Starting /dee2/code/volunteer_pipeline.sh SRR5578472 current disk space = 1522382561280 free memory = 1570155712 SRR5578472 SRAfilesize 2227030fc1ef0796f5d50efda785563b SRR5578472.sra SRR5578472.sra file validated SRR5578472 is paired end SRR5578472 is conventional basespace SRR5578472 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.97075 34.0 33.0 34.0 32.0 34.0 2 33.10525 34.0 33.0 34.0 32.0 34.0 3 33.183 34.0 33.0 34.0 32.0 34.0 4 33.20775 34.0 33.0 34.0 32.0 34.0 5 33.36475 34.0 33.0 34.0 33.0 34.0 6 36.9525 38.0 37.0 38.0 36.0 38.0 7 37.27825 38.0 38.0 38.0 36.0 38.0 8 37.40825 38.0 38.0 38.0 37.0 38.0 9 37.513 38.0 38.0 38.0 37.0 38.0 10-14 37.464 38.0 38.0 38.0 37.2 38.0 15-19 37.46425000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.47 38.0 38.0 38.0 38.0 38.0 25-29 37.41265 38.0 38.0 38.0 37.2 38.0 30-34 37.3445 38.0 38.0 38.0 37.0 38.0 35-39 37.3166 38.0 38.0 38.0 37.0 38.0 40-44 37.20405 38.0 38.0 38.0 37.0 38.0 45-49 37.20315 38.0 38.0 38.0 37.0 38.0 50-54 37.1536 38.0 38.0 38.0 36.2 38.0 55-59 37.1205 38.0 38.0 38.0 36.0 38.0 60-64 37.10339999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.97455000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.8816 38.0 38.0 38.0 35.2 38.0 75-79 36.851600000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.7668 38.0 38.0 38.0 35.0 38.0 85-89 36.5506 38.0 38.0 38.0 34.2 38.0 90-94 36.543749999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.478249999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.3231 38.0 38.0 38.0 34.0 38.0 105-109 36.13575 38.0 37.8 38.0 33.6 38.0 110-114 35.93765 38.0 37.2 38.0 32.8 38.0 115-119 35.802200000000006 38.0 36.8 38.0 32.4 38.0 120-124 35.50135 38.0 36.0 38.0 31.0 38.0 125-129 35.4563 38.0 36.0 38.0 31.0 38.0 130-134 35.02995 38.0 35.2 38.0 28.6 38.0 135-139 34.642250000000004 38.0 35.0 38.0 26.6 38.0 140-144 34.166549999999994 38.0 34.8 38.0 25.0 38.0 145-149 33.585699999999996 38.0 34.8 38.0 20.4 38.0 150-151 29.586624999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 9.0 19 7.0 20 2.0 21 7.0 22 4.0 23 7.0 24 5.0 25 17.0 26 15.0 27 21.0 28 32.0 29 38.0 30 42.0 31 55.0 32 75.0 33 89.0 34 131.0 35 255.0 36 705.0 37 2469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.11912225705329 10.632183908045976 7.41901776384535 33.82967607105538 2 24.349999999999998 13.225000000000001 31.95 30.475 3 22.161080540270135 20.135067533766886 25.212606303151574 32.491245622811405 4 27.55 26.474999999999998 19.8 26.174999999999997 5 26.650000000000002 28.125 22.85 22.375 6 21.525 33.050000000000004 23.5 21.925 7 18.075 23.425 37.675 20.825 8 19.175 24.099999999999998 28.95 27.775 9 19.45 22.7 32.275 25.575 10-14 23.400000000000002 26.590000000000003 24.709999999999997 25.3 15-19 23.345 26.165 25.019999999999996 25.47 20-24 22.665 25.53 25.755 26.05 25-29 22.945 25.64 25.435000000000002 25.979999999999997 30-34 23.275000000000002 25.86 25.1 25.765 35-39 23.35 26.179999999999996 25.080000000000002 25.39 40-44 23.575 26.095000000000002 24.77 25.56 45-49 23.78 25.405 24.195 26.619999999999997 50-54 23.61 25.490000000000002 24.7 26.200000000000003 55-59 24.279999999999998 25.009999999999998 24.945 25.765 60-64 23.62 25.55 24.345 26.484999999999996 65-69 23.425 26.11 24.705 25.759999999999998 70-74 23.53 26.145000000000003 23.93 26.395000000000003 75-79 23.810000000000002 25.480000000000004 24.205 26.505000000000003 80-84 23.985 25.330000000000002 24.3 26.384999999999998 85-89 24.695 24.875 24.565 