86075 38.0 37.0 38.0 31.0 38.0 7 35.82975 38.0 37.0 38.0 31.0 38.0 8 35.693 38.0 37.0 38.0 29.0 38.0 9 35.8395 38.0 37.0 38.0 31.0 38.0 10-14 35.8237 38.0 37.0 38.0 31.0 38.0 15-19 35.737350000000006 38.0 37.0 38.0 30.6 38.0 20-24 35.54805 38.0 37.0 38.0 29.0 38.0 25-29 35.3466 38.0 37.0 38.0 29.0 38.0 30-34 35.2214 38.0 36.2 38.0 28.4 38.0 35-39 35.0092 38.0 36.0 38.0 28.0 38.0 40-44 34.805899999999994 38.0 36.0 38.0 27.0 38.0 45-49 34.59545 38.0 35.6 38.0 26.2 38.0 50-54 34.30159999999999 38.0 35.0 38.0 25.0 38.0 55-59 33.952349999999996 38.0 34.0 38.0 21.0 38.0 60-64 33.684 38.0 34.0 38.0 17.6 38.0 65-69 33.05585 37.4 33.2 38.0 16.0 38.0 70-74 32.86445 37.2 32.8 38.0 16.0 38.0 75-79 32.3981 37.0 31.6 38.0 15.4 38.0 80-84 31.695549999999997 37.0 29.0 38.0 15.0 38.0 85-89 31.2506 36.4 28.8 38.0 15.0 38.0 90-94 30.6135 35.8 27.2 38.0 14.4 38.0 95-99 29.905099999999997 35.0 25.2 38.0 13.6 38.0 100-104 28.996 34.4 23.0 38.0 13.0 38.0 105-109 28.475100000000005 34.2 21.8 38.0 10.8 38.0 110-114 27.321799999999996 34.0 15.0 38.0 2.0 38.0 115-119 26.23005 32.8 15.0 37.2 2.0 38.0 120-124 25.027299999999997 31.2 14.0 37.2 2.0 38.0 125-129 23.48925 28.2 13.0 36.0 2.0 38.0 130-134 22.06525 25.4 4.2 35.2 2.0 38.0 135-139 20.419549999999997 22.8 2.0 34.8 2.0 38.0 140-144 18.253449999999997 15.6 2.0 33.8 2.0 38.0 145-149 15.739800000000002 6.6 2.0 33.4 2.0 38.0 150-151 11.812875 2.0 2.0 28.0 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 6.0 4 13.0 5 3.0 6 6.0 7 9.0 8 9.0 9 10.0 10 11.0 11 18.0 12 16.0 13 16.0 14 22.0 15 23.0 16 20.0 17 41.0 18 36.0 19 46.0 20 41.0 21 63.0 22 72.0 23 79.0 24 96.0 25 134.0 26 130.0 27 149.0 28 178.0 29 215.0 30 241.0 31 259.0 32 345.0 33 343.0 34 444.0 35 423.0 36 377.0 37 80.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 23.7 5.7 30.599999999999998 2 26.065162907268167 24.285714285714285 32.45614035087719 17.192982456140353 3 20.857357733767863 24.442216094259212 29.93231386312359 24.768112308849336 4 24.191526698420656 32.53948357984457 20.205565304587616 23.063424417147154 5 26.698420656806217 35.29706693406869 19.303083479568812 18.70142892955628 6 22.375 35.325 20.849999999999998 21.45 7 22.43060765191298 18.879719929982496 36.33408352088022 22.355588897224308 8 21.2 22.875 26.924999999999997 28.999999999999996 9 23.1 20.9 28.449999999999996 27.55 10-14 25.539046475561562 25.894241833008152 22.98764320376207 25.579068487668216 15-19 26.171875 24.924879807692307 23.933293269230766 24.969951923076923 20-24 25.45591182364729 26.152304609218437 24.40380761523046 23.98797595190381 25-29 25.44826204547731 25.282981067815285 24.55173795452269 24.717018932184715 30-34 26.15638766519824 25.12515018021626 24.374249098918703 24.3442130556668 35-39 25.428142213319983 24.957436154231345 24.361542313470206 25.252879318978465 40-44 25.0751503006012 26.187374749499 24.46392785571142 24.273547094188377 45-49 25.53991080823771 25.49481384977702 24.537756175777922 24.427519166207347 50-54 26.161858974358974 25.430689102564102 24.103565705128204 24.303886217948715 55-59 26.27993187055405 24.81715258992085 24.190962829375813 24.711952710149284 60-64 26.405733186328558 24.255788313120178 25.09271324045304 24.245765260098224 65-69 25.29559118236473 25.98697394789579 24.118236472945892 24.599198396793586 70-74 