Starting /dee2/code/volunteer_pipeline.sh SRR5578480 current disk space = 1521941438464 free memory = 1569070800 SRR5578480 SRAfilesize 94576910ae9c5e64e23209f1cf45e072 SRR5578480.sra SRR5578480.sra file validated SRR5578480 is paired end SRR5578480 is conventional basespace SRR5578480 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75575 34.0 34.0 34.0 33.0 34.0 2 33.37925 34.0 34.0 34.0 33.0 34.0 3 33.44325 34.0 34.0 34.0 33.0 34.0 4 33.57575 34.0 34.0 34.0 33.0 34.0 5 33.37975 34.0 34.0 34.0 33.0 34.0 6 37.23925 38.0 38.0 38.0 36.0 38.0 7 37.503 38.0 38.0 38.0 37.0 38.0 8 37.64175 38.0 38.0 38.0 38.0 38.0 9 37.60675 38.0 38.0 38.0 38.0 38.0 10-14 37.63135 38.0 38.0 38.0 38.0 38.0 15-19 37.628750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.637649999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.62735 38.0 38.0 38.0 38.0 38.0 30-34 37.6111 38.0 38.0 38.0 38.0 38.0 35-39 37.5795 38.0 38.0 38.0 38.0 38.0 40-44 37.49015 38.0 38.0 38.0 37.6 38.0 45-49 37.4507 38.0 38.0 38.0 37.2 38.0 50-54 37.40295 38.0 38.0 38.0 37.0 38.0 55-59 37.381400000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.34905 38.0 38.0 38.0 37.0 38.0 65-69 37.2701 38.0 38.0 38.0 36.6 38.0 70-74 37.19195 38.0 38.0 38.0 36.2 38.0 75-79 37.193400000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.122400000000006 38.0 38.0 38.0 36.0 38.0 85-89 37.04975 38.0 38.0 38.0 36.0 38.0 90-94 36.95275 38.0 38.0 38.0 35.8 38.0 95-99 36.8474 38.0 38.0 38.0 35.0 38.0 100-104 36.6922 38.0 38.0 38.0 34.6 38.0 105-109 36.5558 38.0 38.0 38.0 34.0 38.0 110-114 36.44395 38.0 38.0 38.0 34.0 38.0 115-119 36.31275 38.0 38.0 38.0 34.0 38.0 120-124 36.141000000000005 38.0 37.2 38.0 33.2 38.0 125-129 35.86615 38.0 36.6 38.0 32.4 38.0 130-134 35.51245 38.0 36.0 38.0 31.0 38.0 135-139 35.174600000000005 38.0 35.8 38.0 29.6 38.0 140-144 34.71535 38.0 35.2 38.0 27.6 38.0 145-149 34.01605000000001 38.0 35.0 38.0 23.0 38.0 150-151 30.328625000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 3.0 20 3.0 21 3.0 22 7.0 23 5.0 24 11.0 25 9.0 26 14.0 27 21.0 28 23.0 29 26.0 30 35.0 31 46.0 32 45.0 33 65.0 34 126.0 35 233.0 36 564.0 37 2759.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.381562099871964 9.859154929577464 8.476312419974393 39.28297055057619 2 24.05 13.325000000000001 33.825 28.799999999999997 3 22.630657664416105 19.02975743935984 23.330832708177045 35.00875218804701 4 28.9 25.374999999999996 20.525 25.2 5 26.41367177682835 30.057803468208093 21.73913043478261 21.78939432018095 6 21.525 34.55 23.625 20.3 7 17.150000000000002 24.224999999999998 39.5 19.125 8 20.175 22.175 29.725 27.925 9 20.625 21.025 31.75 26.6 10-14 22.945 27.245 25.169999999999998 24.64 15-19 22.335 25.72 26.25 25.695 20-24 22.43 25.645 26.26 25.665 25-29 23.275000000000002 25.825 26.169999999999998 24.73 30-34 23.01 25.705 25.445 25.840000000000003 35-39 23.31 25.014999999999997 26.19 25.485000000000003 40-44 22.785 25.480000000000004 25.990000000000002 25.745 45-49 23.005 26.009999999999998 25.650000000000002 25.335 50-54 23.225 25.185000000000002 25.855 25.735000000000003 55-59 23.135 25.900000000000002 25.5 25.465 60-64 23.0 25.235000000000003 25.81 25.955000000000002 65-69 22.96 25.380000000000003 25.865 25.795 70-74 23.74 25.335 26.305 24.62 75-79 23.215 25.635 25.52 25.629999999999995 80-84 22.95 25.674999999999997 25.915 