Starting /dee2/code/volunteer_pipeline.sh SRR5578481 current disk space = 1521361231872 free memory = 1571706776 SRR5578481 SRAfilesize 6ea938d0f3a9ee095413624ced1302d3 SRR5578481.sra SRR5578481.sra file validated SRR5578481 is paired end SRR5578481 is conventional basespace SRR5578481 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.533 34.0 34.0 34.0 33.0 34.0 2 33.3815 34.0 34.0 34.0 33.0 34.0 3 33.51075 34.0 34.0 34.0 33.0 34.0 4 33.5745 34.0 34.0 34.0 33.0 34.0 5 33.619 34.0 34.0 34.0 33.0 34.0 6 37.3035 38.0 38.0 38.0 36.0 38.0 7 37.45525 38.0 38.0 38.0 37.0 38.0 8 37.55625 38.0 38.0 38.0 37.0 38.0 9 37.6485 38.0 38.0 38.0 38.0 38.0 10-14 37.664 38.0 38.0 38.0 38.0 38.0 15-19 37.66115 38.0 38.0 38.0 38.0 38.0 20-24 37.6569 38.0 38.0 38.0 38.0 38.0 25-29 37.6453 38.0 38.0 38.0 38.0 38.0 30-34 37.622 38.0 38.0 38.0 38.0 38.0 35-39 37.5912 38.0 38.0 38.0 38.0 38.0 40-44 37.5173 38.0 38.0 38.0 38.0 38.0 45-49 37.494899999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.499649999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.48535 38.0 38.0 38.0 38.0 38.0 60-64 37.409349999999996 38.0 38.0 38.0 37.6 38.0 65-69 37.351749999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.3429 38.0 38.0 38.0 37.0 38.0 75-79 37.2815 38.0 38.0 38.0 37.0 38.0 80-84 37.23875 38.0 38.0 38.0 36.8 38.0 85-89 37.170300000000005 38.0 38.0 38.0 36.2 38.0 90-94 37.112899999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.980000000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.877 38.0 38.0 38.0 35.2 38.0 105-109 36.74315 38.0 38.0 38.0 35.0 38.0 110-114 36.650200000000005 38.0 38.0 38.0 34.6 38.0 115-119 36.4013 38.0 38.0 38.0 34.0 38.0 120-124 36.36075 38.0 38.0 38.0 34.0 38.0 125-129 36.12624999999999 38.0 38.0 38.0 33.6 38.0 130-134 35.854850000000006 38.0 37.2 38.0 33.0 38.0 135-139 35.6505 38.0 36.0 38.0 31.6 38.0 140-144 35.1778 38.0 35.6 38.0 30.0 38.0 145-149 34.6201 38.0 35.0 38.0 27.6 38.0 150-151 30.755625000000002 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 3.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 3.0 20 3.0 21 3.0 22 2.0 23 7.0 24 3.0 25 10.0 26 7.0 27 15.0 28 13.0 29 21.0 30 31.0 31 22.0 32 51.0 33 71.0 34 102.0 35 161.0 36 520.0 37 2943.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.834971546818416 9.881013967925504 9.053285049146405 38.23072943610967 2 27.0 13.425 31.55 28.025 3 22.53063265816454 18.95473868467117 23.13078269567392 35.38384596149037 4 27.750000000000004 24.575 20.75 26.924999999999997 5 27.6 28.999999999999996 21.525 21.875 6 22.15 31.05 24.2 22.6 7 19.275000000000002 21.825 38.525 20.375 8 20.05 22.05 29.5 28.4 9 22.325 22.025 32.0 23.65 10-14 23.84 25.835 25.045 25.28 15-19 23.645 24.709999999999997 25.855 25.790000000000003 20-24 23.674999999999997 24.365000000000002 25.44 26.52 25-29 24.375 24.185000000000002 25.25 26.19 30-34 23.92119605980299 24.71123556177809 25.226261313065653 26.14130706535327 35-39 24.286214310715536 24.431221561078054 25.251262563128158 26.03130156507825 40-44 24.511225561278064 24.201210060503026 25.186259312965646 26.10130506525326 45-49 24.14 24.735 25.014999999999997 26.11 50-54 24.14 24.099999999999998 25.61 26.150000000000002 55-59 24.505 25.119999999999997 24.03 26.345000000000002 60-64 24.395 24.51 25.09 26.005 65-69 24.04 24.57 24.575 26.815 70-74 24.565 24.8 24.81 25.825 75-79 24.725 24.169999999999998 25.105 26.0 80-84 24.315 24.03 24.995 26.66 