25.865 90-94 23.995 25.11 24.275 26.619999999999997 95-99 24.490000000000002 25.035 24.85 25.624999999999996 100-104 24.495 25.040000000000003 24.310000000000002 26.155 105-109 24.38 25.240000000000002 24.474999999999998 25.905 110-114 24.81 24.995 24.0 26.195 115-119 24.425 25.074999999999996 23.79 26.71 120-124 24.625 25.474999999999998 23.294999999999998 26.605 125-129 24.529999999999998 25.905 23.715 25.85 130-134 24.985 25.595000000000002 23.23 26.19 135-139 24.455 25.935000000000002 23.135 26.474999999999998 140-144 24.45 25.115 23.31 27.125 145-149 24.075 25.5 23.294999999999998 27.13 150-151 24.975 23.4375 23.9875 27.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.5 28 2.5 29 2.0 30 5.5 31 11.5 32 14.0 33 15.5 34 23.0 35 34.5 36 48.0 37 70.5 38 87.5 39 90.0 40 115.5 41 149.5 42 166.5 43 168.0 44 165.5 45 176.0 46 181.0 47 183.5 48 187.0 49 182.5 50 169.0 51 144.0 52 132.5 53 131.5 54 116.5 55 99.0 56 96.0 57 95.0 58 91.5 59 91.0 60 85.0 61 79.0 62 74.0 63 67.5 64 61.0 65 56.0 66 53.5 67 57.5 68 52.5 69 37.5 70 27.0 71 16.0 72 16.0 73 17.5 74 14.0 75 11.0 76 6.0 77 5.5 78 3.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96176247151178 97.7 2 0.8863003291972652 1.7500000000000002 3 0.10129146619397315 0.3 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.7750000000000004 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 5.1625 0.0 0.0 0.0 0.0 114-115 6.050000000000001 0.0 0.0 0.0 0.0 116-117 6.7875 0.0 0.0 0.0 0.0 118-119 7.45 0.0 0.0 0.0 0.0 120-121 8.075 0.0 0.0 0.0 0.0 122-123 8.675 0.0 0.0 0.0 0.0 124-125 9.5125 0.0 0.0 0.0 0.0 126-127 10.524999999999999 0.0 0.0 0.0 0.0 128-129 11.2625 0.0 0.0 0.0 0.0 130-131 12.05 0.0 0.0 0.0 0.0 132-133 13.0 0.0 0.0 0.0 0.0 134-135 13.7625 0.0 0.0 0.0 0.0 136-137 14.6375 0.0 0.0 0.0 0.0 138-139 15.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578472 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71125 33.0 33.0 34.0 32.0 34.0 2 32.83975 33.0 33.0 34.0 32.0 34.0 3 32.76175 34.0 33.0 34.0 32.0 34.0 4 32.711 34.0 33.0 34.0 32.0 34.0 5 32.695 34.0 33.0 34.0 32.0 34.0 6 36.90675 38.0 38.0 38.0 36.0 38.0 7 36.8045 38.0 38.0 38.0 36.0 38.0 8 36.84625 38.0 38.0 38.0 36.0 38.0 9 36.71925 38.0 38.0 38.0 36.0 38.0 10-14 36.78255 38.0 38.0 38.0 36.0 38.0 15-19 36.72645 38.0 38.0 38.0 35.8 38.0 20-24 36.67835 38.0 38.0 38.0 35.8 38.0 25-29 36.690799999999996 38.0 38.0 38.0 35.8 38.0 30-34 36.71035 38.0 38.0 38.0 36.0 38.0 35-39 36.665850000000006 38.0 38.0 38.0 35.6 38.0 40-44 36.69455000000001 38.0 38.0 38.0 35.8 38.0 45-49 36.65365 38.0 38.0 38.0 35.8 38.0 50-54 36.55275 38.0 38.0 38.0 35.0 38.0 55-59 36.461299999999994 38.0 38.0 38.0 34.6 38.0 60-64 36.393600000000006 38.0 38.0 38.0 34.4 38.0 65-69 36.3839 38.0 38.0 38.0 34.2 38.0 70-74 36.263099999999994 38.0 38.0 38.0 34.0 38.0 75-79 36.226749999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.201049999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.03545 38.0 38.0 38.0 33.4 38.0 90-94 35.90575 38.0 38.0 38.0 33.0 38.0 95-99 35.73885 38.0 37.8 38.0 32.4 38.0 100-104 35.503949999999996 38.0 37.0 38.0 31.0 38.0 105-109 35.34705 38.0 36.6 38.0 29.8 38.0 110-114 35.15885 38.0 36.0 38.0 29.6 38.0 115-119 35.035900000000005 38.0 36.0 38.0 28.6 38.0 120-124 34.70205 38.0 35.4 38.0 27.2 38.0 125-129 34.36579999999999 38.0 35.0 38.0 25.8 38.0 130-134 33.735850000000006 38.0 34.2 38.0 22.2 38.0 135-139 33.20725 38.0 33.2 38.0 19.4 38.0 140-144 32.41055 38.0 33.0 38.0 12.8 38.0 145-149 30.915550000000003 38.0 30.8 38.0 6.0 38.0 150-151 25.667875 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 3.0 5 2.0 6 5.