Starting /dee2/code/volunteer_pipeline.sh SRR5578467 current disk space = 1522645843968 free memory = 1568119656 SRR5578467 SRAfilesize 13b4307ecb4095b1a9ac207f4db48093 SRR5578467.sra SRR5578467.sra file validated SRR5578467 is paired end SRR5578467 is conventional basespace SRR5578467 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16875 34.0 33.0 34.0 33.0 34.0 2 33.4645 34.0 34.0 34.0 33.0 34.0 3 33.44575 34.0 34.0 34.0 33.0 34.0 4 33.45675 34.0 34.0 34.0 33.0 34.0 5 33.4755 34.0 34.0 34.0 33.0 34.0 6 37.16875 38.0 38.0 38.0 36.0 38.0 7 37.40525 38.0 38.0 38.0 37.0 38.0 8 37.48625 38.0 38.0 38.0 37.0 38.0 9 37.519 38.0 38.0 38.0 38.0 38.0 10-14 37.443599999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.52325 38.0 38.0 38.0 37.8 38.0 20-24 37.503949999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.482549999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.47805 38.0 38.0 38.0 38.0 38.0 35-39 37.46875 38.0 38.0 38.0 37.4 38.0 40-44 37.3593 38.0 38.0 38.0 37.0 38.0 45-49 37.3566 38.0 38.0 38.0 37.0 38.0 50-54 37.34245 38.0 38.0 38.0 37.0 38.0 55-59 37.317750000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.266600000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.27475 38.0 38.0 38.0 37.0 38.0 70-74 37.21515 38.0 38.0 38.0 36.8 38.0 75-79 37.154250000000005 38.0 38.0 38.0 36.6 38.0 80-84 37.08895 38.0 38.0 38.0 36.2 38.0 85-89 37.04765 38.0 38.0 38.0 36.0 38.0 90-94 36.97085 38.0 38.0 38.0 35.8 38.0 95-99 36.9587 38.0 38.0 38.0 35.8 38.0 100-104 36.851749999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.80115 38.0 38.0 38.0 35.0 38.0 110-114 36.75915 38.0 38.0 38.0 35.0 38.0 115-119 36.564350000000005 38.0 38.0 38.0 34.4 38.0 120-124 36.492900000000006 38.0 38.0 38.0 34.2 38.0 125-129 36.41545 38.0 38.0 38.0 34.0 38.0 130-134 36.13965 38.0 38.0 38.0 33.4 38.0 135-139 36.05995 38.0 38.0 38.0 33.4 38.0 140-144 35.715050000000005 38.0 37.4 38.0 32.0 38.0 145-149 35.228699999999996 38.0 36.0 38.0 31.0 38.0 150-151 31.4955 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 3.0 20 3.0 21 3.0 22 2.0 23 3.0 24 6.0 25 9.0 26 13.0 27 16.0 28 17.0 29 23.0 30 31.0 31 39.0 32 52.0 33 76.0 34 102.0 35 166.0 36 403.0 37 3022.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.37670196671709 10.035300050428644 9.606656580937972 38.98134140191629 2 23.425 14.149999999999999 34.625 27.800000000000004 3 21.5 19.3 23.925 35.275 4 26.825 26.05 20.724999999999998 26.400000000000002 5 25.074999999999996 31.05 23.325000000000003 20.549999999999997 6 21.325 31.924999999999997 24.725 22.025 7 17.125 22.825 41.425 18.625 8 19.425 23.05 30.725 26.8 9 18.875 22.0 33.525 25.6 10-14 22.39 27.07 25.745 24.795 15-19 22.595000000000002 25.89 26.634999999999998 24.88 20-24 22.065 26.565 26.229999999999997 25.14 25-29 22.325 26.384999999999998 26.484999999999996 24.805 30-34 22.835 25.905 26.540000000000003 24.72 35-39 22.405 25.915 26.424999999999997 25.255 40-44 22.78 25.965 25.97 25.285000000000004 45-49 22.435 25.91 26.155 25.5 50-54 22.905 25.669999999999998 26.11 25.314999999999998 55-59 22.73 25.869999999999997 25.835 25.564999999999998 60-64 23.465 25.03 26.090000000000003 25.415 65-69 22.345000000000002 26.090000000000003 26.005 25.56 70-74 22.165000000000003 26.0 26.155 25.679999999999996 75-79 22.95 25.540000000000003 25.935000000000002 25.575 80-84 22.66 25.374999999999996 26.465 25.5 85-89 22.865 25.5 26.529999999999998 25.105 90-94 23.405 25.580000000000002 25.47 25.545 95-99 22.695 25.230000000000004 27.01 25.064999999999998 100-104 23.035 25.64 25.81 25.515 105-109 22.945 25.900000000000002 26.290000000000003 24.865000000000002 110-114 23.244999999999997 25.775 25.465 25.515 115-119 23.31 25.715 25.365 25.61 120-124 22.735 25.905 25.615 25.745 125-129 23.425 26.009999999999998 25.21 25.355 130-134 23.035 25.985000000000003 25.145 25.835 135-139 23.185 26.165 25.11 25.540000000000003 140-144 22.88 26.455000000000002 25.009999999999998 25.655 145-149 23.605 26.619999999999997 24.104999999999997 25.669999999999998 150-151 23.1625 26.0625 24.712500000000002 26.