Starting /dee2/code/volunteer_pipeline.sh SRR5578470 current disk space = 1522413899776 free memory = 1567231380 SRR5578470 SRAfilesize c6013fbf406ab1a973baf1efb80e344c SRR5578470.sra SRR5578470.sra file validated SRR5578470 is paired end SRR5578470 is conventional basespace SRR5578470 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2645 34.0 33.0 34.0 33.0 34.0 2 33.4675 34.0 34.0 34.0 33.0 34.0 3 33.45925 34.0 34.0 34.0 33.0 34.0 4 33.49375 34.0 34.0 34.0 33.0 34.0 5 33.47875 34.0 34.0 34.0 33.0 34.0 6 37.17025 38.0 38.0 38.0 36.0 38.0 7 37.3945 38.0 38.0 38.0 37.0 38.0 8 37.48325 38.0 38.0 38.0 37.0 38.0 9 37.46225 38.0 38.0 38.0 37.0 38.0 10-14 37.49655 38.0 38.0 38.0 37.2 38.0 15-19 37.493849999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.51845 38.0 38.0 38.0 38.0 38.0 25-29 37.45975 38.0 38.0 38.0 37.8 38.0 30-34 37.458600000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.4251 38.0 38.0 38.0 37.8 38.0 40-44 37.30305 38.0 38.0 38.0 37.2 38.0 45-49 37.332499999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3667 38.0 38.0 38.0 37.0 38.0 55-59 37.282650000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.24444999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.22410000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.21685 38.0 38.0 38.0 37.0 38.0 75-79 37.009949999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.02454999999999 38.0 38.0 38.0 36.4 38.0 85-89 36.8629 38.0 38.0 38.0 36.0 38.0 90-94 36.842949999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.74855 38.0 38.0 38.0 35.2 38.0 100-104 36.6791 38.0 38.0 38.0 35.0 38.0 105-109 36.632099999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.49675 38.0 38.0 38.0 34.6 38.0 115-119 36.3538 38.0 38.0 38.0 34.0 38.0 120-124 36.265100000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.0669 38.0 38.0 38.0 33.8 38.0 130-134 35.82815 38.0 37.8 38.0 33.0 38.0 135-139 35.7778 38.0 38.0 38.0 33.0 38.0 140-144 35.4949 38.0 37.4 38.0 31.4 38.0 145-149 35.080349999999996 38.0 36.0 38.0 31.0 38.0 150-151 31.073375 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 4.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 3.0 14 1.0 15 2.0 16 3.0 17 2.0 18 6.0 19 8.0 20 7.0 21 2.0 22 2.0 23 8.0 24 6.0 25 9.0 26 11.0 27 10.0 28 18.0 29 27.0 30 37.0 31 39.0 32 48.0 33 74.0 34 94.0 35 147.0 36 410.0 37 3018.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.89179667840966 10.719677906391546 8.882737795671867 35.50578761952693 2 25.6 12.825000000000001 30.575000000000003 31.0 3 23.799999999999997 16.75 24.45 35.0 4 27.375 24.075 21.099999999999998 27.450000000000003 5 27.375 27.575 24.325 20.724999999999998 6 22.330582645661416 31.45786446611653 25.456364091022753 20.7551887971993 7 16.875 23.849999999999998 40.9 18.375 8 20.45 24.825 29.299999999999997 25.424999999999997 9 20.65 22.25 34.0 23.1 10-14 23.580000000000002 27.26 25.44 23.72 15-19 23.244999999999997 25.665 25.195 25.895000000000003 20-24 23.365 25.445 26.290000000000003 24.9 25-29 22.96 25.924999999999997 26.165 24.95 30-34 22.84 26.090000000000003 25.900000000000002 25.169999999999998 35-39 23.630000000000003 25.374999999999996 25.88 25.115 40-44 24.59 25.535000000000004 24.72 25.155 45-49 23.59 25.825 25.935000000000002 24.65 50-54 24.315 25.665 25.485000000000003 24.535 55-59 23.595 25.605 25.509999999999998 25.290000000000003 60-64 22.919999999999998 26.015 25.619999999999997 25.445 65-69 22.689999999999998 26.63 25.305 