85-89 25.205 24.285 24.104999999999997 26.405 90-94 24.995 24.265 24.875 25.865 95-99 24.595 24.52 24.57 26.314999999999998 100-104 24.535 24.725 23.875 26.865 105-109 25.25 24.72 24.415 25.615 110-114 25.009999999999998 24.895 24.42 25.674999999999997 115-119 24.9 25.355 23.89 25.855 120-124 24.77871680752113 25.20378056708506 23.65854878231735 26.35895384307646 125-129 24.716065442537648 25.20138089758343 23.985590633912043 26.09696302596688 130-134 25.007502250675202 25.31259377813344 23.206962088626586 26.472941882564772 135-139 24.466223311165557 25.656282814140706 23.27116355817791 26.606330316515823 140-144 24.58 25.395 23.945 26.08 145-149 24.455 25.679999999999996 23.599999999999998 26.265 150-151 24.55591693770328 25.74430823117338 22.75456592444333 26.945208906680012 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 4.0 29 5.0 30 4.5 31 10.0 32 15.5 33 17.0 34 26.5 35 37.0 36 48.5 37 74.5 38 94.5 39 98.0 40 103.5 41 134.5 42 164.0 43 165.0 44 167.5 45 174.5 46 173.5 47 165.0 48 160.5 49 157.0 50 139.5 51 123.0 52 121.5 53 129.0 54 115.0 55 96.5 56 96.5 57 101.0 58 97.0 59 86.0 60 85.5 61 82.0 62 74.0 63 69.5 64 68.5 65 73.0 66 71.5 67 61.0 68 46.0 69 45.5 70 46.5 71 37.5 72 32.5 73 30.5 74 24.0 75 12.5 76 7.5 77 6.5 78 5.5 79 5.0 80 5.0 81 2.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.065 130-134 0.03 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8579359071410547 1.7000000000000002 3 0.0 0.0 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.175 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.675 0.0 0.0 0.0 0.0 94-95 1.9125 0.0 0.0 0.0 0.0 96-97 2.2874999999999996 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.1125 0.0 0.0 0.0 0.0 102-103 3.6375 0.0 0.0 0.0 0.0 104-105 4.125 0.0 0.0 0.0 0.0 106-107 4.65 0.0 0.0 0.0 0.0 108-109 5.4 0.0 0.0 0.0 0.0 110-111 6.2625 0.0 0.0 0.0 0.0 112-113 6.9875 0.0 0.0 0.0 0.0 114-115 7.575 0.0 0.0 0.0 0.0 116-117 8.2625 0.0 0.0 0.0 0.0 118-119 9.037500000000001 0.0 0.0 0.0 0.0 120-121 9.8875 0.0 0.0 0.0 0.0 122-123 10.850000000000001 0.0 0.0 0.0 0.0 124-125 12.149999999999999 0.0 0.0 0.0 0.0 126-127 12.962499999999999 0.0 0.0 0.0 0.0 128-129 14.1625 0.0 0.0 0.0 0.0 130-131 15.075 0.0 0.0 0.0 0.0 132-133 15.899999999999999 0.0 0.0 0.0 0.0 134-135 16.775 0.0 0.0 0.0 0.0 136-137 17.8 0.0 0.0 0.0 0.0 138-139 18.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCAT 10 0.0068343505 144.975 5 >>END_MODULE SRR5578481 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12075 33.0 33.0 34.0 32.0 34.0 2 33.217 34.0 33.0 34.0 33.0 34.0 3 33.192 34.0 33.0 34.0 33.0 34.0 4 33.16075 34.0 33.0 34.0 33.0 34.0 5 33.17 34.0 33.0 34.0 33.0 34.0 6 37.34275 38.0 38.0 38.0 37.0 38.0 7 37.41525 38.0 38.0 38.0 37.0 38.0 8 37.39025 38.0 38.0 38.0 37.0 38.0 9 37.43975 38.0 38.0 38.0 37.0 38.0 10-14 37.36555 38.0 38.0 38.0 37.4 38.0 15-19 37.34665 38.0 38.0 38.0 37.2 38.0 20-24 37.34105 38.0 38.0 38.0 38.0 38.0 25-29 37.32185 38.0 38.0 38.0 37.4 38.0 30-34 37.3349 38.0 38.0 38.0 37.4 38.0 35-39 37.301 38.0 38.0 38.0 37.0 38.0 40-44 37.27295 38.0 38.0 38.0 37.2 38.0 45-49 37.23875 38.0 38.0 38.0 37.0 38.0 50-54 37.18599999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.13125 38.0 38.0 38.0 37.0 38.0 60-64 37.076150000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.0271 38.0 38.0 38.0 36.2 38.0 70-74 36.940549999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.84325 38.0 38.0 