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 4.0 13 3.0 14 5.0 15 9.0 16 7.0 17 9.0 18 15.0 19 10.0 20 9.0 21 10.0 22 14.0 23 17.0 24 22.0 25 17.0 26 30.0 27 26.0 28 39.0 29 37.0 30 50.0 31 85.0 32 67.0 33 125.0 34 178.0 35 311.0 36 717.0 37 2147.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.775 17.825 10.925 27.474999999999998 2 26.875 22.925 27.375 22.825 3 24.9 24.4 25.624999999999996 25.074999999999996 4 29.325000000000003 29.549999999999997 18.325 22.8 5 27.750000000000004 32.9 19.900000000000002 19.45 6 24.5 33.025 20.025000000000002 22.45 7 24.375 18.275 32.25 25.1 8 24.675 21.95 24.224999999999998 29.15 9 24.275 22.5 25.674999999999997 27.55 10-14 26.655 24.72 22.345000000000002 26.279999999999998 15-19 26.43 24.905 23.555 25.11 20-24 25.740000000000002 25.0 23.985 25.275 25-29 26.93 24.735 23.72 24.615000000000002 30-34 26.590000000000003 24.560000000000002 23.724999999999998 25.124999999999996 35-39 26.695 24.34 24.224999999999998 24.740000000000002 40-44 25.900000000000002 24.995 23.544999999999998 25.56 45-49 26.834999999999997 24.435000000000002 23.84 24.89 50-54 26.235000000000003 23.48 25.15 25.135 55-59 27.284999999999997 24.425 24.345 23.945 60-64 26.400000000000002 24.795 24.235 24.57 65-69 26.284999999999997 24.64 24.610000000000003 24.465 70-74 27.05 24.615000000000002 23.875 24.46 75-79 26.005 24.26 24.73 25.005 80-84 26.38 24.595 24.265 24.759999999999998 85-89 25.89 24.86 24.240000000000002 25.009999999999998 90-94 26.13 25.119999999999997 24.46 24.29 95-99 26.245 24.905 24.865000000000002 23.985 100-104 26.919999999999998 24.25 24.474999999999998 24.355 105-109 26.655 25.014999999999997 24.4 23.93 110-114 26.99 25.080000000000002 23.895 24.035 115-119 27.205000000000002 25.4 23.735 23.66 120-124 27.755000000000003 24.65 24.055 23.54 125-129 27.71 25.085 24.169999999999998 23.035 130-134 27.99 25.46 23.865 22.685 135-139 28.565 25.424999999999997 23.96 22.05 140-144 28.38 25.575 24.005000000000003 22.040000000000003 145-149 28.925 25.53 23.294999999999998 22.25 150-151 29.299999999999997 25.75 23.2625 21.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 1.5 28 0.5 29 2.5 30 3.0 31 3.0 32 5.5 33 6.0 34 9.5 35 17.5 36 26.0 37 36.0 38 55.5 39 82.0 40 112.0 41 124.0 42 125.0 43 149.0 44 174.5 45 185.0 46 198.0 47 191.0 48 162.5 49 149.0 50 155.0 51 161.0 52 143.5 53 131.0 54 127.5 55 126.5 56 126.0 57 115.0 58 107.0 59 117.5 60 106.0 61 81.0 62 79.5 63 78.0 64 72.5 65 60.0 66 61.5 67 62.0 68 47.0 69 41.0 70 42.0 71 37.5 72 27.5 73 21.5 74 18.0 75 14.5 76 7.5 77 4.0 78 3.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11459650898053 97.95 2 0.6830255502150265 1.35 3 0.12648621300278268 0.375 4 0.05059448520111307 0.2 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.8624999999999998 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.3625 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.0999999999999996 0.0 0.0 0.0 0.0 108-109 3.7375 0.0 0.0 0.0 0.0 110-111 4.324999999999999 0.0 0.0 0.0 0.0 112-113 5.050000000000001 0.0 0.0 0.0 0.0 114-115 5.925000000000001 0.0 0.0 0.0 0.0 116-117 6.7 0.0 0.0 0.0 0.0 118-119 7.375 0.0 0.0 0.0 0.0 120-121 7.975 0.0 0.0 0.0 0.0 122-123 8.5625 0.0 0.0 0.0 0.0 124-125 9.4125 0.0 0.0 0.0 0.0 126-127 10.4375 0.0 0.0 0.0 0.0 128-129 11.1375 0.0 0.0 0.0 0.0 130-131 11.925 0.0 0.0 0.0 0.0 132-133 12.8625 0.0 0.0 0.0 0.0 134-135 13.6625 0.0 0.0 0.0 0.0 136-137 14.5375 0.0 0.0 0.0 0.0 138-139 15.