25.374999999999996 70-74 23.95 25.790000000000003 24.535 25.724999999999998 75-79 23.705000000000002 25.495 25.115 25.685000000000002 80-84 23.65 25.77 24.735 25.845000000000002 85-89 23.815 24.9 25.525 25.759999999999998 90-94 24.165 25.180000000000003 25.21 25.445 95-99 23.375 25.22 26.005 25.4 100-104 24.035 25.575 24.805 25.585 105-109 24.075 25.545 25.215 25.165 110-114 23.875 25.255 24.715 26.155 115-119 24.26 25.735000000000003 24.505 25.5 120-124 24.315 25.15 24.065 26.47 125-129 24.675 25.86 23.76 25.705 130-134 24.965 25.445 23.794999999999998 25.795 135-139 23.87 25.619999999999997 24.990000000000002 25.52 140-144 24.69 25.8 23.855 25.655 145-149 24.19 26.005 23.525 26.279999999999998 150-151 24.587500000000002 24.325 24.15 26.937499999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.5 25 1.0 26 1.0 27 2.0 28 4.5 29 7.5 30 11.0 31 26.0 32 33.0 33 30.0 34 41.0 35 50.0 36 67.0 37 110.5 38 124.0 39 115.0 40 139.0 41 138.5 42 124.0 43 137.0 44 150.5 45 159.0 46 184.5 47 195.0 48 179.5 49 174.0 50 158.0 51 139.0 52 139.5 53 130.5 54 110.0 55 90.0 56 82.5 57 80.0 58 72.5 59 77.0 60 72.5 61 68.0 62 59.0 63 52.0 64 56.5 65 52.5 66 48.0 67 43.0 68 42.5 69 38.5 70 33.5 71 29.5 72 24.0 73 20.5 74 15.0 75 14.5 76 13.0 77 10.0 78 8.5 79 4.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.55555555555556 88.14999999999999 2 2.9810298102981028 5.5 3 0.8401084010840107 2.325 4 0.24390243902439024 0.8999999999999999 5 0.05420054200542006 0.25 6 0.10840108401084012 0.6 7 0.02710027100271003 0.17500000000000002 8 0.05420054200542006 0.4 9 0.02710027100271003 0.22499999999999998 >10 0.10840108401084012 1.4749999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 22 0.5499999999999999 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCCTGATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 18 (97% over 37bp) CTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGT 13 0.325 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 10 0.25 No Hit GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 9 0.22499999999999998 No Hit GCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGA 8 0.2 No Hit GGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGG 8 0.2 No Hit GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 7 0.17500000000000002 No Hit GTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGT 6 0.15 No Hit CCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAAT 6 0.15 No Hit GCCCTAACTGCGCAGTTAATAATTCTGGCAATTCGTCTCCACACTAGAAG 6 0.15 No Hit GGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGG 6 0.15 No Hit GGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGT 5 0.125 No Hit GCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.4749999999999996 0.0 0.0 0.0 0.0 104-105 2.8 0.0 0.0 0.0 0.0 106-107 3.1625 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 4.949999999999999 0.0 0.0 0.0 0.0 116-117 5.325 0.0 0.0 0.0 0.0 118-119 5.9375 0.0 0.0 0.0 0.0 120-121 6.625 0.0 0.0 0.0 0.0 122-123 7.2875 0.0 0.0 0.0 0.0 124-125 8.1 0.0 0.0 0.0 0.0 126-127 8.962499999999999 0.0 0.0 0.0 0.0 128-129 9.6875 0.0 0.0 0.0 0.0 130-131 10.3375 0.0 0.0 0.0 0.0 132-133 11.075 0.0 0.0 0.0 0.0 134-135 12.024999999999999 0.0 0.0 0.0 0.0 136-137 12.787500000000001 0.0 0.0 0.0 0.0 138-139 13.