Starting /dee2/code/volunteer_pipeline.sh SRR5578475 current disk space = 1522344779776 free memory = 1372229668 SRR5578475 SRAfilesize ff38903cf481617734fd83b293656b66 SRR5578475.sra SRR5578475.sra file validated SRR5578475 is paired end SRR5578475 is conventional basespace SRR5578475 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.50375 34.0 34.0 34.0 33.0 34.0 2 33.42275 34.0 34.0 34.0 33.0 34.0 3 33.51325 34.0 34.0 34.0 33.0 34.0 4 33.53075 34.0 34.0 34.0 33.0 34.0 5 33.555 34.0 34.0 34.0 33.0 34.0 6 37.30675 38.0 38.0 38.0 36.0 38.0 7 37.4195 38.0 38.0 38.0 37.0 38.0 8 37.51625 38.0 38.0 38.0 38.0 38.0 9 37.499 38.0 38.0 38.0 38.0 38.0 10-14 37.563599999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.529999999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.552899999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.5165 38.0 38.0 38.0 38.0 38.0 30-34 37.5302 38.0 38.0 38.0 38.0 38.0 35-39 37.481049999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.407599999999995 38.0 38.0 38.0 37.4 38.0 45-49 37.4202 38.0 38.0 38.0 37.0 38.0 50-54 37.347699999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.307500000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.270450000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.28285 38.0 38.0 38.0 37.0 38.0 70-74 37.24185 38.0 38.0 38.0 37.0 38.0 75-79 37.1844 38.0 38.0 38.0 36.6 38.0 80-84 37.151050000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.14545 38.0 38.0 38.0 36.0 38.0 90-94 37.018950000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.941700000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.9118 38.0 38.0 38.0 35.2 38.0 105-109 36.764700000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.747299999999996 38.0 38.0 38.0 35.0 38.0 115-119 36.52184999999999 38.0 38.0 38.0 34.2 38.0 120-124 36.42385 38.0 38.0 38.0 34.0 38.0 125-129 36.30255 38.0 38.0 38.0 34.0 38.0 130-134 36.0986 38.0 38.0 38.0 33.2 38.0 135-139 35.9841 38.0 37.8 38.0 33.0 38.0 140-144 35.7496 38.0 36.6 38.0 32.8 38.0 145-149 35.24735 38.0 36.0 38.0 31.2 38.0 150-151 32.168375 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 5.0 21 3.0 22 3.0 23 5.0 24 5.0 25 6.0 26 5.0 27 13.0 28 19.0 29 28.0 30 22.0 31 44.0 32 45.0 33 64.0 34 92.0 35 170.0 36 425.0 37 3031.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.925000000000004 10.475 9.8 37.8 2 24.874623871614844 14.418254764292879 31.87061183550652 28.836509528585758 3 22.375 18.525 24.65 34.449999999999996 4 26.375 26.75 21.15 25.724999999999998 5 26.650000000000002 30.575000000000003 22.0 20.775 6 22.175 33.45 22.400000000000002 21.975 7 17.675 21.875 40.875 19.575 8 21.2 21.575 29.75 27.474999999999998 9 19.125 21.425 34.150000000000006 25.3 10-14 22.96 26.669999999999998 25.674999999999997 24.695 15-19 22.985 25.81 26.224999999999998 24.98 20-24 22.785 25.5 26.529999999999998 25.185000000000002 25-29 22.88 25.755 25.205 26.16 30-34 22.939999999999998 25.41 26.165 25.485000000000003 35-39 22.99 25.019999999999996 25.835 26.155 40-44 23.135 25.34 25.979999999999997 25.545 45-49 23.221161058052903 24.931246562328116 26.23131156557828 25.616280814040703 50-54 23.255 25.2 25.81 25.735000000000003 55-59 23.416170808540425 25.211260563028155 25.676283814190707 25.696284814240713 60-64 22.99 25.224999999999998 25.995 25.790000000000003 65-69 23.265816454113526 25.6064016004001 25.716429107276817 25.41135283820955 70-74 23.236161808090404 25.36626831341567 25.686284314215712 