25.554498573073648 24.34786962399239 25.639613478195567 24.458018324738397 75-79 25.16406993637593 24.798356795751715 24.452682731326085 25.58489053654627 80-84 25.48852590439924 25.523599559074057 24.346126866419482 24.641747670107225 85-89 25.247971145175836 25.36319006111612 24.27111511872558 25.117723674982468 90-94 25.852144751989588 25.6669502978127 24.145352620251266 24.335552329946445 95-99 25.503658414353016 25.784303898967625 24.386088002405533 24.32594968427383 100-104 26.52099829608099 25.157863085095723 23.584243760649493 24.736894858173798 105-109 25.667618618167243 25.657598076055915 24.279773535748284 24.395009770028558 110-114 25.54642069380389 25.65670743934229 23.781832765189492 25.01503910166433 115-119 25.81938458454445 25.85947679663225 23.574220707627543 24.74691791119575 120-124 26.269912834385334 25.56357078449053 23.634906322011823 24.531610059112314 125-129 26.411502429737986 26.25118982014929 23.069986473623565 24.267321276489152 130-134 26.851759045805352 25.724165580835923 23.06304500350807 24.361030369850656 135-139 26.928084935897434 26.171875 23.62780448717949 23.272235576923077 140-144 27.252263518583362 26.15176829573308 23.000350157570907 23.59561802811265 145-149 26.672337019062393 27.567919147445842 21.79416620803522 23.965577625456547 150-151 28.32811521603006 27.326236693800876 21.202254226675016 23.14339386349405 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 0.5 26 2.0 27 3.0 28 5.5 29 9.0 30 12.5 31 12.0 32 16.0 33 19.5 34 20.0 35 35.0 36 54.0 37 64.0 38 68.5 39 83.5 40 114.0 41 145.5 42 159.5 43 167.5 44 179.0 45 185.5 46 181.0 47 175.0 48 182.5 49 182.5 50 172.0 51 149.0 52 114.0 53 97.5 54 94.5 55 92.5 56 85.0 57 81.5 58 85.0 59 90.0 60 86.5 61 80.5 62 82.5 63 80.5 64 78.0 65 67.0 66 59.5 67 59.0 68 52.5 69 48.0 70 37.5 71 28.5 72 27.0 73 21.0 74 15.5 75 10.5 76 8.0 77 5.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.055 15-19 0.16 20-24 0.2 25-29 0.16999999999999998 30-34 0.12 35-39 0.15 40-44 0.2 45-49 0.215 50-54 0.16 55-59 0.19 60-64 0.22999999999999998 65-69 0.2 70-74 0.135 75-79 0.19499999999999998 80-84 0.21 85-89 0.19 90-94 0.105 95-99 0.22999999999999998 100-104 0.22999999999999998 105-109 0.20500000000000002 110-114 0.26 115-119 0.22999999999999998 120-124 0.19 125-129 0.19499999999999998 130-134 0.22999999999999998 135-139 0.16 140-144 0.045 145-149 0.065 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00256081946223 95.675 2 1.6389244558258642 3.2 3 0.3072983354673495 0.8999999999999999 4 0.02560819462227913 0.1 5 0.02560819462227913 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0125 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.037500000000000006 0.0 0.025 0.0 0.0 62-63 0.05 0.0 0.025 0.0 0.0 64-65 0.05 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.0625 0.0 0.025 0.0 0.0 72-73 0.075 0.0 0.025 0.0 0.0 74-75 0.075 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.0875 0.0 0.025 0.0 0.0 80-81 0.15 0.0 0.025 0.0 0.0 82-83 0.175 0.0 0.025 0.0 0.0 84-85 0.175 0.0 0.025 0.0 0.0 86-87 0.225 0.0 0.025 0.0 0.0 88-89 0.35 0.0 0.025 0.0 0.0 90-91 0.525 0.0 0.025 0.0 0.0 92-93 0.65 0.0 0.025 0.0 0.0 94-95 0.7375 0.0 0.025 0.0 0.0 96-97 0.825 0.0 0.025 0.0 0.0 98-99 0.8875 0.0 0.025 0.0 0.0 100-101 0.9624999999999999 0.0 0.025 0.0 0.0 102-103 1.025 