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578470 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.77325 33.0 32.0 33.0 28.0 34.0 2 31.9715 33.0 33.0 34.0 30.0 34.0 3 31.7835 33.0 33.0 34.0 29.0 34.0 4 31.878 33.0 33.0 34.0 30.0 34.0 5 31.81175 33.0 33.0 34.0 29.0 34.0 6 35.82925 38.0 37.0 38.0 31.0 38.0 7 35.7295 38.0 37.0 38.0 31.0 38.0 8 35.78275 38.0 37.0 38.0 31.0 38.0 9 35.82 38.0 37.0 38.0 31.0 38.0 10-14 35.7873 38.0 37.0 38.0 31.0 38.0 15-19 35.58345 38.0 37.0 38.0 29.8 38.0 20-24 35.444599999999994 38.0 37.0 38.0 29.0 38.0 25-29 35.23735 38.0 36.6 38.0 28.4 38.0 30-34 35.000899999999994 38.0 36.0 38.0 28.0 38.0 35-39 34.87845 38.0 36.0 38.0 27.0 38.0 40-44 34.65865 38.0 36.0 38.0 27.0 38.0 45-49 34.3071 38.0 35.4 38.0 25.2 38.0 50-54 33.94015 38.0 34.2 38.0 19.2 38.0 55-59 33.6413 38.0 34.0 38.0 16.0 38.0 60-64 33.5181 38.0 33.8 38.0 16.0 38.0 65-69 32.89444999999999 37.6 32.8 38.0 16.0 38.0 70-74 32.57195 37.0 32.0 38.0 15.6 38.0 75-79 31.96155 37.0 30.0 38.0 15.0 38.0 80-84 31.442699999999995 37.0 29.0 38.0 15.0 38.0 85-89 30.94755 36.6 27.8 38.0 14.4 38.0 90-94 30.1041 35.8 26.2 38.0 13.4 38.0 95-99 29.2414 35.0 23.2 38.0 13.0 38.0 100-104 28.244099999999996 34.4 19.4 38.0 6.4 38.0 105-109 27.535649999999997 34.0 15.0 38.0 2.0 38.0 110-114 26.33455 33.6 15.0 37.8 2.0 38.0 115-119 25.216649999999998 32.2 14.2 37.0 2.0 38.0 120-124 23.93535 29.4 13.0 36.6 2.0 38.0 125-129 22.273450000000004 25.8 4.2 35.6 2.0 38.0 130-134 20.737550000000002 23.2 2.0 34.8 2.0 38.0 135-139 19.052049999999998 18.8 2.0 34.6 2.0 38.0 140-144 17.0201 13.8 2.0 33.6 2.0 38.0 145-149 14.49435 4.2 2.0 33.0 2.0 36.8 150-151 11.05075 2.0 2.0 23.5 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 8.0 4 9.0 5 11.0 6 6.0 7 8.0 8 12.0 9 8.0 10 15.0 11 14.0 12 22.0 13 20.0 14 28.0 15 26.0 16 42.0 17 37.0 18 43.0 19 50.0 20 60.0 21 76.0 22 87.0 23 99.0 24 119.0 25 116.0 26 117.0 27 184.0 28 173.0 29 201.0 30 233.0 31 275.0 32 320.0 33 324.0 34 370.0 35 405.0 36 343.0 37 108.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 18.15 11.825 30.0 2 26.84026039058588 24.111166750125186 27.265898848272407 21.782674011016525 3 24.85592583312453 24.680531195189175 27.38661989476322 23.076923076923077 4 28.1203007518797 30.87719298245614 17.969924812030076 23.032581453634084 5 29.31596091205212 32.22250062640942 19.54397394136808 18.917564520170384 6 23.43671835917959 33.81690845422711 20.51025512756378 22.236118059029515 7 22.241681260945708 21.26594946209657 32.399299474605954 24.093069802351764 8 22.18609304652326 25.03751875937969 24.61230615307654 28.16408204102051 9 24.256064016004 23.40585146286572 26.38159539884971 25.95648912228057 10-14 26.68001000750563 25.869402051538653 22.226670002501876 25.223917938453837 15-19 25.767055408178585 25.98728665098353 23.219380349366837 25.026277591471047 20-24 26.206447737284744 25.51061273528234 23.30296355626752 24.9799759711654 25-29 26.173791170287313 25.337871658824707 23.901291420562618 24.58704575032536 30-34 26.710374856113305 25.7194334617887 23.392222611480907 24.177969070617085 35-39 25.696981830922468 25.35662445567846 24.240452475098852 24.705941238300216 40-44 26.254130369480322 24.71212576349254 24.14138379893862 24.892360068088514 45-49 26.224091318714326 24.56193050966256 24.376689696605588 24.837288475017523 50-54 26.328961858043847 24.727199919911904 24.917409150065073 24.026429071979177 55-59 25.60200250312891 25.41176470588235 24.86107634543179 24.125156445556946 60-64 24.852308000400523 25.578251727245423 24.952438169620507 24.617002102733554 65-69 24.74092615769712 25.902377972465583 25.231539424280353 24.125156445556946 70-74 25.167650885797215 