Starting /dee2/code/volunteer_pipeline.sh SRR5578466 current disk space = 1522646249472 free memory = 1409922272 SRR5578466 SRAfilesize 9f3df55fae54ddcbd66e22abd094033d SRR5578466.sra SRR5578466.sra file validated SRR5578466 is paired end SRR5578466 is conventional basespace SRR5578466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26625 34.0 33.0 34.0 33.0 34.0 2 33.42925 34.0 34.0 34.0 33.0 34.0 3 33.42875 34.0 34.0 34.0 33.0 34.0 4 33.366 34.0 34.0 34.0 33.0 34.0 5 33.3605 34.0 34.0 34.0 33.0 34.0 6 37.035 38.0 38.0 38.0 36.0 38.0 7 37.303 38.0 38.0 38.0 37.0 38.0 8 37.3985 38.0 38.0 38.0 37.0 38.0 9 37.4165 38.0 38.0 38.0 37.0 38.0 10-14 37.44285 38.0 38.0 38.0 37.0 38.0 15-19 37.411649999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.42165 38.0 38.0 38.0 37.2 38.0 25-29 37.40855 38.0 38.0 38.0 37.4 38.0 30-34 37.4111 38.0 38.0 38.0 37.4 38.0 35-39 37.3867 38.0 38.0 38.0 37.4 38.0 40-44 37.26369999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.268649999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.218849999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.1811 38.0 38.0 38.0 36.4 38.0 60-64 37.2164 38.0 38.0 38.0 37.0 38.0 65-69 37.180099999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.1229 38.0 38.0 38.0 36.2 38.0 75-79 37.00095 38.0 38.0 38.0 36.0 38.0 80-84 36.988299999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.89765 38.0 38.0 38.0 35.4 38.0 90-94 36.8748 38.0 38.0 38.0 35.0 38.0 95-99 36.79065000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.69405 38.0 38.0 38.0 35.0 38.0 105-109 36.5619 38.0 38.0 38.0 34.0 38.0 110-114 36.5025 38.0 38.0 38.0 34.0 38.0 115-119 36.34439999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.21555 38.0 38.0 38.0 33.6 38.0 125-129 36.043899999999994 38.0 37.8 38.0 33.2 38.0 130-134 35.812050000000006 38.0 37.2 38.0 33.0 38.0 135-139 35.57315 38.0 36.2 38.0 31.6 38.0 140-144 35.215199999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.85435 38.0 36.0 38.0 29.4 38.0 150-151 31.452624999999998 35.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 4.0 20 3.0 21 5.0 22 4.0 23 5.0 24 4.0 25 12.0 26 14.0 27 12.0 28 27.0 29 36.0 30 43.0 31 47.0 32 51.0 33 87.0 34 101.0 35 203.0 36 459.0 37 2872.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.390562248995984 10.86847389558233 8.634538152610443 39.106425702811244 2 23.875 13.375 34.1 28.65 3 21.349999999999998 18.375 23.375 36.9 4 27.200000000000003 25.724999999999998 20.674999999999997 26.400000000000002 5 26.400000000000002 29.975 23.025000000000002 20.599999999999998 6 21.725 33.625 23.5 21.15 7 17.599999999999998 23.400000000000002 39.025 19.975 8 20.7 21.9 29.7 27.700000000000003 9 19.475 21.875 33.550000000000004 25.1 10-14 22.720000000000002 26.669999999999998 25.575 25.035 15-19 22.935 25.56 25.655 25.85 20-24 22.95614780739037 25.656282814140706 25.85629281464073 25.531276563828193 25-29 23.28 25.740000000000002 25.3 25.679999999999996 30-34 23.375 25.115 25.85 25.66 35-39 23.1 25.230000000000004 25.230000000000004 26.44 40-44 23.31 25.080000000000002 25.91 25.7 45-49 23.385 25.474999999999998 25.174999999999997 25.965 50-54 23.16 25.345000000000002 25.46 26.035000000000004 55-59 23.18 25.419999999999998 25.53 25.869999999999997 60-64 23.72 25.290000000000003 25.365 25.624999999999996 65-69 22.96 25.285000000000004 25.705 26.05 70-74 24.015 24.75 25.330000000000002 25.905 75-79 23.945 25.195 24.865000000000002 25.995 80-84 23.855 25.235000000000003 24.745 26.165 85-89 23.830000000000002 24.775 25.605 25.790000000000003 90-94 24.19 25.035 25.009999999999998 25.765 95-99 23.91 