38.0 36.0 38.0 80-84 36.802350000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.64704999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.63275 38.0 38.0 38.0 35.0 38.0 95-99 36.33695 38.0 38.0 38.0 34.2 38.0 100-104 36.117850000000004 38.0 38.0 38.0 33.8 38.0 105-109 35.8685 38.0 38.0 38.0 32.8 38.0 110-114 35.6366 38.0 37.8 38.0 32.4 38.0 115-119 35.4084 38.0 37.0 38.0 30.6 38.0 120-124 35.134499999999996 38.0 36.0 38.0 29.6 38.0 125-129 34.683749999999996 38.0 35.4 38.0 26.4 38.0 130-134 34.290949999999995 38.0 34.4 38.0 25.6 38.0 135-139 33.6465 38.0 33.0 38.0 22.2 38.0 140-144 32.64979999999999 38.0 32.4 38.0 13.8 38.0 145-149 30.9067 38.0 30.6 38.0 4.2 38.0 150-151 25.51125 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 2.0 12 5.0 13 0.0 14 3.0 15 9.0 16 3.0 17 4.0 18 12.0 19 7.0 20 8.0 21 13.0 22 5.0 23 16.0 24 16.0 25 12.0 26 22.0 27 33.0 28 32.0 29 30.0 30 40.0 31 45.0 32 73.0 33 127.0 34 161.0 35 282.0 36 716.0 37 2316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.574999999999996 16.3 12.5 32.625 2 31.15 22.825 25.474999999999998 20.549999999999997 3 25.1 25.15 24.9 24.85 4 27.05 30.25 18.2 24.5 5 27.85 32.75 18.975 20.424999999999997 6 22.900000000000002 35.325 19.975 21.8 7 22.975 18.125 33.675 25.224999999999998 8 23.974999999999998 22.400000000000002 23.625 30.0 9 24.825 21.75 26.474999999999998 26.950000000000003 10-14 26.640000000000004 25.22 22.055 26.085 15-19 25.924999999999997 24.94 24.2 24.935 20-24 25.885 25.240000000000002 23.255 25.619999999999997 25-29 26.669999999999998 24.8 22.845 25.685000000000002 30-34 26.63 24.445 23.755000000000003 25.169999999999998 35-39 25.965 24.755 23.715 25.564999999999998 40-44 26.435 24.735 23.380000000000003 25.45 45-49 25.985000000000003 25.025 23.77 25.22 50-54 26.355 24.310000000000002 23.87 25.465 55-59 26.61 24.38 23.87 25.14 60-64 26.205000000000002 24.54 24.055 25.2 65-69 26.284999999999997 24.795 23.77 25.15 70-74 26.650000000000002 24.060000000000002 23.544999999999998 25.745 75-79 25.88 24.415 24.665 25.040000000000003 80-84 26.450000000000003 24.09 24.04 25.419999999999998 85-89 25.88 24.555 24.05 25.515 90-94 26.875 25.245 23.23 24.65 95-99 27.334999999999997 24.805 23.645 24.215 100-104 27.51 24.709999999999997 23.125 24.654999999999998 105-109 27.275 24.675 23.73 24.32 110-114 27.66 25.03 23.5 23.810000000000002 115-119 28.065 25.564999999999998 22.73 23.64 120-124 28.33 25.535000000000004 22.965 23.169999999999998 125-129 28.62 25.055 23.28 23.044999999999998 130-134 29.39 25.56 22.525000000000002 22.525000000000002 135-139 28.945 25.990000000000002 22.470000000000002 22.595000000000002 140-144 28.89 25.540000000000003 23.26 22.31 145-149 28.99 25.735000000000003 23.419999999999998 21.855 150-151 30.225 26.55 21.525 21.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 3.5 28 4.0 29 4.5 30 4.0 31 6.0 32 10.5 33 14.0 34 19.5 35 30.5 36 42.5 37 57.0 38 79.0 39 89.5 40 120.0 41 141.0 42 133.0 43 137.0 44 153.5 45 163.0 46 146.5 47 152.0 48 160.0 49 153.5 50 145.0 51 129.5 52 130.0 53 119.0 54 105.0 55 99.5 56 95.5 57 99.0 58 93.5 59 93.0 60 98.5 61 89.0 62 91.0 63 92.5 64 81.0 65 78.0 66 79.5 67 72.5 68 58.0 69 53.5 70 54.0 71 53.5 72 48.5 73 34.5 74 23.0 75 17.0 76 11.5 77 9.5 78 6.5 79 4.5 80 3.0 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96307536671725 97.82499999999999 2 0.9357612544258977 1.8499999999999999 3 0.07587253414264036 