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.0 27 2.0 28 6.5 29 8.0 30 6.0 31 14.0 32 23.5 33 25.0 34 35.5 35 49.5 36 54.0 37 64.5 38 92.5 39 112.5 40 134.5 41 169.5 42 183.0 43 195.5 44 197.0 45 212.0 46 231.5 47 211.5 48 192.0 49 181.5 50 170.0 51 153.0 52 133.5 53 117.0 54 107.0 55 92.0 56 82.5 57 81.5 58 76.5 59 76.0 60 69.5 61 55.0 62 48.0 63 37.0 64 32.0 65 40.5 66 41.5 67 35.0 68 29.5 69 27.0 70 22.5 71 17.0 72 13.5 73 10.5 74 9.5 75 7.0 76 4.0 77 2.0 78 2.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93858984078847 97.875 2 1.0361384887541065 2.0500000000000003 3 0.025271670457417232 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.2249999999999996 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.25 0.0 0.0 0.0 0.0 124-125 5.75 0.0 0.0 0.0 0.0 126-127 6.2375 0.0 0.0 0.0 0.0 128-129 6.75 0.0 0.0 0.0 0.0 130-131 7.325 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.55 0.0 0.0125 0.0 0.0 136-137 9.175 0.0 0.025 0.0 0.0 138-139 9.912500000000001 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTGC 10 0.006832588 144.9875 8 >>END_MODULE SRR5578467 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 39 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 15.10925 18.0 2.0 27.0 2.0 32.0 2 15.44525 18.0 2.0 27.0 2.0 33.0 3 15.295 18.0 2.0 27.0 2.0 33.0 4 14.59725 15.0 2.0 27.0 2.0 33.0 5 14.54225 15.0 2.0 27.0 2.0 33.0 6 15.74775 16.0 2.0 29.0 2.0 37.0 7 15.65375 16.0 2.0 29.0 2.0 38.0 8 15.4205 16.0 2.0 29.0 2.0 37.0 9 15.24675 16.0 2.0 29.0 2.0 37.0 10-14 14.978400000000002 15.2 2.0 28.4 2.0 37.6 15-19 14.344100000000001 11.8 2.0 28.0 2.0 37.0 20-24 13.773349999999999 2.0 2.0 27.6 2.0 37.0 25-29 13.1547 2.0 2.0 26.2 2.0 37.0 30-34 12.853200000000001 2.0 2.0 25.4 2.0 37.0 35-39 12.490649999999999 2.0 2.0 25.0 2.0 37.0 40-44 12.08535 2.0 2.0 25.0 2.0 37.0 45-49 11.90265 2.0 2.0 23.0 2.0 36.6 50-54 11.489 2.0 2.0 16.0 2.0 36.2 55-59 11.08215 2.0 2.0 16.0 2.0 36.0 60-64 10.76725 2.0 2.0 16.0 2.0 36.0 65-69 10.488649999999998 2.0 2.0 16.0 2.0 36.0 70-74 10.133400000000002 2.0 2.0 16.0 2.0 35.2 75-79 9.891250000000001 2.0 2.0 16.0 2.0 34.8 80-84 9.62 2.0 2.0 15.6 2.0 34.0 85-89 9.1755 2.0 2.0 15.0 2.0 33.8 90-94 8.80195 2.0 2.0 15.0 2.0 33.4 95-99 8.3658 2.0 2.0 14.4 2.0 31.4 100-104 7.881950000000001 2.0 2.0 4.2 2.0 29.2 105-109 7.558099999999999 2.0 2.0 2.0 2.0 28.8 110-114 7.11165 2.0 2.0 2.0 2.0 27.4 115-119 6.676849999999999 2.0 2.0 2.0 2.0 26.0 120-124 6.3138000000000005 2.0 2.0 2.0 2.0 24.6 125-129 5.8626 2.0 2.0 2.0 2.0 22.6 130-134 5.385000000000001 2.0 2.0 2.0 2.0 16.6 135-139 4.8759500000000005 2.0 2.0 2.0 2.0 14.4 140-144 4.4113500000000005 2.0 2.0 2.0 2.0 6.4 145-149 3.88885 2.0 2.0 2.0 2.0 2.0 150-151 3.2325 2.0 2.0 2.0 2.0 2.