25.245 25.074999999999996 25.77 100-104 24.175 24.959999999999997 25.005 25.86 105-109 23.69 25.365 24.815 26.13 110-114 24.375 25.64 24.305 25.679999999999996 115-119 23.400000000000002 25.615 24.915000000000003 26.07 120-124 24.661233061653082 24.521226061303064 24.39121956097805 26.426321316065803 125-129 23.965 25.52 24.36 26.155 130-134 23.45 25.535000000000004 24.445 26.57 135-139 24.33 25.480000000000004 24.12 26.07 140-144 24.740000000000002 25.230000000000004 23.565 26.465 145-149 24.490000000000002 24.525 24.455 26.529999999999998 150-151 24.5375 24.9125 23.8125 26.737499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 1.0 28 3.0 29 4.5 30 5.5 31 9.5 32 14.5 33 19.5 34 31.0 35 44.0 36 61.0 37 74.5 38 88.0 39 111.5 40 124.0 41 137.5 42 149.5 43 166.5 44 194.0 45 201.5 46 195.5 47 189.5 48 188.5 49 171.0 50 145.5 51 139.0 52 132.5 53 128.0 54 114.0 55 98.0 56 97.5 57 93.0 58 83.0 59 75.5 60 75.5 61 68.0 62 64.0 63 65.0 64 63.0 65 59.0 66 47.0 67 43.0 68 48.5 69 41.5 70 25.0 71 24.0 72 24.0 73 16.5 74 13.5 75 10.0 76 4.5 77 4.0 78 4.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.875 0.0 0.0 0.0 0.0 102-103 2.1500000000000004 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.7625 0.0 0.0 0.0 0.0 108-109 3.175 0.0 0.0 0.0 0.0 110-111 3.475 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.275 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.887499999999999 0.0 0.0 0.0 0.0 122-123 6.262499999999999 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.3625 0.0 0.0 0.0 0.0 128-129 8.15 0.0 0.0 0.0 0.0 130-131 8.7125 0.0 0.0 0.0 0.0 132-133 9.4625 0.0 0.0 0.0 0.0 134-135 10.025 0.0 0.0 0.0 0.0 136-137 10.649999999999999 0.0 0.0 0.0 0.0 138-139 11.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACACAG 10 0.006830828 145.0 3 ACACAGG 10 0.006830828 145.0 4 CTGCATT 10 0.006830828 145.0 2 AATAACT 10 0.006830828 145.0 2 CCAGTCA 20 0.00593511 29.0 140-144 >>END_MODULE SRR5578466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71025 33.0 32.0 33.0 28.0 34.0 2 31.913 33.0 33.0 34.0 30.0 34.0 3 31.936 33.0 33.0 34.0 30.0 34.0 4 31.73875 33.0 33.0 34.0 29.0 34.0 5 31.70175 33.0 33.0 34.0 29.0 34.0 6 35.772 38.0 37.0 38.0 31.0 38.0 7 35.6255 38.0 37.0 38.0 29.0 38.0 8 35.601 38.0 37.0 38.0 29.0 38.0 9 35.61475 38.0 37.0 38.0 29.0 38.0 10-14 35.47619999999999 38.0 37.0 38.0 29.0 38.0 15-19 35.417899999999996 38.0 37.0 38.0 29.0 38.0 20-24 35.2615 38.0 37.0 38.0 28.6 38.0 25-29 35.0782 38.0 36.8 38.0 27.8 38.0 30-34 34.94585000000001 38.0 36.2 38.0 27.2 38.0 35-39 34.646249999999995 38.0 36.0 38.0 26.6 38.0 40-44 34.52835 38.0 36.0 38.0 25.8 38.0 45-49 34.2843 38.0 35.0 38.0 24.8 38.0 50-54 33.89135 38.0 34.4 38.0 17.6 38.0 55-59 33.752599999999994 38.0 34.0 38.0 17.6 38.0 60-64 33.5595 38.0 34.0 38.0 16.0 38.0 65-69 33.16775 38.0 33.2 38.0 16.0 38.0 70-74 32.687850000000005 37.8 32.4 38.0 15.8 38.0 75-79 32.26625 37.0 31.0 38.0 15.0 38.0 80-84 31.696050000000003 37.0 29.0 38.0 15.0 38.0 85-89 31.04735 36.2 28.2 38.0 14.8 38.0 90-94 30.532600000000002 36.2 27.2 38.0 13.8 38.0 95-99 29.50845 35.4 24.4 38.0 13.0 38.0 100-104 28.863100000000003 35.0 22.6 38.0 8.6 38.0 105-109 27.9717 34.0 17.8 38.0 2.0 38.0 110-114 26.728950000000005 34.0 15.0 38.0 2.0 38.0 115-119 25.920149999999996 33.2 14.8 37.8 2.0 38.0 120-124 24.77185 31.4 13.6 37.0 2.0 38.0 125-129 23.428000000000004 28.6 10.8 36.2 2.0 38.0 130-134 21.8698 25.4 2.0 35.2 2.0 38.0 135-139 20.4792 22.8 2.0 35.0 2.0 38.0 140-144 18.5155 16.8 2.0 34.4 2.0 38.0 145-149 16.2731 8.8 2.0 34.2 2.0 38.0 150-151 12.52575 2.0 2.0 28.5 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 17.0 4 8.0 5 12.0 6 9.0 7 16.0 8 9.0 9 6.0 10 15.0 11 15.0 12 13.0 13 15.0 14 31.0 15 28.0 16 40.0 17 41.0 18 40.0 19 64.0 20 60.0 21 77.0 22 70.0 23 73.0 24 92.0 25 103.0 26 129.0 27 130.0 28 162.0 29 167.0 30 223.0 31 236.0 32 288.0 33 335.0 34 400.0 35 425.0 36 445.