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238733 spots for SRR5578472.sra Written 1238733 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra Read 1238716 spots for SRR5578472.sra Written 1238716 spots for SRR5578472.sra SRR ids: ['SRR5578472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5__aamjt SRR5578472.sra spots: 24774337 blocks: [[1, 1238716], [1238717, 2477432], [2477433, 3716148], [3716149, 4954864], [4954865, 6193580], [6193581, 7432296], [7432297, 8671012], [8671013, 9909728], [9909729, 11148444], [11148445, 12387160], [12387161, 13625876], [13625877, 14864592], [14864593, 16103308], [16103309, 17342024], [17342025, 18580740], [18580741, 19819456], [19819457, 21058172], [21058173, 22296888], [22296889, 23535604], [23535605, 24774337]] SRR5578472 file size 8373509 SRR5578472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578472 SRR5578472_1.fastq SRR5578472_2.fastq Input file: SRR5578472_1.fastq Paired file: SRR5578472_2.fastq trimmed: SRR5578472-trimmed-pair1.fastq, SRR5578472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:19:42 2024 >> started Mon Dec 9 19:20:12 2024 >> done (29.882s) 24774337 read pairs processed; of these: 55331 ( 0.22%) short read pairs filtered out after trimming by size control 57784 ( 0.23%) empty read pairs filtered out after trimming by size control 24661222 (99.54%) read pairs available; of these: 13728139 (55.67%) trimmed read pairs available after processing 10933083 (44.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 22 0.00% 20 15 0.00% 21 21 0.00% 22 24 0.00% 23 22 0.00% 24 25 0.00% 25 16 0.00% 26 26 0.00% 27 27 0.00% 28 21 0.00% 29 28 0.00% 30 44 0.00% 31 22 0.00% 32 28 0.00% 33 25 0.00% 34 51 0.00% 35 44 0.00% 36 28 0.00% 37 49 0.00% 38 48 0.00% 39 75 0.00% 40 69 0.00% 41 67 0.00% 42 85 0.00% 43 89 0.00% 44 123 0.00% 45 131 0.00% 46 163 0.00% 47 186 0.00% 48 207 0.00% 49 235 0.00% 50 280 0.00% 51 282 0.00% 52 342 0.00% 53 328 0.00% 54 412 0.00% 55 423 0.00% 56 472 0.00% 57 570 0.00% 58 658 0.00% 59 693 0.00% 60 797 0.00% 61 930 0.00% 62 1010 0.00% 63 1214 0.00% 64 1353 0.01% 65 1590 0.01% 66 1812 0.01% 67 2188 0.01% 68 2497 0.01% 69 3458 0.01% 70 3467 0.01% 71 3472 0.01% 72 4015 0.02% 73 4524 0.02% 74 5225 0.02% 75 6038 0.02% 76 6522 0.03% 77 7271 0.03% 78 8263 0.03% 79 9347 0.04% 80 10158 0.04% 81 11613 0.05% 82 13138 0.05% 83 15177 0.06% 84 19036 0.08% 85 21939 0.09% 86 23759 0.10% 87 25608 0.10% 88 26480 0.11% 89 27330 0.11% 90 28967 0.12% 91 30888 0.13% 92 32272 0.13% 93 34753 0.14% 94 37397 0.15% 95 39317 0.16% 96 42246 0.17% 97 44823 0.18% 98 46508 0.19% 99 48823 0.20% 100 51362 0.21% 101 53201 0.22% 102 56007 0.23% 103 59681 0.24% 104 61903 0.25% 105 65106 0.26% 106 68887 0.28% 107 71005 0.29% 108 73845 0.30% 109 75446 0.31% 110 78455 0.32% 111 80925 0.33% 112 84032 0.34% 113 87410 0.35% 114 90777 0.37% 115 94303 0.38% 116 97362 0.39% 117 100294 0.41% 118 101916 0.41% 119 104057 0.42% 120 107618 0.44% 121 109620 0.44% 122 112219 0.46% 123 114023 0.46% 124 118822 0.48% 125 122087 0.50% 126 125573 0.51% 127 128832 0.52% 128 130449 0.53% 129 134237 0.54% 130 136120 0.55% 131 137799 0.56% 132 141455 0.57% 133 146433 0.59% 134 148199 0.60% 135 153366 0.62% 136 157205 0.64% 137 162106 0.66% 138 167514 0.68% 139 174595 0.71% 140 180229 0.73% 141 187927 0.76% 142 203544 0.83% 143 214296 0.87% 144 236274 0.96% 145 265628 1.08% 