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 1736.0 3 222.0 4 186.0 5 115.0 6 89.0 7 91.0 8 83.0 9 76.0 10 60.0 11 71.0 12 76.0 13 61.0 14 51.0 15 83.0 16 69.0 17 65.0 18 60.0 19 59.0 20 56.0 21 75.0 22 46.0 23 41.0 24 40.0 25 45.0 26 39.0 27 48.0 28 48.0 29 52.0 30 50.0 31 27.0 32 49.0 33 32.0 34 36.0 35 27.0 36 31.0 37 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.925 30.225 19.85 27.0 2 20.190142606955217 36.27720790592945 22.61696272204153 20.915686765073804 3 17.60581016779364 37.56574004507889 21.96343601302279 22.865013774104685 4 18.432256448785374 39.04332582018532 19.93488605058853 22.58953168044077 5 20.160280490859 37.08990733784122 20.210368144252442 22.539444027047335 6 17.30432608152038 38.009502375593904 21.080270067516878 23.605901475368842 7 15.65391347836959 36.25906476619154 24.55613903475869 23.53088272068017 8 18.0 36.3 20.5 25.2 9 16.900000000000002 37.35 21.099999999999998 24.65 10-14 17.426970788315327 39.83093237294918 19.692877150860344 23.04921968787515 15-19 16.613306653326664 40.090045022511255 19.894947473736867 23.401700850425215 20-24 16.618309154577286 40.12006003001501 19.694847423711856 23.566783391695846 25-29 15.747873936968485 41.645822911455724 19.504752376188094 23.101550775387693 30-34 16.353176588294147 41.53076538269135 18.589294647323662 23.526763381690845 35-39 16.228114057028513 42.58129064532266 18.339169584792398 22.851425712856425 40-44 15.572786393196598 43.29664832416208 17.603801900950476 23.526763381690845 45-49 16.308969933463406 42.95362449347141 17.719745860223124 23.01765971284206 50-54 15.90295147573787 43.48174087043522 17.428714357178592 23.186593296648326 55-59 15.81790895447724 42.71135567783892 18.009004502251123 23.461730865432717 60-64 15.794476686011608 43.681208725235145 17.240344206523915 23.283970382229338 65-69 15.37845815198359 43.54394917204463 16.89929461203662 24.178298063935163 70-74 15.467733866933466 44.822411205602805 16.228114057028513 23.481740870435218 75-79 15.298414127770274 43.57896843263795 16.959327630196608 24.163289809395167 80-84 15.45272636318159 44.65732866433217 15.987993996998497 23.901950975487743 85-89 15.212606303151578 45.107553776888444 16.003001500750376 23.676838419209606 90-94 14.622311155577789 45.107553776888444 16.03301650825413 24.23711855927964 95-99 14.834642517636464 45.04928203332166 15.96037424325812 24.155701205783757 100-104 14.752376188094047 45.01750875437719 15.322661330665333 24.907453726863434 105-109 13.881940970485243 46.10805402701351 15.217608804402202 24.79239619809905 110-114 15.247534664864595 45.682534915152424 14.902137458076789 24.167792961906194 115-119 14.453007706936244 47.28755880292263 14.473025723150837 23.78640776699029 120-124 15.26263131565783 46.008004002001 14.017008504252127 24.712356178089045 125-129 15.008254539996999 46.61563860123067 14.292861073590474 24.08324578518185 130-134 14.190609670637702 47.95274802282511 13.690059064971468 24.16658324156572 135-139 14.017008504252127 49.40470235117559 12.821410705352676 23.75687843921961 140-144 13.255965184332949 49.35721074483518 12.830773848231706 24.55605022260017 145-149 13.006503251625812 49.48974487243622 12.621310655327663 24.882441220610303 150-151 12.256128064032017 54.73986993496749 11.28064032016008 21.72336168084042 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 8.0 1 8.0 2 12.0 3 12.0 4 6.0 5 4.0 6 3.0 7 1.5 8 1.0 9 2.5 10 4.0 11 3.5 12 2.5 13 3.0 14 5.0 15 7.0 16 10.0 17 14.5 18 15.5 19 16.5 20 25.0 21 29.5 22 27.0 23 34.5 24 50.0 25 55.0 26 62.5 27 72.5 28 70.0 29 74.5 30 86.0 31 91.0 32 105.5 33 125.5 34 129.5 35 128.0 36 127.5 37 143.5 38 157.5 39 145.5 40 144.0 41 151.5 42 159.5 43 153.0 44 145.5 45 136.5 46 128.5 47 132.0 48 129.5 49 114.5 50 96.0 51 79.5 52 65.0 53 57.5 54 51.0 55 58.0 56 47.0 57 36.5 58 34.5 59 27.5 60 25.0 61 22.0 62 21.5 63 22.0 64 19.5 65 15.5 66 12.5 67 10.0 68 8.5 69 4.5 70 2.5 71 3.0 72 3.0 73 1.5 74 1.0 75 1.5 76 1.