25.46 85-89 23.47 24.709999999999997 26.150000000000002 25.669999999999998 90-94 23.465 25.165 25.835 25.535000000000004 95-99 23.53 25.2 25.595000000000002 25.674999999999997 100-104 23.799999999999997 25.145 25.335 25.72 105-109 23.705000000000002 25.174999999999997 24.815 26.305 110-114 23.18 25.480000000000004 25.665 25.674999999999997 115-119 23.615 25.765 25.14 25.480000000000004 120-124 23.34116705835292 25.876293814690737 25.401270063503173 25.38126906345317 125-129 23.900975243810954 25.896474118529632 24.351087771942986 25.851462865716428 130-134 23.969587835134053 26.015406162464988 24.66486594637855 25.350140056022408 135-139 23.770696813566104 26.621979890950925 24.285928667900556 25.32139462758241 140-144 24.02 26.05 23.615 26.314999999999998 145-149 23.215 26.16 24.529999999999998 26.095000000000002 150-151 24.125830304549442 25.59217947111167 25.19112670760747 25.09086351673142 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 3.5 28 5.0 29 8.0 30 13.0 31 16.0 32 16.0 33 22.5 34 32.0 35 39.5 36 59.0 37 68.0 38 79.0 39 108.0 40 136.5 41 157.0 42 170.5 43 186.5 44 185.5 45 198.0 46 201.5 47 186.0 48 187.0 49 182.5 50 159.5 51 139.0 52 129.5 53 119.5 54 117.5 55 110.0 56 100.0 57 90.0 58 86.5 59 83.0 60 72.0 61 71.0 62 66.5 63 51.5 64 49.5 65 48.5 66 40.5 67 33.5 68 29.0 69 29.5 70 27.5 71 21.5 72 17.5 73 15.0 74 10.5 75 5.5 76 3.0 77 3.0 78 2.0 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.025 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.025 130-134 0.04 135-139 0.045 140-144 0.0 145-149 0.0 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.5793450881612091 1.15 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.575 0.0 0.0 0.0 0.0 94-95 1.8375 0.0 0.0 0.0 0.0 96-97 2.1500000000000004 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.0875000000000004 0.0 0.0 0.0 0.0 104-105 3.4625 0.0 0.0 0.0 0.0 106-107 3.9250000000000003 0.0 0.0 0.0 0.0 108-109 4.45 0.0 0.0 0.0 0.0 110-111 4.887499999999999 0.0 0.0 0.0 0.0 112-113 5.387499999999999 0.0 0.0 0.0 0.0 114-115 6.012499999999999 0.0 0.0 0.0 0.0 116-117 6.6125 0.0 0.0 0.0 0.0 118-119 7.074999999999999 0.0 0.0 0.0 0.0 120-121 7.7125 0.0 0.0 0.0 0.0 122-123 8.35 0.0 0.0 0.0 0.0 124-125 9.025 0.0 0.0 0.0 0.0 126-127 9.850000000000001 0.0 0.0 0.0 0.0 128-129 10.787500000000001 0.0 0.0 0.0 0.0 130-131 11.8625 0.0 0.0 0.0 0.0 132-133 12.7 0.0 0.0 0.0 0.0 134-135 13.25 0.0 0.0 0.0 0.0 136-137 14.1875 0.0 0.0 0.0 0.0 138-139 14.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGG 10 0.006836113 144.9625 6 CTGGGCA 10 0.006836113 144.9625 8 CGGATCC 10 0.006836113 144.9625 3 >>END_MODULE SRR5578480 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.984 33.0 33.0 34.0 32.0 34.0 2 33.08825 34.0 33.0 34.0 32.0 34.0 3 33.11975 34.0 33.0 34.0 33.0 34.0 4 33.07975 34.0 33.0 34.0 33.0 34.0 5 33.096 34.0 33.0 34.0 33.0 34.0 6 37.26425 38.0 38.0 38.0 37.0 38.0 7 37.3355 38.0 38.0 38.0 37.0 38.0 8 37.3325 38.0 38.0 38.0 37.0 38.0 9 37.2025 38.0 38.0 38.0 37.0 38.0 10-14 37.3257 38.0 38.0 38.0 37.0 38.0 15-19 37.2279 38.0 38.0 38.0 37.0 38.0 20-24 37.26555 38.0 38.0 38.0 37.0 38.0 25-29 37.218799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.21355 38.0 38.0 38.0 37.0 38.0 35-39 37.21155 38.0 38.0 38.0 37.0 38.0 40-44 37.21169999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.165 38.0 38.0 38.0 