Starting /dee2/code/volunteer_pipeline.sh SRR5578465 current disk space = 1522633740288 free memory = 1580360996 SRR5578465 SRAfilesize 50063925fd9913fb419b95b2519a12de SRR5578465.sra SRR5578465.sra file validated SRR5578465 is paired end SRR5578465 is conventional basespace SRR5578465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34225 34.0 33.0 34.0 32.0 34.0 2 33.28525 34.0 34.0 34.0 33.0 34.0 3 33.383 34.0 34.0 34.0 33.0 34.0 4 33.49775 34.0 34.0 34.0 33.0 34.0 5 33.50825 34.0 34.0 34.0 33.0 34.0 6 37.2515 38.0 38.0 38.0 36.0 38.0 7 37.5545 38.0 38.0 38.0 37.0 38.0 8 37.4925 38.0 38.0 38.0 38.0 38.0 9 37.57775 38.0 38.0 38.0 38.0 38.0 10-14 37.571600000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.5792 38.0 38.0 38.0 38.0 38.0 20-24 37.5924 38.0 38.0 38.0 38.0 38.0 25-29 37.5744 38.0 38.0 38.0 38.0 38.0 30-34 37.52075 38.0 38.0 38.0 38.0 38.0 35-39 37.51095 38.0 38.0 38.0 38.0 38.0 40-44 37.43095 38.0 38.0 38.0 37.0 38.0 45-49 37.3815 38.0 38.0 38.0 37.0 38.0 50-54 37.311099999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.25425 38.0 38.0 38.0 36.8 38.0 60-64 37.20115 38.0 38.0 38.0 36.6 38.0 65-69 37.2046 38.0 38.0 38.0 36.2 38.0 70-74 37.0761 38.0 38.0 38.0 36.0 38.0 75-79 37.0912 38.0 38.0 38.0 36.0 38.0 80-84 36.98715 38.0 38.0 38.0 35.8 38.0 85-89 36.866200000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.75364999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.59155 38.0 38.0 38.0 34.2 38.0 100-104 36.565549999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.3482 38.0 38.0 38.0 34.0 38.0 110-114 36.202099999999994 38.0 38.0 38.0 33.6 38.0 115-119 35.91629999999999 38.0 37.0 38.0 32.8 38.0 120-124 35.73775 38.0 36.0 38.0 32.0 38.0 125-129 35.580799999999996 38.0 36.0 38.0 31.2 38.0 130-134 35.32675 38.0 36.0 38.0 31.0 38.0 135-139 34.98495 38.0 35.8 38.0 29.2 38.0 140-144 34.47995 38.0 35.0 38.0 26.4 38.0 145-149 33.8858 38.0 35.0 38.0 23.8 38.0 150-151 29.471 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 3.0 17 6.0 18 1.0 19 3.0 20 2.0 21 4.0 22 5.0 23 7.0 24 10.0 25 12.0 26 10.0 27 19.0 28 20.0 29 35.0 30 36.0 31 52.0 32 51.0 33 76.0 34 133.0 35 244.0 36 654.0 37 2610.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.29164504411002 10.897768552153607 9.133367929423974 35.677218474312404 2 24.3 13.200000000000001 32.824999999999996 29.675 3 22.925 18.4 22.7 35.975 4 27.85 25.224999999999998 20.775 26.150000000000002 5 27.670753064798596 28.621466099574683 21.4160620465349 22.291718789091817 6 24.675 30.575000000000003 21.825 22.925 7 18.275 22.650000000000002 38.2 20.875 8 21.099999999999998 22.1 29.425 27.375 9 20.474999999999998 22.0 31.474999999999998 26.05 10-14 23.674999999999997 25.724999999999998 24.83 25.77 15-19 23.69 24.43 25.629999999999995 26.25 20-24 23.995 24.575 25.365 26.064999999999998 25-29 23.985 25.16 25.040000000000003 25.814999999999998 30-34 24.375 24.43 25.03 26.165 35-39 23.9 24.36 25.055 26.685 40-44 24.29 24.22 25.275 26.215 45-49 24.375 24.345 25.174999999999997 26.105 50-54 24.315 23.995 25.230000000000004 26.46 55-59 24.68 24.175 24.725 26.419999999999998 60-64 24.23 24.125 24.695 26.950000000000003 65-69 24.69 24.165 24.87 26.275 70-74 24.355 24.135 25.230000000000004 26.279999999999998 75-79 