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.04 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.055 50-54 0.05 55-59 0.05 60-64 0.06 65-69 0.055 70-74 0.05 75-79 0.055 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.065 100-104 0.05 105-109 0.05 110-114 0.11499999999999999 115-119 0.09 120-124 0.05 125-129 0.055 130-134 0.11 135-139 0.05 140-144 0.045 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8742770932864 99.3 2 0.07543374402816193 0.15 3 0.0 0.0 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025144581342720643 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 18 0.44999999999999996 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.07500000000000001 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.575 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138-139 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040286 spots for SRR5578467.sra Written 1040286 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra Read 1040270 spots for SRR5578467.sra Written 1040270 spots for SRR5578467.sra SRR ids: ['SRR5578467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zak2eixi SRR5578467.sra spots: 20805416 blocks: [[1, 1040270], [1040271, 2080540], [2080541, 3120810], [3120811, 4161080], [4161081, 5201350], [5201351, 6241620], [6241621, 7281890], [7281891, 8322160], [8322161, 9362430], [9362431, 10402700], [10402701, 11442970], [11442971, 12483240], [12483241, 13523510], [13523511, 14563780], [14563781, 15604050], [15604051, 16644320], [16644321, 17684590], [17684591, 18724860], [18724861, 19765130], [19765131, 20805416]] SRR5578467 file size 7028572 SRR5578467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578467 SRR5578467_1.fastq SRR5578467_2.fastq Input file: SRR5578467_1.fastq Paired file: SRR5578467_2.fastq trimmed: SRR5578467-trimmed-pair1.fastq, SRR5578467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:59:57 2024 >> started Mon Dec 9 19:00:25 2024 >> done (27.827s) 20805416 read pairs processed; of these: 477521 ( 2.30%) short read pairs filtered out after trimming by size control 1243740 ( 5.98%) empty read pairs filtered out after trimming by size control 19084155 (91.73%) read pairs available; of these: 11488816 (60.20%) trimmed read pairs available after processing 7595339 (39.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 14 0.00% 21 11 0.00% 22 12 0.00% 23 22 0.00% 24 19 0.00% 25 18 0.00% 26 18 0.00% 27 16 0.00% 28 21 0.00% 29 24 0.00% 30 22 0.00% 31 18 0.00% 32 34 0.00% 33 19 0.00% 34 44 0.00% 35 38 0.00% 36 39 0.00% 37 52 0.00% 38 45 0.00% 39 51 0.00% 40 62 0.00% 41 52 0.00% 42 74 0.00% 43 90 0.00% 44 75 0.00% 45 105 0.00% 46 99 0.00% 47 130 0.00% 48 151 0.00% 49 181 0.00% 50 200 0.00% 51 233 0.00% 52 240 0.00% 53 258 0.00% 54 309 0.00% 55 306 0.00% 56 450 0.00% 57 467 0.00% 58 551 0.00% 59 565 0.00% 60 750 0.00% 61 777 0.00% 62 933 0.00% 63 1061 0.01% 64 1194 0.01% 65 1367 0.01% 66 1506 0.01% 67 1662 0.01% 68 1907 0.01% 69 2358 0.01% 70 2637 0.01% 71 2786 0.01% 72 2985 0.02% 73 3167 0.02% 74 3720 0.02% 75 4213 0.02% 76 4554 0.02% 77 5068 0.03% 78 5393 0.03% 79 6295 0.03% 80 6965 0.04% 81 8149 0.04% 82 9399 0.05% 83 11460 0.06% 84 36322 0.19% 85 52548 0.28% 86 48753 0.26% 87 45873 0.24% 88 43217 0.23% 89 42097 0.22% 90 42545 0.22% 91 43251 0.23% 92 43464 0.23% 93 44172 0.23% 94 45568 0.24% 95 44742 0.23% 96 45684 0.24% 97 46113 0.24% 98 46821 0.25% 99 48497 0.25% 100 49207 0.26% 