Starting /dee2/code/volunteer_pipeline.sh SRR5578477 current disk space = 1522137829376 free memory = 1569269152 SRR5578477 SRAfilesize 155fbd0ce5a18364829accc2ca659376 SRR5578477.sra SRR5578477.sra file validated SRR5578477 is paired end SRR5578477 is conventional basespace SRR5578477 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5 34.0 34.0 34.0 33.0 34.0 2 33.3735 34.0 34.0 34.0 33.0 34.0 3 33.4565 34.0 34.0 34.0 33.0 34.0 4 33.52275 34.0 34.0 34.0 33.0 34.0 5 33.5765 34.0 34.0 34.0 33.0 34.0 6 37.24625 38.0 38.0 38.0 36.0 38.0 7 37.55225 38.0 38.0 38.0 37.0 38.0 8 37.67575 38.0 38.0 38.0 38.0 38.0 9 37.71675 38.0 38.0 38.0 38.0 38.0 10-14 37.6734 38.0 38.0 38.0 38.0 38.0 15-19 37.665200000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.67645 38.0 38.0 38.0 38.0 38.0 25-29 37.631150000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.617599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.566950000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.4868 38.0 38.0 38.0 38.0 38.0 45-49 37.433499999999995 38.0 38.0 38.0 37.4 38.0 50-54 37.385999999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.3467 38.0 38.0 38.0 37.0 38.0 60-64 37.30255 38.0 38.0 38.0 37.0 38.0 65-69 37.28925 38.0 38.0 38.0 37.0 38.0 70-74 37.193650000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.11035 38.0 38.0 38.0 36.0 38.0 80-84 37.04875 38.0 38.0 38.0 36.0 38.0 85-89 36.9116 38.0 38.0 38.0 35.2 38.0 90-94 36.83655 38.0 38.0 38.0 35.0 38.0 95-99 36.72155 38.0 38.0 38.0 35.0 38.0 100-104 36.53785 38.0 38.0 38.0 34.4 38.0 105-109 36.42685 38.0 38.0 38.0 34.0 38.0 110-114 36.22365 38.0 37.8 38.0 33.8 38.0 115-119 36.051249999999996 38.0 37.2 38.0 33.2 38.0 120-124 35.8063 38.0 36.4 38.0 32.2 38.0 125-129 35.56905 38.0 36.0 38.0 31.2 38.0 130-134 35.243700000000004 38.0 35.8 38.0 30.2 38.0 135-139 34.8613 38.0 35.0 38.0 28.0 38.0 140-144 34.278749999999995 38.0 35.0 38.0 24.6 38.0 145-149 33.55505000000001 38.0 34.2 38.0 21.0 38.0 150-151 29.244375 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 3.0 16 0.0 17 1.0 18 2.0 19 4.0 20 5.0 21 2.0 22 7.0 23 7.0 24 8.0 25 13.0 26 10.0 27 13.0 28 25.0 29 27.0 30 24.0 31 45.0 32 51.0 33 89.0 34 130.0 35 224.0 36 746.0 37 2560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.59637774902975 10.16817593790427 8.615782664941785 37.61966364812419 2 25.324999999999996 13.850000000000001 32.074999999999996 28.749999999999996 3 23.234852278417627 17.100650976464696 24.962443665498245 34.702053079619425 4 29.075 25.3 20.175 25.45 5 27.200000000000003 28.725 23.625 20.45 6 23.25 30.975 22.5 23.275000000000002 7 18.35 22.3 39.025 20.325 8 20.674999999999997 22.15 28.425 28.749999999999996 9 20.849999999999998 21.099999999999998 31.8 26.25 10-14 24.46744674467447 25.48254825482548 24.52245224522452 25.52755275527553 15-19 24.325 24.59 25.145 25.94 20-24 24.2 24.625 24.560000000000002 26.615 25-29 24.3 24.865000000000002 24.98 25.855 30-34 24.54 24.89 24.81 25.759999999999998 35-39 24.0 24.575 24.745 26.68 40-44 24.745 24.465 24.54 26.25 45-49 24.535 23.895 25.165 26.405 50-54 24.740000000000002 24.09 24.62 26.55 55-59 24.495 24.79 24.959999999999997 25.755 60-64 24.67 24.21 24.905 26.215 65-69 24.505 24.345 24.545 26.605 70-74 25.06 24.26 24.065 26.615 75-79 25.365 24.104999999999997 24.055 26.474999999999998 80-84 24.705 24.2 24.33 26.765 85-89 25.055 23.849999999999998 24.279999999999998 26.815 90-94 25.655 23.53 24.310000000000002 26.505000000000003 95-99 25.165 24.15 24.349999999999998 26.334999999999997 100-104 