0.22499999999999998 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 90-91 1.425 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 1.925 0.0 0.0 0.0 0.0 96-97 2.2874999999999996 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 3.1 0.0 0.0 0.0 0.0 102-103 3.6624999999999996 0.0 0.0 0.0 0.0 104-105 4.2125 0.0 0.0 0.0 0.0 106-107 4.75 0.0 0.0 0.0 0.0 108-109 5.550000000000001 0.0 0.0 0.0 0.0 110-111 6.4 0.0 0.0 0.0 0.0 112-113 7.1125 0.0 0.0 0.0 0.0 114-115 7.7 0.0 0.0 0.0 0.0 116-117 8.4 0.0 0.0 0.0 0.0 118-119 9.175 0.0 0.0 0.0 0.0 120-121 10.0125 0.0 0.0 0.0 0.0 122-123 10.9375 0.0 0.0 0.0 0.0 124-125 12.2125 0.0 0.0 0.0 0.0 126-127 13.037500000000001 0.0 0.0 0.0 0.0 128-129 14.225 0.0 0.0 0.0 0.0 130-131 15.125 0.0 0.0 0.0 0.0 132-133 15.925 0.0 0.0 0.0 0.0 134-135 16.775 0.0 0.0 0.0 0.0 136-137 17.8 0.0 0.0 0.0 0.0 138-139 18.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCTC 10 0.006830828 145.0 5 >>END_MODULE Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024319 spots for SRR5578481.sra Written 1024319 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra Read 1024311 spots for SRR5578481.sra Written 1024311 spots for SRR5578481.sra SRR ids: ['SRR5578481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9el8jy_4 SRR5578481.sra spots: 20486228 blocks: [[1, 1024311], [1024312, 2048622], [2048623, 3072933], [3072934, 4097244], [4097245, 5121555], [5121556, 6145866], [6145867, 7170177], [7170178, 8194488], [8194489, 9218799], [9218800, 10243110], [10243111, 11267421], [11267422, 12291732], [12291733, 13316043], [13316044, 14340354], [14340355, 15364665], [15364666, 16388976], [16388977, 17413287], [17413288, 18437598], [18437599, 19461909], [19461910, 20486228]] SRR5578481 file size 6920410 SRR5578481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578481 SRR5578481_1.fastq SRR5578481_2.fastq Input file: SRR5578481_1.fastq Paired file: SRR5578481_2.fastq trimmed: SRR5578481-trimmed-pair1.fastq, SRR5578481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:16:26 2024 >> started Mon Dec 9 20:16:50 2024 >> done (24.664s) 20486228 read pairs processed; of these: 16820 ( 0.08%) short read pairs filtered out after trimming by size control 19428 ( 0.09%) empty read pairs filtered out after trimming by size control 20449980 (99.82%) read pairs available; of these: 11428296 (55.88%) trimmed read pairs available after processing 9021684 (44.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 20 0.00% 20 13 0.00% 21 12 0.00% 22 19 0.00% 23 23 0.00% 24 29 0.00% 25 26 0.00% 26 16 0.00% 27 22 0.00% 28 25 0.00% 29 38 0.00% 30 39 0.00% 31 35 0.00% 32 43 0.00% 33 36 0.00% 34 62 0.00% 35 46 0.00% 36 44 0.00% 37 68 0.00% 38 66 0.00% 39 98 0.00% 40 105 0.00% 41 92 0.00% 42 124 0.00% 43 131 0.00% 44 157 0.00% 45 134 0.00% 46 171 0.00% 47 244 0.00% 48 222 0.00% 49 270 0.00% 50 334 0.00% 51 349 0.00% 52 403 0.00% 53 419 0.00% 54 506 0.00% 55 545 0.00% 56 651 0.00% 57 740 0.00% 58 815 0.00% 59 1000 0.00% 60 1079 0.01% 61 1332 0.01% 62 1444 0.01% 63 1636 0.01% 64 1867 0.01% 65 2000 0.01% 66 2310 0.01% 67 2666 0.01% 68 3185 0.02% 69 4835 0.02% 70 6065 0.03% 71 5203 0.03% 72 5528 0.03% 73 6009 0.03% 74 6477 0.03% 75 7436 0.04% 76 8292 0.04% 77 9180 0.04% 78 10257 0.05% 79 11601 0.06% 80 12751 0.06% 81 14314 0.07% 82 16061 0.08% 83 17435 0.09% 84 20112 0.10% 85 22252 0.11% 86 23770 0.12% 87 25521 0.12% 88 27659 0.14% 89 29021 0.14% 90 31215 0.15% 91 