24.87 23.794999999999998 24.83 26.505000000000003 80-84 24.785 24.060000000000002 24.705 26.450000000000003 85-89 24.67 23.78 25.09 26.46 90-94 25.695 24.365000000000002 24.315 25.624999999999996 95-99 24.985 23.845 25.045 26.125 100-104 25.28 24.104999999999997 24.465 26.150000000000002 105-109 24.93 24.36 24.68 26.029999999999998 110-114 24.86 24.47 24.69 25.979999999999997 115-119 25.285000000000004 24.305 24.535 25.874999999999996 120-124 25.465 24.834999999999997 23.345 26.355 125-129 25.395 24.505 23.849999999999998 26.25 130-134 25.290000000000003 23.935000000000002 24.52 26.255 135-139 24.425 25.069999999999997 24.044999999999998 26.46 140-144 24.685000000000002 24.795 24.055 26.465 145-149 24.709999999999997 24.41 24.18 26.700000000000003 150-151 24.88738738738739 24.78728728728729 24.074074074074073 26.25125125125125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 4.0 28 2.5 29 1.5 30 6.0 31 15.5 32 18.5 33 18.0 34 22.5 35 33.5 36 48.0 37 58.0 38 67.5 39 90.5 40 116.5 41 136.5 42 152.5 43 158.0 44 167.5 45 176.0 46 183.5 47 184.0 48 169.0 49 153.5 50 146.0 51 128.5 52 111.5 53 105.0 54 98.0 55 104.5 56 103.5 57 92.5 58 88.0 59 89.5 60 92.5 61 99.5 62 87.0 63 80.5 64 83.0 65 66.5 66 61.0 67 67.0 68 59.5 69 47.0 70 49.0 71 40.0 72 28.5 73 22.0 74 16.0 75 16.5 76 14.0 77 7.0 78 3.5 79 3.5 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39408615855213 96.5 2 1.325516186591894 2.6 3 0.22941626306398166 0.675 4 0.025490695895997964 0.1 5 0.025490695895997964 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3875 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 4.3375 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.4625 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.4125 0.0 0.0 0.0 0.0 122-123 6.9375 0.0 0.0 0.0 0.0 124-125 7.5375 0.0 0.0 0.0 0.0 126-127 8.175 0.0 0.0 0.0 0.0 128-129 9.1 0.0 0.0 0.0 0.0 130-131 9.7 0.0 0.0 0.0 0.0 132-133 10.45 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.2375 0.0 0.0 0.0 0.0 138-139 13.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.043 33.0 33.0 34.0 32.0 34.0 2 33.1215 34.0 33.0 34.0 33.0 34.0 3 33.11025 34.0 33.0 34.0 33.0 34.0 4 33.0835 34.0 33.0 34.0 33.0 34.0 5 33.11 34.0 33.0 34.0 33.0 34.0 6 37.31625 38.0 38.0 38.0 37.0 38.0 7 37.36425 38.0 38.0 38.0 37.0 38.0 8 37.31825 38.0 38.0 38.0 37.0 38.0 9 37.31125 38.0 38.0 38.0 37.0 38.0 10-14 37.319050000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.23075 38.0 38.0 38.0 37.0 38.0 20-24 37.23535 38.0 38.0 38.0 37.0 38.0 25-29 37.23155 38.0 38.0 38.0 37.0 38.0 30-34 37.29225 38.0 38.0 38.0 37.4 38.0 35-39 37.289249999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.2712 38.0 38.0 38.0 37.2 38.0 45-49 37.248149999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.23955 38.0 38.0 38.0 37.0 38.0 55-59 37.1846 38.0 38.0 38.0 37.0 38.0 60-64 37.15915 38.0 38.0 38.0 37.0 38.0 65-69 37.032 38.0 38.0 38.0 36.4 38.0 70-74 37.0133 38.0 38.0 38.0 36.0 38.0 75-79 36.9097 38.0 38.0 38.0 36.0 38.0 80-84 36.86955 38.0 38.0 38.0 36.0 38.0 85-89 36.7185 38.0 38.0 38.0 35.2 38.0 90-94 36.630449999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.507600000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.317750000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.16735 