25.41 24.37 24.65 25.569999999999997 105-109 25.89 24.25 23.46 26.400000000000002 110-114 24.47 25.06 23.73 26.740000000000002 115-119 25.314999999999998 24.365000000000002 23.535 26.784999999999997 120-124 26.040000000000003 24.610000000000003 23.305 26.045 125-129 24.65 24.955 23.685000000000002 26.71 130-134 25.525 24.73 23.325000000000003 26.419999999999998 135-139 25.490000000000002 24.645 23.775 26.090000000000003 140-144 25.540000000000003 24.875 23.435 26.150000000000002 145-149 24.735 24.34 24.404999999999998 26.52 150-151 24.962500000000002 24.2 24.025 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 4.5 29 5.0 30 6.5 31 9.0 32 13.5 33 22.5 34 28.0 35 38.0 36 44.5 37 52.5 38 73.0 39 100.5 40 128.5 41 135.0 42 148.0 43 161.0 44 175.0 45 172.5 46 161.0 47 164.5 48 161.0 49 144.5 50 132.0 51 134.0 52 123.5 53 110.0 54 92.5 55 81.0 56 85.0 57 85.5 58 96.0 59 94.5 60 85.5 61 99.0 62 96.5 63 74.5 64 67.5 65 81.5 66 74.0 67 65.5 68 71.0 69 62.0 70 54.5 71 40.0 72 31.5 73 29.0 74 22.0 75 22.0 76 17.5 77 9.0 78 2.5 79 3.0 80 3.5 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.82497441146366 95.575 2 2.047082906857728 4.0 3 0.1023541453428864 0.3 4 0.0 0.0 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.3125 0.0 0.0 0.0 0.0 108-109 3.75 0.0 0.0 0.0 0.0 110-111 4.2875 0.0 0.0 0.0 0.0 112-113 4.75 0.0 0.0 0.0 0.0 114-115 5.2375 0.0 0.0 0.0 0.0 116-117 5.7 0.0 0.0 0.0 0.0 118-119 6.1 0.0 0.0 0.0 0.0 120-121 6.5875 0.0 0.0 0.0 0.0 122-123 7.0125 0.0 0.0 0.0 0.0 124-125 7.5 0.0 0.0 0.0 0.0 126-127 8.4 0.0 0.0 0.0 0.0 128-129 8.875 0.0 0.0 0.0 0.0 130-131 9.75 0.0 0.0 0.0 0.0 132-133 10.5 0.0 0.0 0.0 0.0 134-135 11.375 0.0 0.0 0.0 0.0 136-137 12.1 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578477 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.984 33.0 33.0 34.0 32.0 34.0 2 33.1405 34.0 33.0 34.0 33.0 34.0 3 33.2015 34.0 33.0 34.0 33.0 34.0 4 33.074 34.0 33.0 34.0 33.0 34.0 5 33.16275 34.0 33.0 34.0 33.0 34.0 6 37.3345 38.0 38.0 38.0 37.0 38.0 7 37.3425 38.0 38.0 38.0 38.0 38.0 8 37.3845 38.0 38.0 38.0 38.0 38.0 9 37.29525 38.0 38.0 38.0 37.0 38.0 10-14 37.315999999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.26635 38.0 38.0 38.0 37.6 38.0 20-24 37.26635 38.0 38.0 38.0 37.4 38.0 25-29 37.22925 38.0 38.0 38.0 37.4 38.0 30-34 37.177749999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.20955 38.0 38.0 38.0 37.4 38.0 40-44 37.206849999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.1922 38.0 38.0 38.0 37.0 38.0 50-54 37.14735 38.0 38.0 38.0 37.2 38.0 55-59 37.125800000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.064499999999995 38.0 38.0 38.0 37.0 38.0 65-69 36.97695 38.0 38.0 38.0 36.4 38.0 70-74 36.7877 38.0 38.0 38.0 36.0 38.0 75-79 36.80295 38.0 38.0 38.0 36.0 38.0 80-84 36.758449999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.6348 38.0 38.0 38.0 35.0 38.0 90-94 36.50285 38.0 38.0 38.0 35.0 38.0 95-99 36.36865 38.0 38.0 38.0 34.2 38.0 100-104 36.2242 38.0 38.0 38.0 34.0 38.0 105-109 36.123000000000005 38.0 38.0 38.0 34.0 38.0 110-114 35.918899999999994 38.0 38.0 38.0 33.2 38.0 115-119 35.8137 38.0 37.8 38.0 33.0 38.0 120-124 35.4825 38.0 36.8 38.0 31.2 38.0 125-129 35.1181 38.0 36.0 38.0 29.2 38.0 130-134 34.6482 38.0 35.8 38.0 27.2 38.0 135-139 34.18095 38.0 34.4 38.0 25.2 38.0 140-144 33.419799999999995 38.0 33.0 38.0 20.4 38.0 145-149 32.26225 38.0 33.0 38.0 10.4 38.0 150-151 26.883499999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 4.0 5 3.0 6 2.0 7 0.0 8 4.0 9 1.0 10 2.0 11 3.0 12 3.0 13 2.0 14 5.0 15 2.0 16 5.0 17 6.0 18 2.0 19 6.0 20 4.0 21 8.0 22 9.0 23 4.0 24 12.0 25 18.0 26 13.0 27 14.0 28 32.0 29 36.0 30 48.0 31 50.0 32 65.0 33 90.0 34 142.0 35 245.0 36 642.0 37 2510.