0.0 0.025 0.0 0.0 104-105 1.0875 0.0 0.025 0.0 0.0 106-107 1.225 0.0 0.025 0.0 0.0 108-109 1.3250000000000002 0.0 0.025 0.0 0.0 110-111 1.4125 0.0 0.025 0.0 0.0 112-113 1.575 0.0 0.025 0.0 0.0 114-115 1.7375 0.0 0.025 0.0 0.0 116-117 1.8125 0.0 0.025 0.0 0.0 118-119 2.025 0.0 0.025 0.0 0.0 120-121 2.3 0.0 0.025 0.0 0.0 122-123 2.5125 0.0 0.025 0.0 0.0 124-125 2.6875 0.0 0.025 0.0 0.0 126-127 2.9375 0.0 0.025 0.0 0.0 128-129 3.25 0.0 0.025 0.0 0.0 130-131 3.4875 0.0 0.025 0.0 0.0 132-133 3.8125 0.0 0.025 0.0 0.0 134-135 4.1625 0.0 0.025 0.0 0.0 136-137 4.4125 0.0 0.025 0.0 0.0 138-139 4.5125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.0061106835 28.8275 135-139 >>END_MODULE Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929558 spots for SRR5578462.sra Written 929558 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra Read 929542 spots for SRR5578462.sra Written 929542 spots for SRR5578462.sra SRR ids: ['SRR5578462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3pgqi8bg SRR5578462.sra spots: 18590856 blocks: [[1, 929542], [929543, 1859084], [1859085, 2788626], [2788627, 3718168], [3718169, 4647710], [4647711, 5577252], [5577253, 6506794], [6506795, 7436336], [7436337, 8365878], [8365879, 9295420], [9295421, 10224962], [10224963, 11154504], [11154505, 12084046], [12084047, 13013588], [13013589, 13943130], [13943131, 14872672], [14872673, 15802214], [15802215, 16731756], [16731757, 17661298], [17661299, 18590856]] SRR5578462 file size 6278130 SRR5578462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578462 SRR5578462_1.fastq SRR5578462_2.fastq Input file: SRR5578462_1.fastq Paired file: SRR5578462_2.fastq trimmed: SRR5578462-trimmed-pair1.fastq, SRR5578462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:50:12 2024 >> started Mon Dec 9 18:50:34 2024 >> done (21.905s) 18590856 read pairs processed; of these: 43751 ( 0.24%) short read pairs filtered out after trimming by size control 62464 ( 0.34%) empty read pairs filtered out after trimming by size control 18484641 (99.43%) read pairs available; of these: 9994882 (54.07%) trimmed read pairs available after processing 8489759 (45.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 12 0.00% 20 14 0.00% 21 22 0.00% 22 16 0.00% 23 23 0.00% 24 25 0.00% 25 30 0.00% 26 28 0.00% 27 33 0.00% 28 43 0.00% 29 42 0.00% 30 51 0.00% 31 46 0.00% 32 33 0.00% 33 58 0.00% 34 47 0.00% 35 41 0.00% 36 62 0.00% 37 51 0.00% 38 45 0.00% 39 68 0.00% 40 60 0.00% 41 54 0.00% 42 75 0.00% 43 59 0.00% 44 78 0.00% 45 95 0.00% 46 94 0.00% 47 107 0.00% 48 107 0.00% 49 127 0.00% 50 162 0.00% 51 174 0.00% 52 176 0.00% 53 226 0.00% 54 204 0.00% 55 251 0.00% 56 253 0.00% 57 308 0.00% 58 332 0.00% 59 357 0.00% 60 435 0.00% 61 509 0.00% 62 582 0.00% 63 615 0.00% 64 707 0.00% 65 839 0.00% 66 987 0.01% 67 1047 0.01% 68 1193 0.01% 69 1461 0.01% 70 1748 0.01% 71 1534 0.01% 72 1908 0.01% 73 2156 0.01% 74 2420 0.01% 75 2758 0.01% 76 2940 0.02% 77 3367 0.02% 78 3720 0.02% 79 4285 0.02% 80 4663 0.03% 81 5354 0.03% 82 6102 0.03% 83 6873 0.04% 84 9243 0.05% 85 10667 0.06% 86 10785 0.06% 87 11904 0.06% 88 12233 0.07% 89 13001 0.07% 90 13546 0.07% 91 14493 0.08% 92 15024 0.08% 93 16340 0.09% 94 17975 0.10% 95 18534 0.10% 96 19553 0.11% 97 20679 0.11% 98 21459 0.12% 99 23089 0.12% 100 24005 0.13% 101 25534 