25.673105795215694 24.522069862876588 24.6371734561105 75-79 24.58450140168202 26.311573888666402 24.46936323588306 24.63456147376852 80-84 25.234065989085263 25.609572923446656 24.58819406198368 24.568167025484403 85-89 24.88486183420104 25.93612334801762 24.62955546655987 24.54945935122147 90-94 25.33279951956761 25.91332198979081 24.577119407466718 24.176759083174858 95-99 24.919887842980174 27.09793711195674 24.193871419987982 23.788303625075105 100-104 25.72472838331748 26.125269113302956 24.04746407650328 24.102538426876283 105-109 25.971165398478174 26.386663996796155 23.638366039247096 24.003804565478575 110-114 25.133957634333214 26.9267364414843 23.43632630577395 24.50297961840853 115-119 26.11656318846385 27.36330863208492 22.726817544562387 23.793310634888844 120-124 25.682102628285357 26.608260325406757 23.42428035043805 24.285356695869837 125-129 26.426712054465355 27.22266720064077 22.872446936323588 23.478173808570286 130-134 26.959090681488156 26.984126984126984 22.85814430924841 23.198638025136447 135-139 26.48545827701857 27.952144966711717 22.605996896430895 22.956399859838815 140-144 27.106685348278624 27.502001601281023 22.55804643714972 22.833266613290633 145-149 27.747197758206564 27.94735788630905 21.427141713370695 22.87830264211369 150-151 27.73119759729696 27.943936929045176 20.961081216368417 23.36378425728945 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 1.0 5 1.5 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 3.5 28 5.0 29 8.0 30 13.5 31 16.0 32 14.0 33 20.0 34 32.0 35 39.0 36 48.0 37 69.0 38 101.0 39 120.5 40 144.5 41 142.5 42 130.5 43 142.5 44 150.5 45 156.0 46 153.0 47 158.0 48 169.0 49 162.5 50 141.5 51 144.0 52 144.0 53 127.5 54 135.0 55 128.5 56 94.5 57 82.0 58 87.0 59 87.0 60 76.5 61 67.0 62 68.0 63 66.0 64 58.5 65 58.5 66 62.0 67 55.0 68 49.0 69 42.5 70 35.5 71 37.5 72 33.0 73 28.0 74 26.0 75 18.5 76 12.0 77 7.5 78 5.0 79 4.0 80 3.0 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.22499999999999998 4 0.25 5 0.22499999999999998 6 0.05 7 0.075 8 0.05 9 0.025 10-14 0.075 15-19 0.105 20-24 0.12 25-29 0.11 30-34 0.095 35-39 0.105 40-44 0.13 45-49 0.13 50-54 0.11 55-59 0.125 60-64 0.13 65-69 0.125 70-74 0.09 75-79 0.12 80-84 0.135 85-89 0.12 90-94 0.09 95-99 0.13999999999999999 100-104 0.135 105-109 0.12 110-114 0.155 115-119 0.13999999999999999 120-124 0.125 125-129 0.12 130-134 0.145 135-139 0.11499999999999999 140-144 0.08 145-149 0.08 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 96.09332609875203 88.55 2 2.6044492674986435 4.8 3 0.5697232772653282 1.575 4 0.2170374389582203 0.8 5 0.08138903960933261 0.375 6 0.05425935973955508 0.3 7 0.10851871947911015 0.7000000000000001 8 0.05425935973955508 0.4 9 0.02712967986977754 0.22499999999999998 >10 0.18990775908844276 2.275 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 16 0.4 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 14 0.35000000000000003 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 13 0.325 No Hit ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 13 0.325 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 12 0.3 No Hit ATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAG 12 0.3 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 11 0.27499999999999997 No Hit ATTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATC 9 0.22499999999999998 No Hit TAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGT 8 0.2 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 