38.0 38.0 38.0 34.0 38.0 110-114 35.96585 38.0 38.0 38.0 33.2 38.0 115-119 35.710550000000005 38.0 38.0 38.0 33.0 38.0 120-124 35.431349999999995 38.0 36.6 38.0 31.4 38.0 125-129 35.2781 38.0 36.2 38.0 30.6 38.0 130-134 34.83775 38.0 36.0 38.0 27.8 38.0 135-139 34.17355 38.0 34.8 38.0 24.6 38.0 140-144 33.5278 38.0 33.0 38.0 22.2 38.0 145-149 32.07295 38.0 33.0 38.0 8.2 38.0 150-151 26.447125 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 4.0 15 5.0 16 0.0 17 9.0 18 6.0 19 6.0 20 4.0 21 5.0 22 17.0 23 10.0 24 11.0 25 14.0 26 14.0 27 19.0 28 36.0 29 19.0 30 54.0 31 56.0 32 74.0 33 91.0 34 138.0 35 222.0 36 620.0 37 2547.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.67083541770886 16.03301650825413 11.080540270135067 31.21560780390195 2 29.45 22.95 25.85 21.75 3 25.087543771885944 25.48774387193597 24.7623811905953 24.662331165582792 4 27.66383191595798 31.265632816408207 18.3591795897949 22.71135567783892 5 27.838919459729865 33.49174587293647 17.808904452226113 20.860430215107552 6 22.425 34.575 19.875 23.125 7 22.650000000000002 16.525000000000002 34.35 26.474999999999998 8 22.725 23.1 23.925 30.25 9 23.825 24.125 25.275 26.775 10-14 26.39 25.4 22.264999999999997 25.945 15-19 25.91 24.82 23.775 25.495 20-24 26.685 24.52 23.445 25.35 25-29 26.534999999999997 24.255 23.205000000000002 26.005 30-34 25.869999999999997 24.884999999999998 23.205000000000002 26.040000000000003 35-39 26.455000000000002 24.385 23.13 26.029999999999998 40-44 26.939999999999998 24.315 22.795 25.95 45-49 26.855 24.69 22.8 25.655 50-54 26.345000000000002 24.14 23.69 25.825 55-59 26.395000000000003 23.805 23.799999999999997 26.0 60-64 26.33 24.025 23.74 25.905 65-69 26.445 24.63 23.54 25.385 70-74 26.695 24.240000000000002 23.96 25.105 75-79 26.826341317065854 23.986199309965496 23.711185559277965 25.476273813690685 80-84 26.355 24.169999999999998 23.82 25.655 85-89 26.495 24.13 23.89 25.485000000000003 90-94 26.540000000000003 24.575 23.955000000000002 24.93 95-99 26.810000000000002 25.009999999999998 23.155 25.025 100-104 26.919999999999998 24.82 22.975 25.285000000000004 105-109 27.150000000000002 24.57 23.525 24.755 110-114 27.245 25.15 22.95 24.654999999999998 115-119 26.875 25.009999999999998 23.13 24.985 120-124 27.49 25.145 23.145 24.22 125-129 28.005000000000003 24.834999999999997 22.855 24.305 130-134 27.875 24.875 23.39 23.86 135-139 28.194999999999997 25.990000000000002 22.98 22.835 140-144 28.175 25.825 23.315 22.685 145-149 28.915000000000003 25.7 22.98 22.405 150-151 29.362500000000004 25.124999999999996 22.787499999999998 22.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.0 29 4.0 30 4.5 31 4.0 32 8.0 33 10.5 34 14.5 35 24.5 36 37.0 37 46.0 38 57.5 39 81.0 40 107.5 41 119.0 42 122.5 43 141.5 44 168.5 45 162.0 46 139.5 47 145.5 48 155.0 49 156.5 50 157.0 51 149.5 52 124.0 53 118.5 54 127.0 55 113.5 56 101.0 57 105.0 58 119.0 59 101.5 60 94.0 61 106.0 62 98.0 63 91.5 64 84.0 65 82.0 66 81.5 67 77.0 68 67.5 69 58.5 70 59.0 71 53.0 72 39.0 73 27.0 74 18.0 75 11.5 76 8.0 77 4.0 78 2.5 79 2.0 80 1.0 81 0.5 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.25997952917092 96.0 2 1.3561924257932445 2.65 3 0.23029682702149437 0.675 4 0.127942681678608 