34535 0.17% 92 36654 0.18% 93 39132 0.19% 94 41674 0.20% 95 43903 0.21% 96 45791 0.22% 97 47913 0.23% 98 50278 0.25% 99 52353 0.26% 100 55285 0.27% 101 57155 0.28% 102 59846 0.29% 103 62817 0.31% 104 65112 0.32% 105 67012 0.33% 106 70382 0.34% 107 71266 0.35% 108 73145 0.36% 109 75510 0.37% 110 76842 0.38% 111 79086 0.39% 112 81802 0.40% 113 84217 0.41% 114 87341 0.43% 115 90239 0.44% 116 91189 0.45% 117 92699 0.45% 118 93136 0.46% 119 94699 0.46% 120 96615 0.47% 121 97880 0.48% 122 99988 0.49% 123 101358 0.50% 124 104609 0.51% 125 106255 0.52% 126 108397 0.53% 127 109868 0.54% 128 109927 0.54% 129 112470 0.55% 130 112754 0.55% 131 114344 0.56% 132 117400 0.57% 133 119384 0.58% 134 120921 0.59% 135 124274 0.61% 136 126107 0.62% 137 128195 0.63% 138 130667 0.64% 139 135144 0.66% 140 139861 0.68% 141 145859 0.71% 142 154341 0.75% 143 162936 0.80% 144 176579 0.86% 145 197395 0.97% 146 231221 1.13% 147 291629 1.43% 148 412423 2.02% 149 804505 3.93% 150 4167252 20.38% 151 9021684 44.12% 20449980 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=13 prefix-density=0.89 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=22.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=13 prefix-density=0.63 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=49.43 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578481 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:17:38 Started mapping on | Dec 09 20:17:38 Finished on | Dec 09 20:20:47 Mapping speed, Million of reads per hour | 389.52 Number of input reads | 20449980 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 18998649 Uniquely mapped reads % | 92.90% Average mapped length | 284.94 Number of splices: Total | 18755339 Number of splices: Annotated (sjdb) | 17717873 Number of splices: GT/AG | 18514571 Number of splices: GC/AG | 217421 Number of splices: AT/AC | 9256 Number of splices: Non-canonical | 14091 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309174 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 61430 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 1.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1153285 1153285 1153285 N_multimapping 309174 309174 309174 N_noFeature 683108 18444320 879953 N_ambiguous 420231 2120 63772 UnstrandedReadsAssigned:17895310 PositiveStrandReadsAssigned:552209 NegativeStrandReadsAssigned:18054924 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR5578481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578481-trimmed-pair1.fastq SRR5578481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,449,980 reads, 18,149,197 reads pseudoaligned [quant] estimated average fragment length: 221.025 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR5578481.ke.tsv 35125 SRR5578481.se.tsv 88098 total ==> SRR5578481.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.469 0 0 PNS24247 1044 823.975 29.5039 2.80117 PNS24249 1928 1707.97 115.593 5.29453 PNS24246 1044 823.975 29.5039 2.80117 PNS24248 1044 823.975 29.5039 2.80117 PNS24244 1471 1250.97 47.895 2.99513 PNS24243 293 117.214 1 0.667416 KQK14069 1603 1382.97 116.184 6.57215 KQK14071 474 267.946 2.38285 0.695705 ==> SRR5578481.se.tsv <== BRADI_1g14170v3 146 BRADI_1g53295v3 135 BRADI_1g59795v3 341 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 1820 BRADI_1g74790v3 132 BRADI_1g09890v3 3 BRADI_1g77505v3 248 BRADI_1g48960v3 0 SRR5578481 completed mapping pipeline successfully