37.0 38.0 50-54 37.0591 38.0 38.0 38.0 36.6 38.0 55-59 37.008 38.0 38.0 38.0 36.0 38.0 60-64 36.91275 38.0 38.0 38.0 36.0 38.0 65-69 36.81275 38.0 38.0 38.0 35.8 38.0 70-74 36.73465 38.0 38.0 38.0 35.2 38.0 75-79 36.687 38.0 38.0 38.0 35.0 38.0 80-84 36.575149999999994 38.0 38.0 38.0 34.8 38.0 85-89 36.46945 38.0 38.0 38.0 34.0 38.0 90-94 36.3223 38.0 38.0 38.0 34.0 38.0 95-99 36.16885 38.0 38.0 38.0 34.0 38.0 100-104 35.935700000000004 38.0 37.6 38.0 33.0 38.0 105-109 35.6999 38.0 37.0 38.0 32.0 38.0 110-114 35.47715 38.0 36.8 38.0 31.0 38.0 115-119 35.20335 38.0 36.0 38.0 29.4 38.0 120-124 34.92289999999999 38.0 35.6 38.0 28.2 38.0 125-129 34.44019999999999 38.0 35.0 38.0 25.6 38.0 130-134 33.98845 38.0 34.8 38.0 23.2 38.0 135-139 33.0519 38.0 33.0 38.0 17.4 38.0 140-144 32.15595 38.0 32.0 38.0 13.2 38.0 145-149 30.850150000000003 38.0 30.4 38.0 6.4 38.0 150-151 25.430125 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.0 9 4.0 10 2.0 11 0.0 12 5.0 13 1.0 14 4.0 15 1.0 16 6.0 17 10.0 18 1.0 19 6.0 20 8.0 21 4.0 22 12.0 23 12.0 24 12.0 25 18.0 26 23.0 27 38.0 28 37.0 29 44.0 30 48.0 31 67.0 32 73.0 33 122.0 34 198.0 35 350.0 36 792.0 37 2092.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 16.125 12.375 33.050000000000004 2 29.43235808952238 22.85571392848212 28.532133033258315 19.179794948737182 3 22.375 25.6 27.575 24.45 4 27.93198299574894 30.182545636409102 19.904976244061015 21.980495123780948 5 28.68217054263566 33.28332083020755 19.02975743935984 19.004751187796952 6 22.6 35.35 20.325 21.725 7 22.1 19.2 35.5 23.200000000000003 8 23.3 23.275000000000002 25.025 28.4 9 24.25 22.25 27.425 26.075 10-14 25.775 25.66 23.674999999999997 24.89 15-19 25.7 25.145 24.465 24.69 20-24 25.86 25.77 24.310000000000002 24.060000000000002 25-29 25.840000000000003 25.979999999999997 23.7 24.48 30-34 26.06 25.900000000000002 24.4 23.64 35-39 25.845000000000002 25.81 24.36 23.985 40-44 25.69 25.83 24.215 24.265 45-49 26.21 25.53 24.495 23.765 50-54 25.85 25.374999999999996 24.884999999999998 23.89 55-59 26.11 25.645 24.51 23.735 60-64 25.575 25.979999999999997 24.79 23.655 65-69 25.735000000000003 26.155 24.93 23.18 70-74 25.645 25.255 24.58 24.52 75-79 25.82 25.074999999999996 24.87 24.235 80-84 25.674999999999997 25.615 24.69 24.02 85-89 25.924999999999997 25.759999999999998 24.575 23.74 90-94 25.94 25.564999999999998 24.92 23.575 95-99 25.89 25.755 25.424999999999997 22.93 100-104 26.490000000000002 25.965 24.75 22.795 105-109 26.35 26.165 24.375 23.11 110-114 26.27 26.400000000000002 24.295 23.035 115-119 27.075 26.700000000000003 23.51 22.715 120-124 27.215 26.135 24.085 22.564999999999998 125-129 27.38 26.415 23.635 22.57 130-134 27.71 26.365 24.48 21.445 135-139 27.32 26.295 23.985 22.400000000000002 140-144 28.305000000000003 26.284999999999997 23.695 21.715 145-149 28.465 26.77 23.419999999999998 21.345 150-151 28.74843554443054 27.221526908635795 22.991239048811014 21.038798498122656 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 3.0 27 3.5 28 4.5 29 4.0 30 8.0 31 16.0 32 14.5 33 15.5 34 29.0 35 32.5 36 41.5 37 64.5 38 76.5 39 90.5 40 110.0 41 127.0 42 155.0 43 173.0 44 184.0 45 191.5 46 194.0 47 200.0 48 179.0 49 164.5 50 163.5 51 150.5 52 135.5 53 114.0 54 102.5 55 105.5 56 100.0 57 100.5 58 99.5 59 94.0 60 95.5 61 90.0 62 75.0 63 63.5 64 63.5 65 59.0 66 55.5 67 48.5 68 44.0 69 39.5 70 29.0 71 23.0 72 17.5 73 14.0 74 11.0 75 8.5 76 4.5 77 2.0 78 2.