25.711285564278214 75-79 23.36 25.345000000000002 25.775 25.52 80-84 23.01 25.415 25.995 25.580000000000002 85-89 23.08230823082308 24.487448744874488 26.05760576057606 26.37263726372637 90-94 23.26 24.975 25.629999999999995 26.135 95-99 23.369999999999997 25.47 25.240000000000002 25.919999999999998 100-104 23.625 25.585 25.145 25.645 105-109 23.7 24.79 26.174999999999997 25.335 110-114 24.3 25.045 25.255 25.4 115-119 24.385 25.31 24.89 25.415 120-124 23.78618930946547 25.016250812540626 25.29126456322816 25.906295314765735 125-129 24.560000000000002 25.06 24.715 25.665 130-134 24.11 25.745 24.595 25.55 135-139 24.154999999999998 25.21 24.43 26.205000000000002 140-144 24.29 25.405 24.55 25.755 145-149 24.25 25.535000000000004 24.365000000000002 25.85 150-151 23.7125 25.3 23.9125 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.5 28 2.0 29 5.0 30 9.5 31 10.0 32 13.5 33 23.0 34 29.5 35 35.0 36 47.5 37 68.0 38 95.0 39 118.0 40 138.0 41 157.0 42 163.0 43 180.0 44 208.0 45 212.0 46 213.0 47 199.0 48 183.5 49 173.0 50 152.0 51 143.0 52 133.5 53 112.5 54 100.5 55 99.5 56 88.5 57 82.5 58 82.5 59 71.0 60 63.5 61 59.5 62 51.0 63 51.5 64 55.0 65 51.5 66 45.5 67 36.5 68 36.5 69 36.5 70 33.5 71 34.0 72 23.0 73 17.0 74 14.5 75 12.5 76 8.5 77 2.5 78 2.0 79 2.0 80 1.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.025 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.175000000000001 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.387499999999999 0.0 0.0 0.0 0.0 128-129 5.8 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAACAG 10 0.006843168 144.91249 3 >>END_MODULE SRR5578475 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6815 33.0 32.0 33.0 28.0 34.0 2 31.98925 33.0 33.0 34.0 30.0 34.0 3 31.929 33.0 33.0 34.0 29.0 34.0 4 32.02125 33.0 33.0 34.0 31.0 34.0 5 32.00225 33.0 33.0 34.0 31.0 34.0 6 36.08275 38.0 38.0 38.0 33.0 38.0 7 36.0035 38.0 38.0 38.0 33.0 38.0 8 35.91275 38.0 37.0 38.0 33.0 38.0 9 35.96 38.0 38.0 38.0 33.0 38.0 10-14 35.97115 38.0 38.0 38.0 33.0 38.0 15-19 35.8439 38.0 37.2 38.0 32.4 38.0 20-24 35.7571 38.0 37.0 38.0 31.4 38.0 25-29 35.62155 38.0 37.0 38.0 30.6 38.0 30-34 35.406699999999994 38.0 37.0 38.0 29.0 38.0 35-39 35.2668 38.0 36.8 38.0 28.8 38.0 40-44 35.1686 38.0 36.4 38.0 28.2 38.0 45-49 34.950050000000005 38.0 36.0 38.0 28.0 38.0 50-54 34.68265 38.0 35.8 38.0 26.6 38.0 55-59 34.451049999999995 38.0 35.0 38.0 26.2 38.0 60-64 34.070499999999996 38.0 34.8 38.0 22.8 38.0 65-69 33.77954999999999 38.0 34.0 38.0 17.6 38.0 70-74 33.48125 38.0 34.0 38.0 16.0 38.0 75-79 33.1402 38.0 33.8 38.0 16.0 38.0 80-84 32.562650000000005 37.6 32.6 38.0 15.0 38.0 85-89 32.02695 37.0 30.2 38.0 15.0 38.0 90-94 31.429450000000003 37.0 29.0 38.0 15.0 38.0 95-99 30.882150000000003 36.0 28.0 38.0 14.4 38.0 100-104 30.22335 36.0 26.0 38.0 13.6 38.0 105-109 29.406 35.0 23.6 38.0 13.0 38.0 110-114 28.45675 34.4 21.8 38.0 6.4 38.0 115-119 27.55985 34.0 15.0 38.0 2.0 38.0 120-124 26.6068 33.8 15.0 38.0 2.0 38.0 125-129 25.35855 32.6 14.0 37.6 2.0 38.0 130-134 24.01155 30.6 13.0 36.4 2.0 38.0 135-139 22.6402 27.8 6.4 35.8 2.0 38.0 140-144 21.0375 24.0 2.0 35.0 2.0 38.0 145-149 18.0542 14.6 2.0 33.8 2.0 38.0 150-151 13.16725 2.0 2.0 30.5 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 8.0 4 9.0 5 6.0 6 4.0 7 4.0 8 8.0 9 10.0 10 5.0 11 7.0 12 17.0 13 12.0 14 25.0 15 25.0 16 28.0 17 28.0 18 29.0 19 31.0 20 46.0 21 41.0 22 40.0 23 71.0 24 92.0 25 97.0 26 122.0 27 98.0 28 136.0 