0.14% 102 26892 0.15% 103 28609 0.15% 104 30471 0.16% 105 31325 0.17% 106 33565 0.18% 107 35416 0.19% 108 36223 0.20% 109 38465 0.21% 110 39390 0.21% 111 42386 0.23% 112 44275 0.24% 113 45528 0.25% 114 48571 0.26% 115 51840 0.28% 116 53380 0.29% 117 56245 0.30% 118 57706 0.31% 119 59579 0.32% 120 62790 0.34% 121 64709 0.35% 122 68041 0.37% 123 69969 0.38% 124 73971 0.40% 125 76358 0.41% 126 81168 0.44% 127 83276 0.45% 128 87021 0.47% 129 91489 0.49% 130 94935 0.51% 131 99598 0.54% 132 103215 0.56% 133 106876 0.58% 134 112372 0.61% 135 118281 0.64% 136 124021 0.67% 137 131497 0.71% 138 139267 0.75% 139 148655 0.80% 140 159311 0.86% 141 172191 0.93% 142 190267 1.03% 143 205303 1.11% 144 228036 1.23% 145 261619 1.42% 146 308512 1.67% 147 396540 2.15% 148 554247 3.00% 149 931927 5.04% 150 3529179 19.09% 151 8489759 45.93% 18484641 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=19 prefix-density=1.26 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=31 fanout-score=13.49 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCCT criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.90 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=42.68 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.3 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578462 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:51:29 Started mapping on | Dec 09 18:51:29 Finished on | Dec 09 18:54:38 Mapping speed, Million of reads per hour | 352.09 Number of input reads | 18484641 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17591964 Uniquely mapped reads % | 95.17% Average mapped length | 289.91 Number of splices: Total | 18985096 Number of splices: Annotated (sjdb) | 17982789 Number of splices: GT/AG | 18736203 Number of splices: GC/AG | 231011 Number of splices: AT/AC | 6177 Number of splices: Non-canonical | 11705 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153045 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 18083 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765265 765265 765265 N_multimapping 153045 153045 153045 N_noFeature 642857 17062812 786776 N_ambiguous 454037 2008 70161 UnstrandedReadsAssigned:16495070 PositiveStrandReadsAssigned:527144 NegativeStrandReadsAssigned:16735027 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR5578462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578462-trimmed-pair1.fastq SRR5578462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,484,641 reads, 16,761,161 reads pseudoaligned [quant] estimated average fragment length: 247.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52973 SRR5578462.ke.tsv 35125 SRR5578462.se.tsv 88098 total ==> SRR5578462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.078 0 0 PNS24247 1044 797.502 22.8056 2.47124 PNS24249 1928 1681.5 19.2875 0.99125 PNS24246 1044 797.502 22.8056 2.47124 PNS24248 1044 797.502 22.8056 2.47124 PNS24244 1471 1224.5 71.2959 5.03165 PNS24243 293 99.1956 0 0 KQK14069 1603 1356.5 1939.33 123.549 KQK14071 474 244.281 86.9943 30.7756 ==> SRR5578462.se.tsv <== BRADI_1g14170v3 2512 BRADI_1g53295v3 85 BRADI_1g59795v3 765 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 203 BRADI_1g74790v3 31 BRADI_1g09890v3 0 BRADI_1g77505v3 169 BRADI_1g48960v3 0 SRR5578462 completed mapping pipeline successfully