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.575 0.0 0.0 0.0 0.0 94-95 1.8125 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.7125 0.0 0.0 0.0 0.0 102-103 3.075 0.0 0.0 0.0 0.0 104-105 3.4375 0.0 0.0 0.0 0.0 106-107 3.9 0.0 0.0 0.0 0.0 108-109 4.4125 0.0 0.0 0.0 0.0 110-111 4.8375 0.0 0.0 0.0 0.0 112-113 5.3375 0.0 0.0 0.0 0.0 114-115 5.9125 0.0 0.0 0.0 0.0 116-117 6.525 0.0 0.0 0.0 0.0 118-119 7.025 0.0 0.0 0.0 0.0 120-121 7.6625 0.0 0.0 0.0 0.0 122-123 8.35 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.9125 0.0 0.0 0.0 0.0 128-129 10.825 0.0 0.0 0.0 0.0 130-131 11.875 0.0 0.0 0.0 0.0 132-133 12.6875 0.0 0.0 0.0 0.0 134-135 13.275 0.0 0.0 0.0 0.0 136-137 14.175 0.0 0.0 0.0 0.0 138-139 14.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACATC 10 0.006830828 145.0 2 >>END_MODULE Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978498 spots for SRR5578480.sra Written 978498 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra Read 978489 spots for SRR5578480.sra Written 978489 spots for SRR5578480.sra SRR ids: ['SRR5578480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i6kvet8l SRR5578480.sra spots: 19569789 blocks: [[1, 978489], [978490, 1956978], [1956979, 2935467], [2935468, 3913956], [3913957, 4892445], [4892446, 5870934], [5870935, 6849423], [6849424, 7827912], [7827913, 8806401], [8806402, 9784890], [9784891, 10763379], [10763380, 11741868], [11741869, 12720357], [12720358, 13698846], [13698847, 14677335], [14677336, 15655824], [15655825, 16634313], [16634314, 17612802], [17612803, 18591291], [18591292, 19569789]] SRR5578480 file size 6609858 SRR5578480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578480 SRR5578480_1.fastq SRR5578480_2.fastq Input file: SRR5578480_1.fastq Paired file: SRR5578480_2.fastq trimmed: SRR5578480-trimmed-pair1.fastq, SRR5578480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 19:56:12 2024 >> started Mon Dec 9 19:56:35 2024 >> done (23.576s) 19569789 read pairs processed; of these: 15701 ( 0.08%) short read pairs filtered out after trimming by size control 19862 ( 0.10%) empty read pairs filtered out after trimming by size control 19534226 (99.82%) read pairs available; of these: 10547821 (54.00%) trimmed read pairs available after processing 8986405 (46.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 20 0.00% 20 9 0.00% 21 11 0.00% 22 8 0.00% 23 16 0.00% 24 22 0.00% 25 29 0.00% 26 15 0.00% 27 21 0.00% 28 24 0.00% 29 22 0.00% 30 21 0.00% 31 31 0.00% 32 32 0.00% 33 31 0.00% 34 32 0.00% 35 34 0.00% 36 33 0.00% 37 37 0.00% 38 54 0.00% 39 71 0.00% 40 60 0.00% 41 79 0.00% 42 68 0.00% 43 93 0.00% 44 107 0.00% 45 109 0.00% 46 128 0.00% 47 128 0.00% 48 170 0.00% 49 211 0.00% 50 251 0.00% 51 279 0.00% 52 346 0.00% 53 330 0.00% 54 310 0.00% 55 453 0.00% 56 503 0.00% 57 593 0.00% 58 672 0.00% 59 807 0.00% 60 851 0.00% 61 1097 0.01% 62 1180 0.01% 63 1391 0.01% 64 1633 0.01% 65 1844 0.01% 66 2090 0.01% 67 2333 0.01% 68 2815 0.01% 69 3383 0.02% 70 4045 0.02% 71 4090 0.02% 72 4654 0.02% 73 5368 0.03% 74 5763 0.03% 75 6484 0.03% 76 7215 0.04% 77 8022 0.04% 78 8902 0.05% 79 10093 0.05% 80 11321 0.06% 81 12184 0.06% 82 13609 0.07% 83 15168 0.08% 84 17260 0.09% 85 18989 0.10% 86 19893 0.10% 87 21235 0.11% 88 22524 0.12% 89 24145 0.12% 