8 0.2 No Hit AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 7 0.17500000000000002 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) CTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCA 7 0.17500000000000002 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 6 0.15 No Hit CAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATAC 6 0.15 No Hit CTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTT 5 0.125 No Hit CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGA 5 0.125 No Hit GCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5249999999999999 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.8624999999999998 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 2.9749999999999996 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 7.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945638 spots for SRR5578470.sra Written 945638 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra Read 945633 spots for SRR5578470.sra Written 945633 spots for SRR5578470.sra SRR ids: ['SRR5578470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qvatdxhg SRR5578470.sra spots: 18912665 blocks: [[1, 945633], [945634, 1891266], [1891267, 2836899], [2836900, 3782532], [3782533, 4728165], [4728166, 5673798], [5673799, 6619431], [6619432, 7565064], [7565065, 8510697], [8510698, 9456330], [9456331, 10401963], [10401964, 11347596], [11347597, 12293229], [12293230, 13238862], [13238863, 14184495], [14184496, 15130128], [15130129, 16075761], [16075762, 17021394], [17021395, 17967027], [17967028, 18912665]] SRR5578470 file size 6387181 SRR5578470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578470 SRR5578470_1.fastq SRR5578470_2.fastq Input file: SRR5578470_1.fastq Paired file: SRR5578470_2.fastq trimmed: SRR5578470-trimmed-pair1.fastq, SRR5578470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:36:43 2024 >> started Mon Dec 9 19:37:08 2024 >> done (24.755s) 18912665 read pairs processed; of these: 54262 ( 0.29%) short read pairs filtered out after trimming by size control 135052 ( 0.71%) empty read pairs filtered out after trimming by size control 18723351 (99.00%) read pairs available; of these: 10863805 (58.02%) trimmed read pairs available after processing 7859546 (41.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 9 0.00% 21 15 0.00% 22 19 0.00% 23 15 0.00% 24 34 0.00% 25 24 0.00% 26 28 0.00% 27 29 0.00% 28 32 0.00% 29 34 0.00% 30 55 0.00% 31 45 0.00% 32 39 0.00% 33 43 0.00% 34 53 0.00% 35 59 0.00% 36 45 0.00% 37 66 0.00% 38 81 0.00% 39 72 0.00% 40 81 0.00% 41 99 0.00% 42 104 0.00% 43 126 0.00% 44 123 0.00% 45 154 0.00% 46 171 0.00% 47 204 0.00% 48 228 0.00% 49 278 0.00% 50 273 0.00% 51 303 0.00% 52 397 0.00% 53 426 0.00% 54 501 0.00% 55 557 0.00% 56 614 0.00% 57 627 0.00% 58 755 0.00% 59 843 0.00% 60 920 0.00% 61 998 0.01% 62 1159 0.01% 63 1372 0.01% 64 1598 0.01% 65 1840 0.01% 66 2268 0.01% 67 3228 0.02% 68 4936 0.03% 69 9649 0.05% 70 9642 0.05% 71 5116 0.03% 72 4376 0.02% 73 4612 0.02% 74 4933 0.03% 75 5755 0.03% 76 6370 0.03% 77 7145 0.04% 78 7773 0.04% 79 8753 0.05% 80 9385 0.05% 81 10633 0.06% 82 12264 0.07% 83 13476 0.07% 84 17032 0.09% 85 19905 0.11% 86 20745 0.11% 87 23206 0.12% 88 23876 0.13% 89 24883 0.13% 90 26490 0.14% 91 27508 0.15% 92 28908 0.15% 93 30403 0.16% 94 32408 0.17% 95 33490 0.18% 96 35436 0.19% 97 36910 0.20% 98 38613 0.21% 99 40576 0.22% 100 42581 0.23% 101 44384 0.24% 102 46740 0.25% 103 48918 0.26% 104 