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.6 17.849999999999998 10.7 32.85 2 28.175 23.875 28.15 19.8 3 24.25 24.349999999999998 25.900000000000002 25.5 4 27.85 30.3 17.849999999999998 24.0 5 27.175 33.1 18.125 21.6 6 24.349999999999998 33.900000000000006 19.125 22.625 7 22.175 18.4 34.1 25.324999999999996 8 23.125 23.175 23.025000000000002 30.675 9 24.175 21.975 25.25 28.599999999999998 10-14 26.63 25.185000000000002 22.075 26.11 15-19 26.77035407081416 24.279855971194237 22.744548909781955 26.205241048209643 20-24 26.31894784217633 24.948742311346702 22.908436265439818 25.823873581037155 25-29 26.843421710855424 24.19709854927464 23.226613306653327 25.732866433216607 30-34 26.550533113080043 24.828552835761126 22.811232917855534 25.809681133303297 35-39 26.815111333500123 24.148111083312486 23.587690768076058 25.449086815111333 40-44 26.410564225690276 23.999599839935975 23.539415766306522 26.05042016806723 45-49 26.573601521064745 24.196937856499552 23.6865806064245 25.54288001601121 50-54 26.90710819868941 23.985793607123203 23.630633785203344 25.476464408984047 55-59 27.36736736736737 23.77877877877878 22.93793793793794 25.915915915915917 60-64 26.495170411891294 23.862669536059254 23.42225113858165 26.219908913467794 65-69 25.98007309868322 24.297802032744205 23.61187603264407 26.110248835928502 70-74 26.65965755482127 23.936116952037647 23.445479122859716 25.958746370281364 75-79 26.449094003403744 24.35679247171889 23.641005105616177 25.55310841926119 80-84 25.99749687108886 24.56070087609512 23.103879849812266 26.337922403003756 85-89 26.91576630652261 23.92957182873149 22.97919167667067 26.175470188075227 90-94 27.079477817236032 23.79332766468264 23.81833641774621 25.30885810033512 95-99 26.91345672836418 24.55727863931966 23.566783391695846 24.96248124062031 100-104 26.856856856856858 24.214214214214213 23.35835835835836 25.570570570570574 105-109 26.981028182409773 24.793512539420334 22.80122140461531 25.42423787355459 110-114 26.880320480721082 25.04256384576865 23.480220330495744 24.59689534301452 115-119 27.97836646802544 24.082327607792077 23.08578296359357 24.853522960588915 120-124 27.50851191668336 24.829761666332868 22.77688764269978 24.884838774284 125-129 28.11936711395954 24.869817744842777 22.84197877027839 24.168836370919287 130-134 28.71019427198077 24.939915882235127 22.466453034247948 23.88343681153615 135-139 28.514237101536306 25.381574338187455 22.83440924786068 23.269779312415555 140-144 28.125312781503354 25.18266439795816 22.94565108597738 23.746371734561105 145-149 28.662930344275424 25.405324259407525 22.763210568454763 23.16853482786229 150-151 28.369592398099524 25.806451612903224 22.61815453863466 23.20580145036259 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 0.5 28 2.0 29 2.5 30 4.0 31 7.5 32 9.5 33 11.0 34 19.5 35 27.0 36 31.5 37 48.5 38 72.5 39 88.5 40 113.5 41 133.0 42 133.5 43 136.0 44 142.0 45 146.0 46 151.0 47 159.0 48 156.0 49 137.0 50 126.0 51 127.5 52 112.5 53 106.0 54 115.5 55 107.0 56 96.5 57 94.5 58 98.0 59 101.5 60 97.0 61 92.5 62 97.5 63 106.5 64 102.5 65 92.5 66 84.0 67 82.0 68 80.0 69 76.5 70 67.0 71 51.0 72 41.5 73 32.0 74 28.5 75 20.5 76 9.0 77 6.0 78 4.5 79 4.0 80 2.