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0255885363357216 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.300000000000001 0.0 0.0 0.0 0.0 114-115 4.8625 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 5.8375 0.0 0.0 0.0 0.0 120-121 6.375 0.0 0.0 0.0 0.0 122-123 6.925000000000001 0.0 0.0 0.0 0.0 124-125 7.5625 0.0 0.0 0.0 0.0 126-127 8.2625 0.0 0.0 0.0 0.0 128-129 9.2125 0.0 0.0 0.0 0.0 130-131 9.825 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.537500000000001 0.0 0.0 0.0 0.0 136-137 12.4125 0.0 0.0 0.0 0.0 138-139 13.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912284 spots for SRR5578465.sra Written 912284 spots for SRR5578465.sra Read 912285 spots for SRR5578465.sra Written 912285 spots for SRR5578465.sra SRR ids: ['SRR5578465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pvde25m0 SRR5578465.sra spots: 18245681 blocks: [[1, 912284], [912285, 1824568], [1824569, 2736852], [2736853, 3649136], [3649137, 4561420], [4561421, 5473704], [5473705, 6385988], [6385989, 7298272], [7298273, 8210556], [8210557, 9122840], [9122841, 10035124], [10035125, 10947408], [10947409, 11859692], [11859693, 12771976], [12771977, 13684260], [13684261, 14596544], [14596545, 15508828], [15508829, 16421112], [16421113, 17333396], [17333397, 18245681]] SRR5578465 file size 6161162 SRR5578465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578465 SRR5578465_1.fastq SRR5578465_2.fastq Input file: SRR5578465_1.fastq Paired file: SRR5578465_2.fastq trimmed: SRR5578465-trimmed-pair1.fastq, SRR5578465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:59:14 2024 >> started Mon Dec 9 18:59:34 2024 >> done (19.985s) 18245681 read pairs processed; of these: 15498 ( 0.08%) short read pairs filtered out after trimming by size control 16662 ( 0.09%) empty read pairs filtered out after trimming by size control 18213521 (99.82%) read pairs available; of these: 9607055 (52.75%) trimmed read pairs available after processing 8606466 (47.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 12 0.00% 21 12 0.00% 22 11 0.00% 23 13 0.00% 24 22 0.00% 25 14 0.00% 26 13 0.00% 27 17 0.00% 28 22 0.00% 29 17 0.00% 30 27 0.00% 31 19 0.00% 32 24 0.00% 33 23 0.00% 34 28 0.00% 35 33 0.00% 36 27 0.00% 37 33 0.00% 38 48 0.00% 39 45 0.00% 40 57 0.00% 41 59 0.00% 42 67 0.00% 43 71 0.00% 44 71 0.00% 45 82 0.00% 46 87 0.00% 47 103 0.00% 48 139 0.00% 49 145 0.00% 50 173 0.00% 51 205 0.00% 52 197 0.00% 53 270 0.00% 54 266 0.00% 55 273 0.00% 56 330 0.00% 57 365 0.00% 58 464 0.00% 59 485 0.00% 60 558 0.00% 61 685 0.00% 62 848 0.00% 63 813 0.00% 64 978 0.01% 65 1106 0.01% 66 1276 0.01% 67 1429 0.01% 68 1741 0.01% 69 2315 0.01% 70 2579 0.01% 71 2504 0.01% 72 2868 0.02% 73 3178 0.02% 74 3647 0.02% 75 3982 0.02% 76 4322 0.02% 77 4882 0.03% 78 5471 0.03% 79 5999 0.03% 80 6961 0.04% 81 7746 0.04% 82 8666 0.05% 83 9522 0.05% 84 11295 0.06% 85 12685 0.07% 86 13451 0.07% 87 14639 0.08% 88 15517 0.09% 89 16185 0.09% 90 17539 0.10% 91 18851 0.10% 92 20050 0.11% 93 21809 0.12% 94 23580 0.13% 95 24479 0.13% 96 25883 0.14% 97 27252 0.15% 98 28121 0.15% 99 30249 0.17% 100 31682 0.17% 101 33103 0.18% 102 35063 0.19% 103 36676 0.20% 104 38218 0.21% 105 40083 0.22% 106 42452 0.23% 107 43387 0.24% 108 44796 0.25% 109 