101 51265 0.27% 102 53157 0.28% 103 54522 0.29% 104 56545 0.30% 105 58010 0.30% 106 60626 0.32% 107 62504 0.33% 108 63786 0.33% 109 65599 0.34% 110 68225 0.36% 111 70767 0.37% 112 72968 0.38% 113 75455 0.40% 114 78995 0.41% 115 81948 0.43% 116 84147 0.44% 117 86889 0.46% 118 89579 0.47% 119 92983 0.49% 120 95648 0.50% 121 99040 0.52% 122 101563 0.53% 123 104851 0.55% 124 109373 0.57% 125 113428 0.59% 126 117346 0.61% 127 120046 0.63% 128 125184 0.66% 129 129875 0.68% 130 133358 0.70% 131 137581 0.72% 132 141824 0.74% 133 146047 0.77% 134 153263 0.80% 135 159704 0.84% 136 166543 0.87% 137 173612 0.91% 138 179002 0.94% 139 189512 0.99% 140 198386 1.04% 141 209822 1.10% 142 223948 1.17% 143 236086 1.24% 144 255931 1.34% 145 282964 1.48% 146 323468 1.69% 147 400643 2.10% 148 534097 2.80% 149 853925 4.47% 150 3080443 16.14% 151 7595339 39.80% 19084155 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=43.22 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=39.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCACAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.77 sequence-density-rank=1 fanout-score=43.22 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=39.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCACAATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=20 prefix-density=0.30 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=78.16 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=14.3 sequence=GCCGCCGCCGCC SRR5578467 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:01:23 Started mapping on | Dec 09 19:01:23 Finished on | Dec 09 19:05:21 Mapping speed, Million of reads per hour | 288.67 Number of input reads | 19084155 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 17651509 Uniquely mapped reads % | 92.49% Average mapped length | 282.00 Number of splices: Total | 18769447 Number of splices: Annotated (sjdb) | 17653730 Number of splices: GT/AG | 18530362 Number of splices: GC/AG | 216965 Number of splices: AT/AC | 9839 Number of splices: Non-canonical | 12281 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312895 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 26698 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.90% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1468592 1468592 1468592 N_multimapping 312895 312895 312895 N_noFeature 865305 17151125 1041944 N_ambiguous 397575 2925 74717 UnstrandedReadsAssigned:16388629 PositiveStrandReadsAssigned:497459 NegativeStrandReadsAssigned:16534848 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR5578467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578467-trimmed-pair1.fastq SRR5578467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,084,155 reads, 16,901,194 reads pseudoaligned [quant] estimated average fragment length: 269.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52973 SRR5578467.ke.tsv 35125 SRR5578467.se.tsv 88098 total ==> SRR5578467.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.047 0 0 PNS24247 1044 775.443 50.6 5.87649 PNS24249 1928 1659.44 62.5527 3.3947 PNS24246 1044 775.443 50.6 5.87649 PNS24248 1044 775.443 50.6 5.87649 PNS24244 1471 1202.44 46.6474 3.49367 PNS24243 293 94.6607 0 0 KQK14069 1603 1334.44 784.59 52.9494 KQK14071 474 230.144 12.7061 4.97199 ==> SRR5578467.se.tsv <== BRADI_1g14170v3 879 BRADI_1g53295v3 222 BRADI_1g59795v3 451 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 1799 BRADI_1g74790v3 82 BRADI_1g09890v3 1 BRADI_1g77505v3 317 BRADI_1g48960v3 1 SRR5578467 completed mapping pipeline successfully