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 16.650000000000002 12.025 32.1 2 28.625 23.25 28.475 19.650000000000002 3 22.922922922922922 24.4994994994995 27.227227227227228 25.350350350350347 4 26.382978723404253 30.888610763454317 20.0 22.728410513141426 5 26.376376376376378 33.45845845845846 20.295295295295297 19.86986986986987 6 22.425457278877474 34.65296918065648 19.819594086695062 23.101979453770983 7 22.319639278557112 19.46392785571142 35.59619238476954 22.62024048096192 8 22.436700927550763 22.336425169215342 24.091250940085235 31.135622963148656 9 23.414389571321134 22.762597142140887 26.873903233893202 26.949110052644777 10-14 26.065376516594807 25.473779203850395 23.002105685350447 25.45873859420435 15-19 25.946352469290552 25.31461519177739 23.85058912008022 24.88844321885184 20-24 25.56029079969917 25.36976685886187 24.256705941338684 24.813236400100276 25-29 25.914970420134363 25.188007620575554 24.034894214378824 24.862127744911263 30-34 25.89008123558319 25.58920870524521 23.708755390632835 24.811954668538764 35-39 26.250564447343333 25.33239676885254 23.847273092167978 24.569765691636146 40-44 26.638583822275713 24.923524396971064 24.000802366982597 24.437089413770625 45-49 26.591797854206355 24.857114208362578 23.864433971723653 24.68665396570741 50-54 25.96510578562118 25.03760152411511 24.62147799057455 24.375814699689162 55-59 26.326080417126242 25.017547377920383 23.693973729068485 24.96239847588489 60-64 26.306026270931515 25.413616765266216 23.683946655971123 24.596410307831142 65-69 25.92871108437359 25.206798014739057 24.705469494159523 24.159021406727827 70-74 26.22104101895497 25.31340888576873 24.059773342693813 24.40577675258249 75-79 26.121199959867564 25.09782281529046 24.586134243001904 24.194842981840072 80-84 26.20253799468325 25.24953603852134 24.326628880975072 24.221297085820336 85-89 26.00280786201364 26.143200962695545 23.646209386281587 24.207781789009225 90-94 26.14628273301896 25.072740042139056 24.405538276311827 24.37543894853015 95-99 26.161099408165313 25.599358009830475 23.89407162202829 24.345470959975927 100-104 26.70844823263976 25.740787164702933 23.394334419654047 24.15643018300326 105-109 26.79941816722676 25.63575262075538 23.70968550935447 23.85514370266339 110-114 26.238964686998393 26.238964686998393 23.625601926163725 23.896468699839488 115-119 27.2886882367695 26.104840732380236 23.125156759468272 23.481314271381994 120-124 26.873903233893202 26.382552018049637 23.193782902983205 23.549761845073952 125-129 26.402127019163242 26.94893147386375 22.825323567773655 23.823617939199355 130-134 27.832413447064724 26.251881585549423 23.20120421475163 22.71450075263422 135-139 26.873903233893202 27.039358235146654 23.058410629230384 23.028327901729757 140-144 27.439971928417467 27.725700536367736 21.585041856734673 23.249285678480124 145-149 27.380295813487088 27.570819754324393 22.41163198796691 22.63725244422161 150-151 27.14966156931562 28.854349461017797 21.484081223364253 22.51190774630233 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.5 3 3.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 5.0 28 5.5 29 4.0 30 6.5 31 13.0 32 13.5 33 14.5 34 20.0 35 27.5 36 41.5 37 55.5 38 70.0 39 98.0 40 117.0 41 124.0 42 135.0 43 154.5 44 171.0 45 185.5 46 192.5 47 182.0 48 184.0 49 163.0 50 136.5 51 138.0 52 126.5 53 123.0 54 124.0 55 109.0 56 99.5 57 96.0 58 104.0 59 98.5 60 76.0 61 72.0 62 74.0 63 77.0 64 83.5 65 71.0 66 54.5 67 59.0 68 64.0 69 44.5 70 35.0 71 40.0 72 32.0 73 23.5 74 16.5 75 8.5 76 6.5 77 5.