45969 0.25% 110 47887 0.26% 111 49409 0.27% 112 51404 0.28% 113 53838 0.30% 114 56289 0.31% 115 58326 0.32% 116 59775 0.33% 117 61547 0.34% 118 62757 0.34% 119 63304 0.35% 120 65499 0.36% 121 66405 0.36% 122 68548 0.38% 123 70887 0.39% 124 73655 0.40% 125 75981 0.42% 126 79083 0.43% 127 79522 0.44% 128 80658 0.44% 129 82414 0.45% 130 84859 0.47% 131 85843 0.47% 132 89352 0.49% 133 91492 0.50% 134 94262 0.52% 135 96563 0.53% 136 99456 0.55% 137 101970 0.56% 138 105998 0.58% 139 111120 0.61% 140 115164 0.63% 141 122068 0.67% 142 130939 0.72% 143 139882 0.77% 144 154900 0.85% 145 177167 0.97% 146 209812 1.15% 147 268992 1.48% 148 392591 2.16% 149 776068 4.26% 150 4049889 22.24% 151 8606466 47.25% 18213521 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=15 prefix-density=0.99 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=64.28 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.0 sequence=ATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=17 prefix-density=0.66 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=45.49 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=3.4 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578465 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:00:28 Started mapping on | Dec 09 19:00:28 Finished on | Dec 09 19:06:12 Mapping speed, Million of reads per hour | 190.61 Number of input reads | 18213521 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16968754 Uniquely mapped reads % | 93.17% Average mapped length | 289.20 Number of splices: Total | 17346779 Number of splices: Annotated (sjdb) | 16407520 Number of splices: GT/AG | 17126059 Number of splices: GC/AG | 204524 Number of splices: AT/AC | 5376 Number of splices: Non-canonical | 10820 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184695 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 16308 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.26% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1071258 1071258 1071258 N_multimapping 184695 184695 184695 N_noFeature 494498 16472877 622175 N_ambiguous 438542 1775 71917 UnstrandedReadsAssigned:16035714 PositiveStrandReadsAssigned:494102 NegativeStrandReadsAssigned:16274662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5578465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578465-trimmed-pair1.fastq SRR5578465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,213,521 reads, 16,295,010 reads pseudoaligned [quant] estimated average fragment length: 232.339 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52973 SRR5578465.ke.tsv 35125 SRR5578465.se.tsv 88098 total ==> SRR5578465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.055 0 0 PNS24247 1044 812.661 26.9062 2.70494 PNS24249 1928 1696.66 25.7958 1.24213 PNS24246 1044 812.661 26.9062 2.70494 PNS24248 1044 812.661 26.9062 2.70494 PNS24244 1471 1239.66 73.4857 4.84301 PNS24243 293 108.596 0 0 KQK14069 1603 1371.66 1937.21 115.384 KQK14071 474 257.183 47.7213 15.1595 ==> SRR5578465.se.tsv <== BRADI_1g14170v3 2168 BRADI_1g53295v3 87 BRADI_1g59795v3 498 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 149 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 270 BRADI_1g48960v3 0 SRR5578465 completed mapping pipeline successfully