90 25565 0.13% 91 27563 0.14% 92 29193 0.15% 93 31219 0.16% 94 32762 0.17% 95 34938 0.18% 96 36538 0.19% 97 38152 0.20% 98 39004 0.20% 99 40671 0.21% 100 43238 0.22% 101 44746 0.23% 102 46377 0.24% 103 49051 0.25% 104 50577 0.26% 105 51725 0.26% 106 54813 0.28% 107 55795 0.29% 108 57031 0.29% 109 59175 0.30% 110 59811 0.31% 111 61713 0.32% 112 63647 0.33% 113 65657 0.34% 114 68235 0.35% 115 70661 0.36% 116 71961 0.37% 117 73733 0.38% 118 74364 0.38% 119 75751 0.39% 120 77492 0.40% 121 79246 0.41% 122 81317 0.42% 123 83451 0.43% 124 85899 0.44% 125 87460 0.45% 126 89975 0.46% 127 91257 0.47% 128 93111 0.48% 129 94013 0.48% 130 95502 0.49% 131 97241 0.50% 132 99809 0.51% 133 102276 0.52% 134 105102 0.54% 135 108416 0.56% 136 110877 0.57% 137 113474 0.58% 138 116463 0.60% 139 121743 0.62% 140 125384 0.64% 141 132419 0.68% 142 141864 0.73% 143 151817 0.78% 144 167545 0.86% 145 190816 0.98% 146 225642 1.16% 147 289730 1.48% 148 419948 2.15% 149 828072 4.24% 150 4140933 21.20% 151 8986405 46.00% 19534226 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=13.79 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=2.8 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=23 prefix-density=0.63 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=49.11 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578480 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 19:57:25 Started mapping on | Dec 09 19:57:25 Finished on | Dec 09 20:00:22 Mapping speed, Million of reads per hour | 397.31 Number of input reads | 19534226 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 18387321 Uniquely mapped reads % | 94.13% Average mapped length | 287.22 Number of splices: Total | 19980444 Number of splices: Annotated (sjdb) | 18759322 Number of splices: GT/AG | 19716403 Number of splices: GC/AG | 239683 Number of splices: AT/AC | 10147 Number of splices: Non-canonical | 14211 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303978 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 37005 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 851796 851796 851796 N_multimapping 303978 303978 303978 N_noFeature 845677 17838515 1054059 N_ambiguous 408418 2928 68317 UnstrandedReadsAssigned:17133226 PositiveStrandReadsAssigned:545878 NegativeStrandReadsAssigned:17264945 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5578480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578480-trimmed-pair1.fastq SRR5578480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,534,226 reads, 17,422,813 reads pseudoaligned [quant] estimated average fragment length: 235.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR5578480.ke.tsv 35125 SRR5578480.se.tsv 88098 total ==> SRR5578480.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.714 0 0 PNS24247 1044 809.148 60.3924 6.37737 PNS24249 1928 1693.15 47.8402 2.41427 PNS24246 1044 809.148 60.3924 6.37737 PNS24248 1044 809.148 60.3924 6.37737 PNS24244 1471 1236.15 102.983 7.11838 PNS24243 293 111.956 0 0 KQK14069 1603 1368.15 3451.05 215.529 KQK14071 474 257.658 79.7882 26.4595 ==> SRR5578480.se.tsv <== BRADI_1g14170v3 3988 BRADI_1g53295v3 145 BRADI_1g59795v3 409 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 2277 BRADI_1g74790v3 154 BRADI_1g09890v3 2 BRADI_1g77505v3 280 BRADI_1g48960v3 0 SRR5578480 completed mapping pipeline successfully