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.125 5 0.1 6 0.22499999999999998 7 0.2 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27 15-19 0.27499999999999997 20-24 0.27499999999999997 25-29 0.27 30-34 0.29 35-39 0.345 40-44 0.295 45-49 0.27 50-54 0.27 55-59 0.27 60-64 0.27 65-69 0.265 70-74 0.29 75-79 0.33 80-84 0.315 85-89 0.27999999999999997 90-94 0.33 95-99 0.31 100-104 0.27499999999999997 105-109 0.315 110-114 0.32 115-119 0.325 120-124 0.27499999999999997 125-129 0.33 130-134 0.35000000000000003 135-139 0.27499999999999997 140-144 0.255 145-149 0.27499999999999997 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.5032712632108707 1.0 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 2.9749999999999996 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.199999999999999 0.0 0.0 0.0 0.0 130-131 5.550000000000001 0.0 0.0 0.0 0.0 132-133 5.925 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.512499999999999 0.0 0.0 0.0 0.0 138-139 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAAG 25 8.704915E-4 87.0 3 >>END_MODULE Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208171 spots for SRR5578466.sra Written 1208171 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra Read 1208169 spots for SRR5578466.sra Written 1208169 spots for SRR5578466.sra SRR ids: ['SRR5578466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zxwzywqx SRR5578466.sra spots: 24163382 blocks: [[1, 1208169], [1208170, 2416338], [2416339, 3624507], [3624508, 4832676], [4832677, 6040845], [6040846, 7249014], [7249015, 8457183], [8457184, 9665352], [9665353, 10873521], [10873522, 12081690], [12081691, 13289859], [13289860, 14498028], [14498029, 15706197], [15706198, 16914366], [16914367, 18122535], [18122536, 19330704], [19330705, 20538873], [20538874, 21747042], [21747043, 22955211], [22955212, 24163382]] SRR5578466 file size 8166476 SRR5578466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578466 SRR5578466_1.fastq SRR5578466_2.fastq Input file: SRR5578466_1.fastq Paired file: SRR5578466_2.fastq trimmed: SRR5578466-trimmed-pair1.fastq, SRR5578466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:03:13 2024 >> started Mon Dec 9 19:05:27 2024 >> done (134.111s) 24163382 read pairs processed; of these: 75562 ( 0.31%) short read pairs filtered out after trimming by size control 68645 ( 0.28%) empty read pairs filtered out after trimming by size control 24019175 (99.40%) read pairs available; of these: 12514116 (52.10%) trimmed read pairs available after processing 11505059 (47.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 10 0.00% 21 17 0.00% 22 14 0.00% 23 15 0.00% 24 15 0.00% 25 12 0.00% 26 18 0.00% 27 18 0.00% 28 19 0.00% 29 12 0.00% 30 27 0.00% 31 22 0.00% 32 26 0.00% 33 21 0.00% 34 22 0.00% 35 36 0.00% 36 35 0.00% 37 43 0.00% 38 47 0.00% 39 58 0.00% 40 56 0.00% 41 61 0.00% 42 85 0.00% 43 68 0.00% 44 87 0.00% 45 100 0.00% 46 116 0.00% 47 123 0.00% 48 144 0.00% 49 138 0.00% 50 189 0.00% 51 190 0.00% 52 247 0.00% 53 283 0.00% 54 322 0.00% 55 326 0.00% 56 345 0.00% 57 440 0.00% 58 522 0.00% 59 604 0.00% 60 657 0.00% 61 786 0.00% 62 874 0.00% 63 1024 0.00% 64 1147 0.00% 65 1328 0.01% 66 1506 0.01% 67 1577 0.01% 68 1903 0.01% 69 2281 0.01% 70 2540 0.01% 71 2889 0.01% 72 3050 0.01% 73 3545 0.01% 74 3987 0.02% 75 4292 0.02% 76 5090 0.02% 77 5602 0.02% 78 6366 0.03% 79 7101 0.03% 80 7898 0.03% 81 9031 0.04% 82 