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.015 25-29 0.05 30-34 0.11499999999999999 35-39 0.075 40-44 0.04 45-49 0.06999999999999999 50-54 0.045 55-59 0.1 60-64 0.095 65-69 0.135 70-74 0.13 75-79 0.11 80-84 0.125 85-89 0.04 90-94 0.034999999999999996 95-99 0.05 100-104 0.1 105-109 0.11499999999999999 110-114 0.15 115-119 0.155 120-124 0.13999999999999999 125-129 0.13999999999999999 130-134 0.13999999999999999 135-139 0.08499999999999999 140-144 0.09 145-149 0.08 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.42268041237114 94.5 2 2.1391752577319587 4.15 3 0.36082474226804123 1.05 4 0.07731958762886598 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.9 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.7125 0.0 0.0 0.0 0.0 110-111 4.225 0.0 0.0 0.0 0.0 112-113 4.699999999999999 0.0 0.0 0.0 0.0 114-115 5.2125 0.0 0.0 0.0 0.0 116-117 5.65 0.0 0.0 0.0 0.0 118-119 6.0625 0.0 0.0 0.0 0.0 120-121 6.5625 0.0 0.0 0.0 0.0 122-123 7.012499999999999 0.0 0.0 0.0 0.0 124-125 7.55 0.0 0.0 0.0 0.0 126-127 8.45 0.0 0.0 0.0 0.0 128-129 8.8875 0.0 0.0 0.0 0.0 130-131 9.7875 0.0 0.0 0.0 0.0 132-133 10.55 0.0 0.0 0.0 0.0 134-135 11.425 0.0 0.0 0.0 0.0 136-137 12.15 0.0 0.0 0.0 0.0 138-139 12.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855157 spots for SRR5578477.sra Written 855157 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra Read 855150 spots for SRR5578477.sra Written 855150 spots for SRR5578477.sra SRR ids: ['SRR5578477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ksufgam2 SRR5578477.sra spots: 17103007 blocks: [[1, 855150], [855151, 1710300], [1710301, 2565450], [2565451, 3420600], [3420601, 4275750], [4275751, 5130900], [5130901, 5986050], [5986051, 6841200], [6841201, 7696350], [7696351, 8551500], [8551501, 9406650], [9406651, 10261800], [10261801, 11116950], [11116951, 11972100], [11972101, 12827250], [12827251, 13682400], [13682401, 14537550], [14537551, 15392700], [15392701, 16247850], [16247851, 17103007]] SRR5578477 file size 5773947 SRR5578477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578477 SRR5578477_1.fastq SRR5578477_2.fastq Input file: SRR5578477_1.fastq Paired file: SRR5578477_2.fastq trimmed: SRR5578477-trimmed-pair1.fastq, SRR5578477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:48:01 2024 >> started Mon Dec 9 19:48:23 2024 >> done (22.657s) 17103007 read pairs processed; of these: 14241 ( 0.08%) short read pairs filtered out after trimming by size control 17716 ( 0.10%) empty read pairs filtered out after trimming by size control 17071050 (99.81%) read pairs available; of these: 9757487 (57.16%) trimmed read pairs available after processing 7313563 (42.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 14 0.00% 21 11 0.00% 22 8 0.00% 23 20 0.00% 24 11 0.00% 25 11 0.00% 26 15 0.00% 27 22 0.00% 28 30 0.00% 29 17 0.00% 30 16 0.00% 31 25 0.00% 32 29 0.00% 33 35 0.00% 34 35 0.00% 35 30 0.00% 36 33 0.00% 37 30 0.00% 38 43 0.00% 39 45 0.00% 40 39 0.00% 41 75 0.00% 42 42 0.00% 43 63 0.00% 44 49 0.00% 45 76 0.00% 46 95 0.00% 47 103 0.00% 48 134 0.00% 49 152 0.00% 50 148 0.00% 51 173 0.00% 52 238 0.00% 53 244 0.00% 54 239 0.00% 55 295 0.00% 56 316 0.00% 57 355 0.00% 58 395 0.00% 59 433 0.00% 60 502 0.00% 61 631 0.00% 62 699 0.00% 63 831 0.00% 64 900 0.01% 65 979 0.01% 66 1111 0.01% 67 1365 0.01% 68 1514 0.01% 69 2065 0.01% 70 2314 0.01% 71 2227 0.01% 72 2665 0.02% 73 3041 0.02% 74 3266 0.02% 75 3605 0.02% 76 3992 0.02% 77 4399 0.03% 78 4841 0.03% 79 5740 0.03% 80 6314 0.04% 81 7032 0.04% 82 8238 0.05% 83 9136 0.05% 84 10617 0.06% 85 11592 0.07% 86 12374 0.07% 87 13154 0.08% 88 14390 0.08% 89 15211 0.09% 90 16037 0.09% 91 