51169 0.27% 105 53328 0.28% 106 55689 0.30% 107 58263 0.31% 108 60360 0.32% 109 62297 0.33% 110 63684 0.34% 111 65779 0.35% 112 68562 0.37% 113 72756 0.39% 114 76588 0.41% 115 79556 0.42% 116 81424 0.43% 117 82860 0.44% 118 84606 0.45% 119 85117 0.45% 120 89591 0.48% 121 91273 0.49% 122 93980 0.50% 123 96967 0.52% 124 100027 0.53% 125 102416 0.55% 126 106404 0.57% 127 109467 0.58% 128 110036 0.59% 129 115389 0.62% 130 117798 0.63% 131 119676 0.64% 132 124547 0.67% 133 129037 0.69% 134 132286 0.71% 135 137264 0.73% 136 142464 0.76% 137 146103 0.78% 138 155259 0.83% 139 162761 0.87% 140 172737 0.92% 141 179948 0.96% 142 200390 1.07% 143 211552 1.13% 144 230288 1.23% 145 261314 1.40% 146 302046 1.61% 147 377669 2.02% 148 521555 2.79% 149 862949 4.61% 150 3269680 17.46% 151 7859546 41.98% 18723351 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=32 prefix-density=0.66 prefix-fanout=2.0 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.25 sequence-density-rank=13 fanout-score=21.99 fanout-score-rank=1 prefix-density=2.85 prefix-fanout=1.9 sequence=TTCGTTTTTTTTCTTG criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=2.1 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.20 sequence-density-rank=17 fanout-score=52.30 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=14.3 sequence=CAAGAAGAAGGT SRR5578470 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:38:23 Started mapping on | Dec 09 19:38:23 Finished on | Dec 09 19:54:00 Mapping speed, Million of reads per hour | 71.94 Number of input reads | 18723351 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 13807228 Uniquely mapped reads % | 73.74% Average mapped length | 284.63 Number of splices: Total | 12960609 Number of splices: Annotated (sjdb) | 12220515 Number of splices: GT/AG | 12792163 Number of splices: GC/AG | 152890 Number of splices: AT/AC | 6770 Number of splices: Non-canonical | 8786 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 124550 % of reads mapped to multiple loci | 0.67% Number of reads mapped to too many loci | 12579 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 25.21% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4817301 4817301 4817301 N_multimapping 124550 124550 124550 N_noFeature 332303 13352514 460791 N_ambiguous 390828 1947 64700 UnstrandedReadsAssigned:13084097 PositiveStrandReadsAssigned:452767 NegativeStrandReadsAssigned:13281737 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5578470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578470-trimmed-pair1.fastq SRR5578470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,723,351 reads, 13,356,539 reads pseudoaligned [quant] estimated average fragment length: 217.59 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR5578470.ke.tsv 35125 SRR5578470.se.tsv 88098 total ==> SRR5578470.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.589 21.9924 2.74713 PNS24247 1044 827.41 11.1149 1.20747 PNS24249 1928 1711.41 40.3368 2.11855 PNS24246 1044 827.41 11.1149 1.20747 PNS24248 1044 827.41 11.1149 1.20747 PNS24244 1471 1254.41 66.326 4.75264 PNS24243 293 110.624 0 0 KQK14069 1603 1386.41 1139.63 73.8862 KQK14071 474 265.885 20.1019 6.7957 ==> SRR5578470.se.tsv <== BRADI_1g14170v3 1208 BRADI_1g53295v3 81 BRADI_1g59795v3 471 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1311 BRADI_1g74790v3 265 BRADI_1g09890v3 5 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR5578470 completed mapping pipeline successfully