10141 0.04% 83 11872 0.05% 84 14218 0.06% 85 16861 0.07% 86 17654 0.07% 87 19044 0.08% 88 20475 0.09% 89 21548 0.09% 90 23098 0.10% 91 24280 0.10% 92 25530 0.11% 93 27169 0.11% 94 28893 0.12% 95 30630 0.13% 96 32134 0.13% 97 33877 0.14% 98 35556 0.15% 99 37838 0.16% 100 40237 0.17% 101 41743 0.17% 102 44063 0.18% 103 46117 0.19% 104 48697 0.20% 105 50436 0.21% 106 53200 0.22% 107 55084 0.23% 108 57244 0.24% 109 60381 0.25% 110 62610 0.26% 111 64760 0.27% 112 67877 0.28% 113 70624 0.29% 114 73242 0.30% 115 77103 0.32% 116 79026 0.33% 117 82150 0.34% 118 84384 0.35% 119 86921 0.36% 120 90114 0.38% 121 92654 0.39% 122 95378 0.40% 123 99392 0.41% 124 103236 0.43% 125 106822 0.44% 126 110928 0.46% 127 114331 0.48% 128 116892 0.49% 129 121561 0.51% 130 125205 0.52% 131 128225 0.53% 132 132161 0.55% 133 137613 0.57% 134 143549 0.60% 135 151209 0.63% 136 156586 0.65% 137 161889 0.67% 138 168122 0.70% 139 176605 0.74% 140 186827 0.78% 141 199788 0.83% 142 217212 0.90% 143 234762 0.98% 144 259758 1.08% 145 297002 1.24% 146 350292 1.46% 147 436351 1.82% 148 607370 2.53% 149 1037781 4.32% 150 4398361 18.31% 151 11505059 47.90% 24019175 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=10 prefix-density=0.93 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=17 fanout-score=4.58 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=2.4 sequence=TGCTCACGGAAGACGAAACCGACCTTGCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=15 prefix-density=0.61 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=90.89 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578466 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:10:36 Started mapping on | Dec 09 19:10:36 Finished on | Dec 09 19:26:56 Mapping speed, Million of reads per hour | 88.23 Number of input reads | 24019175 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 22436177 Uniquely mapped reads % | 93.41% Average mapped length | 288.82 Number of splices: Total | 23904769 Number of splices: Annotated (sjdb) | 22542398 Number of splices: GT/AG | 23587564 Number of splices: GC/AG | 289620 Number of splices: AT/AC | 12447 Number of splices: Non-canonical | 15138 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335999 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 40628 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1281624 1281624 1281624 N_multimapping 335999 335999 335999 N_noFeature 799672 21820668 974329 N_ambiguous 516561 2836 76481 UnstrandedReadsAssigned:21119944 PositiveStrandReadsAssigned:612673 NegativeStrandReadsAssigned:21385367 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5578466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578466-trimmed-pair1.fastq SRR5578466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,019,175 reads, 21,555,210 reads pseudoaligned [quant] estimated average fragment length: 242.133 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR5578466.ke.tsv 35125 SRR5578466.se.tsv 88098 total ==> SRR5578466.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.282 30.2669 2.78992 PNS24247 1044 802.867 47.701 3.80774 PNS24249 1928 1686.87 64.1805 2.43841 PNS24246 1044 802.867 47.701 3.80774 PNS24248 1044 802.867 47.701 3.80774 PNS24244 1471 1229.87 101.45 5.2866 PNS24243 293 103.623 0 0 KQK14069 1603 1361.87 873.37 41.1006 KQK14071 474 249.119 11.1503 2.86855 ==> SRR5578466.se.tsv <== BRADI_1g14170v3 941 BRADI_1g53295v3 92 BRADI_1g59795v3 459 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 2916 BRADI_1g74790v3 258 BRADI_1g09890v3 11 BRADI_1g77505v3 356 BRADI_1g48960v3 0 SRR5578466 completed mapping pipeline successfully