29 175.0 30 206.0 31 227.0 32 305.0 33 375.0 34 434.0 35 567.0 36 475.0 37 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.859464866216555 17.829457364341085 12.753188297074269 31.557889472368096 2 29.37937937937938 23.2982982982983 25.95095095095095 21.371371371371374 3 23.547094188376754 26.352705410821642 25.90180360721443 24.19839679358717 4 26.903807615230463 31.83867735470942 19.438877755511022 21.8186372745491 5 27.147508139243676 33.50864012021037 19.358878036563986 19.984973703981968 6 23.280820205051263 34.40860215053764 20.280070017504375 22.030507626906726 7 22.411205602801402 18.75937968984492 34.79239619809905 24.037018509254626 8 23.485227841762644 23.209814722083124 24.586880320480724 28.718077115673513 9 22.922922922922922 23.14814814814815 26.826826826826828 27.102102102102105 10-14 25.887359198998748 25.54192740926158 23.008760951188986 25.56195244055069 15-19 25.804675376683186 25.614456625118887 23.837413024978726 24.743454973219205 20-24 25.703132819537583 25.938344510059054 24.336903212891603 24.02161945751176 25-29 25.40143064378971 25.3564103846731 24.451002951328096 24.791156020209094 30-34 25.6254700426172 25.91626974178992 23.960892454249187 24.497367761343693 35-39 25.132858718540056 25.92499749323173 24.30562518800762 24.636518600220594 40-44 26.276787502503506 25.170238333667132 24.2339274984979 24.319046665331463 45-49 25.95840641443247 25.512402906539716 24.25457278877474 24.27461789025307 50-54 26.443631992788102 25.04131817498873 23.939500175289226 24.57554965693394 55-59 26.141369643572286 25.27533039647577 24.59951942330797 23.983780536643973 60-64 25.743466506458397 25.172724541904472 24.476819865825572 24.606989085811552 65-69 25.453089015720437 25.63332332031641 24.001201562030637 24.912386101932512 70-74 25.683251576734406 25.788367203924317 24.426869556512163 24.10151166282911 75-79 25.453361386634604 25.448351868550244 24.737000300571086 24.36128644424406 80-84 25.339004253189895 25.794345759319487 24.798598949211907 24.06805103827871 85-89 25.947973986993496 25.792896448224113 24.14207103551776 24.117058529264632 90-94 25.608168985884472 25.658224046451096 24.772249474421866 23.961357493242566 95-99 25.500700981373924 26.42699779691568 24.2339274984979 23.8383737232125 100-104 26.35290587176153 25.922776833049916 23.632089626888067 24.092227668300488 105-109 25.75332866152768 25.933526879567527 24.021423565922515 24.29172089298228 110-114 25.83212372991641 26.2725862155263 24.02022123229391 23.875068822263376 115-119 26.69735327963176 25.396507730024513 24.000600390253666 23.90553860009006 120-124 26.103051525762883 26.338169084542272 23.526763381690845 24.032016008004 125-129 26.21728469198819 26.67767602462093 23.860281239053197 23.244758044337686 130-134 26.945208906680012 26.454841130848134 23.222416812609456 23.377533149862398 135-139 26.712020409184134 26.8520834375469 23.275473963283478 23.160422189985493 140-144 26.534287000450156 27.51463012054219 22.878007302555893 23.073075576451757 145-149 27.420484096819365 27.190438087617526 22.694538907781556 22.694538907781556 150-151 26.703337917239654 28.041005125640705 22.777847230903863 22.477809726215778 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 3.5 29 6.5 30 9.5 31 10.0 32 13.0 33 17.0 34 21.0 35 31.0 36 49.0 37 63.0 38 84.5 39 111.0 40 132.5 41 154.0 42 169.0 43 176.5 44 187.5 45 182.5 46 175.5 47 187.5 48 170.5 49 157.5 50 152.0 51 127.5 52 109.0 53 105.0 54 107.5 55 98.0 56 96.5 57 90.0 58 80.0 59 78.5 60 75.5 61 67.0 62 62.5 63 64.0 64 59.0 65 64.5 66 62.0 67 54.0 68 53.5 69 55.0 70 51.5 71 39.5 72 31.5 73 26.0 74 19.5 75 12.5 76 8.5 77 8.0 78 6.0 79 3.