17576 0.10% 92 18862 0.11% 93 20340 0.12% 94 21977 0.13% 95 23425 0.14% 96 24383 0.14% 97 26327 0.15% 98 27245 0.16% 99 28605 0.17% 100 29953 0.18% 101 31271 0.18% 102 33307 0.20% 103 35444 0.21% 104 36641 0.21% 105 37883 0.22% 106 39994 0.23% 107 41439 0.24% 108 42708 0.25% 109 44553 0.26% 110 45300 0.27% 111 47203 0.28% 112 49430 0.29% 113 51103 0.30% 114 53333 0.31% 115 55794 0.33% 116 56903 0.33% 117 59028 0.35% 118 59893 0.35% 119 60701 0.36% 120 62510 0.37% 121 64103 0.38% 122 65321 0.38% 123 67711 0.40% 124 70481 0.41% 125 72432 0.42% 126 75275 0.44% 127 76032 0.45% 128 77289 0.45% 129 79560 0.47% 130 81479 0.48% 131 81905 0.48% 132 85309 0.50% 133 88147 0.52% 134 90253 0.53% 135 93345 0.55% 136 96098 0.56% 137 99632 0.58% 138 102698 0.60% 139 108872 0.64% 140 114960 0.67% 141 122384 0.72% 142 131955 0.77% 143 142350 0.83% 144 160923 0.94% 145 187708 1.10% 146 228562 1.34% 147 303129 1.78% 148 452164 2.65% 149 897322 5.26% 150 4082009 23.91% 151 7313563 42.84% 17071050 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.94 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=31 fanout-score=16.96 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=4.7 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTACGACGGCGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGTGCGCTCTTGACAGTCCGGCGCATGGTGA criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=27 prefix-density=0.73 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=46.40 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578477 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:49:15 Started mapping on | Dec 09 19:49:15 Finished on | Dec 09 19:52:29 Mapping speed, Million of reads per hour | 316.78 Number of input reads | 17071050 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16015759 Uniquely mapped reads % | 93.82% Average mapped length | 288.90 Number of splices: Total | 15991245 Number of splices: Annotated (sjdb) | 15141097 Number of splices: GT/AG | 15786855 Number of splices: GC/AG | 189255 Number of splices: AT/AC | 4899 Number of splices: Non-canonical | 10236 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179340 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 21487 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884858 884858 884858 N_multimapping 179340 179340 179340 N_noFeature 477613 15542260 600085 N_ambiguous 422998 1704 73578 UnstrandedReadsAssigned:15115148 PositiveStrandReadsAssigned:471795 NegativeStrandReadsAssigned:15342096 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5578477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578477-trimmed-pair1.fastq SRR5578477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,071,050 reads, 15,339,587 reads pseudoaligned [quant] estimated average fragment length: 232.251 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR5578477.ke.tsv 35125 SRR5578477.se.tsv 88098 total ==> SRR5578477.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.054 0 0 PNS24247 1044 812.749 28.3593 3.031 PNS24249 1928 1696.75 30.4962 1.56126 PNS24246 1044 812.749 28.3593 3.031 PNS24248 1044 812.749 28.3593 3.031 PNS24244 1471 1239.75 29.4258 2.06178 PNS24243 293 108.942 0 0 KQK14069 1603 1371.75 2567.9 162.611 KQK14071 474 258.452 120.241 40.4129 ==> SRR5578477.se.tsv <== BRADI_1g14170v3 3125 BRADI_1g53295v3 65 BRADI_1g59795v3 468 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 127 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 237 BRADI_1g48960v3 0 SRR5578477 completed mapping pipeline successfully