146 312958 1.27% 147 397837 1.61% 148 560685 2.27% 149 1062646 4.31% 150 5160165 20.92% 151 10933083 44.33% 24661222 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=13.02 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=7.5 sequence=TTTTTTTTTCCAGAATTCAAGACGTTAACAGTTCTTGGCGCAAATAGCGCTGAATCGCTTCTTTAAAGGCTGCAGCGTCGTCCTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAAAATCAGGCAGTTTTTGATCACGTTTATTGTAAGCCGTCAGCATCGGGATATCATCTGCTTCAAGCTCCTCAAGCAGCCGAAGCACTGTTTTTTCATGTCCCGCATAATCCTCATTTGAAGAATCAATTAAATGCAGAATTAAATCCGCTTCTTTTACTTCCTCAAGCGTTGAGCGGAATGCAGCAATCAATGTCGTCGGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCCGCTTGGCAGGACCATTTTTCTGGTCATCGGGTCCAGCGTGGCAAACAGGAGGTCTTCTTCATAGCTGTCAGCACTCGTCAGGCGGTTGAACCATGTTGATTTCCCTGCGTTTGTATAGCCGACAAGCGCAAT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=5.78 fanout-score-rank=13 prefix-density=0.77 prefix-fanout=4.3 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=56.83 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.1 sequence=GGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAGATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGTAACCAGGCAAGAGTTCAATCGCTTAGTTTCGTGGCGGGATTTGAGGAAAACTGCGACTGTTCTTTAACCAAACATCCGTGCGATTCGTGCCACTCGTAGACGGCATCTCACAGTCACTGAAGGCTATTAAAGAGTTAGCACCCACCATTGGATGAAGCCCAGGATAAGTGACCCCCCCGGACCTTGGAGTTTCATGCTAATCAAAGAAGAGCTAATCCGACGTAAAGTTGCGGCGTTGATTAC SRR5578472 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:21:07 Started mapping on | Dec 09 19:21:07 Finished on | Dec 09 19:28:11 Mapping speed, Million of reads per hour | 209.39 Number of input reads | 24661222 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 22091158 Uniquely mapped reads % | 89.58% Average mapped length | 286.72 Number of splices: Total | 19166403 Number of splices: Annotated (sjdb) | 18031723 Number of splices: GT/AG | 18930355 Number of splices: GC/AG | 212295 Number of splices: AT/AC | 11513 Number of splices: Non-canonical | 12240 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202532 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 32204 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.89% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2408218 2408218 2408218 N_multimapping 202532 202532 202532 N_noFeature 450528 21456083 625178 N_ambiguous 521950 2648 62477 UnstrandedReadsAssigned:21118680 PositiveStrandReadsAssigned:632427 NegativeStrandReadsAssigned:21403503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR5578472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578472-trimmed-pair1.fastq SRR5578472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,661,222 reads, 21,539,238 reads pseudoaligned [quant] estimated average fragment length: 214.207 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 SRR5578472.ke.tsv 35125 SRR5578472.se.tsv 88098 total ==> SRR5578472.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.04 89.5133 7.24474 PNS24247 1044 830.793 21.2276 1.49522 PNS24249 1928 1714.79 70.6859 2.41223 PNS24246 1044 830.793 21.2276 1.49522 PNS24248 1044 830.793 21.2276 1.49522 PNS24244 1471 1257.79 223.118 10.3806 PNS24243 293 112.387 0 0 KQK14069 1603 1389.79 5350.64 225.296 KQK14071 474 268.446 61.1502 13.3302 ==> SRR5578472.se.tsv <== BRADI_1g14170v3 5609 BRADI_1g53295v3 40 BRADI_1g59795v3 378 BRADI_1g07683v3 0 BRADI_1g00485v3 86 BRADI_1g20270v3 2565 BRADI_1g74790v3 101 BRADI_1g09890v3 10 BRADI_1g77505v3 447 BRADI_1g48960v3 0 SRR5578472 completed mapping pipeline successfully