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.1 3 0.2 4 0.2 5 0.17500000000000002 6 0.025 7 0.05 8 0.15 9 0.1 10-14 0.125 15-19 0.11499999999999999 20-24 0.09 25-29 0.045 30-34 0.27499999999999997 35-39 0.27 40-44 0.13999999999999999 45-49 0.22499999999999998 50-54 0.165 55-59 0.12 60-64 0.13 65-69 0.13 70-74 0.11 75-79 0.19 80-84 0.075 85-89 0.05 90-94 0.11 95-99 0.13999999999999999 100-104 0.03 105-109 0.11 110-114 0.105 115-119 0.065 120-124 0.05 125-129 0.08499999999999999 130-134 0.075 135-139 0.045 140-144 0.034999999999999996 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7321383489017925 1.4500000000000002 3 0.050492299924261554 0.15 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.137499999999999 0.0 0.0 0.0 0.0 136-137 4.4875 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195843 spots for SRR5578475.sra Written 1195843 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra Read 1195833 spots for SRR5578475.sra Written 1195833 spots for SRR5578475.sra SRR ids: ['SRR5578475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r41zhut2 SRR5578475.sra spots: 23916670 blocks: [[1, 1195833], [1195834, 2391666], [2391667, 3587499], [3587500, 4783332], [4783333, 5979165], [5979166, 7174998], [7174999, 8370831], [8370832, 9566664], [9566665, 10762497], [10762498, 11958330], [11958331, 13154163], [13154164, 14349996], [14349997, 15545829], [15545830, 16741662], [16741663, 17937495], [17937496, 19133328], [19133329, 20329161], [20329162, 21524994], [21524995, 22720827], [22720828, 23916670]] SRR5578475 file size 8082874 SRR5578475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578475 SRR5578475_1.fastq SRR5578475_2.fastq Input file: SRR5578475_1.fastq Paired file: SRR5578475_2.fastq trimmed: SRR5578475-trimmed-pair1.fastq, SRR5578475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:38:10 2024 >> started Mon Dec 9 19:40:19 2024 >> done (128.601s) 23916670 read pairs processed; of these: 71682 ( 0.30%) short read pairs filtered out after trimming by size control 75538 ( 0.32%) empty read pairs filtered out after trimming by size control 23769450 (99.38%) read pairs available; of these: 12934783 (54.42%) trimmed read pairs available after processing 10834667 (45.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 12 0.00% 21 15 0.00% 22 15 0.00% 23 11 0.00% 24 21 0.00% 25 10 0.00% 26 20 0.00% 27 18 0.00% 28 13 0.00% 29 28 0.00% 30 26 0.00% 31 27 0.00% 32 16 0.00% 33 37 0.00% 34 25 0.00% 35 29 0.00% 36 27 0.00% 37 36 0.00% 38 42 0.00% 39 45 0.00% 40 49 0.00% 41 58 0.00% 42 52 0.00% 43 72 0.00% 44 72 0.00% 45 81 0.00% 46 74 0.00% 47 95 0.00% 48 120 0.00% 49 126 0.00% 50 156 0.00% 51 158 0.00% 52 180 0.00% 53 217 0.00% 54 209 0.00% 55 268 0.00% 56 256 0.00% 57 288 0.00% 58 373 0.00% 59 403 0.00% 60 453 0.00% 61 559 0.00% 62 589 0.00% 63 692 0.00% 64 745 0.00% 65 867 0.00% 66 938 0.00% 67 1137 0.00% 68 1225 0.01% 69 1505 0.01% 70 1724 0.01% 71 1759 0.01% 72 2131 0.01% 73 2285 0.01% 74 2593 0.01% 75 2896 0.01% 76 3302 0.01% 77 3674 0.02% 78 4096 0.02% 79 4694 0.02% 80 5189 0.02% 81 5901 0.02% 82 6729 0.03% 83 7711 0.03% 84 10811 0.05% 85 12754 0.05% 86 13322 0.06% 87 14288 0.06% 88 15020 0.06% 89 16134 0.07% 90 17033 0.07% 91 17510 0.07% 92 18713 0.08% 93 20067 0.08% 94 21651 0.09% 95 22813 0.10% 96 24439 0.10% 97 25929 0.11% 98 26940 0.11% 99 29122 0.12% 100 30517 0.13% 101 32302 0.14% 102 34100 0.14% 103 36029 0.15% 104 37845 0.16% 105 40291 0.17% 106 43129 0.18% 107 44939 0.19% 108 47051 0.20% 109 49452 0.21% 110 51457 0.22% 111 54708 0.23% 112 56534 0.24% 113 59983 0.25% 114 63074 0.27% 115 66491 0.28% 116 69231 0.29% 117 71771 0.30% 118 74777 0.31% 119 78188 0.33% 120 81854 0.34% 121 84940 0.36% 122 87903 0.37% 123 91604 0.39% 124 95679 0.40% 125 100114 0.42% 126 104051 0.44% 127 107480 0.45% 128 112325 0.47% 129 115886 0.49% 130 120884 0.51% 131 126436 0.53% 132 131793 0.55% 133 137286 0.58% 134 143780 0.60% 135 151196 0.64% 136 158191 0.67% 137 166086 0.70% 138 176664 0.74% 139 188020 0.79% 140 199794 0.84% 141 213676 0.90% 142 233646 0.98% 143 257711 1.08% 144 286488 1.21% 145 332442 1.40% 146 403969 1.70% 147 524334 2.21% 148 732416 3.08% 149 1250467 5.26% 150 4602058 19.36% 151 10834667 45.58% 23769450 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=11 prefix-density=0.72 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=99.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.5 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=6 prefix-density=0.64 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=60.62 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.0 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578475 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:45:12 Started mapping on | Dec 09 19:45:12 Finished on | Dec 09 19:59:29 Mapping speed, Million of reads per hour | 99.85 Number of input reads | 23769450 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22271122 Uniquely mapped reads % | 93.70% Average mapped length | 289.99 Number of splices: Total | 23755760 Number of splices: Annotated (sjdb) | 22469650 Number of splices: GT/AG | 23438130 Number of splices: GC/AG | 288561 Number of splices: AT/AC | 12586 Number of splices: Non-canonical | 16483 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350911 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 41657 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 1.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1187024 1187024 1187024 N_multimapping 350911 350911 350911 N_noFeature 884925 21650673 1077531 N_ambiguous 506790 3156 79242 UnstrandedReadsAssigned:20879407 PositiveStrandReadsAssigned:617293 NegativeStrandReadsAssigned:21114349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR5578475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578475-trimmed-pair1.fastq SRR5578475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,769,450 reads, 21,279,126 reads pseudoaligned [quant] estimated average fragment length: 246.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52973 SRR5578475.ke.tsv 35125 SRR5578475.se.tsv 88098 total ==> SRR5578475.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.154 4.12102 0.403319 PNS24247 1044 798.8 39.6245 3.3554 PNS24249 1928 1682.8 140.431 5.64482 PNS24246 1044 798.8 39.6245 3.3554 PNS24248 1044 798.8 39.6245 3.3554 PNS24244 1471 1225.8 71.574 3.9496 PNS24243 293 99.0017 0 0 KQK14069 1603 1357.8 1748.57 87.1092 KQK14071 474 244.661 47.6786 13.1819 ==> SRR5578475.se.tsv <== BRADI_1g14170v3 1942 BRADI_1g53295v3 142 BRADI_1g59795v3 574 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 3018 BRADI_1g74790v3 206 BRADI_1g09890v3 6 BRADI_1g77505v3 339 BRADI_1g48960v3 0 SRR5578475 completed mapping pipeline successfully