Starting /dee2/code/volunteer_pipeline.sh SRR5578484 current disk space = 1521137459200 free memory = 1574541184 SRR5578484 SRAfilesize fc14dea6419965c9c9170527518a26e1 SRR5578484.sra SRR5578484.sra file validated SRR5578484 is paired end SRR5578484 is conventional basespace SRR5578484 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.45025 34.0 33.0 34.0 33.0 34.0 2 33.379 34.0 34.0 34.0 33.0 34.0 3 33.4915 34.0 34.0 34.0 33.0 34.0 4 33.49525 34.0 34.0 34.0 33.0 34.0 5 33.4355 34.0 34.0 34.0 33.0 34.0 6 37.24225 38.0 38.0 38.0 36.0 38.0 7 37.4315 38.0 38.0 38.0 37.0 38.0 8 37.54175 38.0 38.0 38.0 37.0 38.0 9 37.5335 38.0 38.0 38.0 37.0 38.0 10-14 37.5724 38.0 38.0 38.0 38.0 38.0 15-19 37.56975 38.0 38.0 38.0 38.0 38.0 20-24 37.58115 38.0 38.0 38.0 38.0 38.0 25-29 37.53789999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.509750000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.48620000000001 38.0 38.0 38.0 37.8 38.0 40-44 37.416450000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.4268 38.0 38.0 38.0 37.2 38.0 50-54 37.400150000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.3481 38.0 38.0 38.0 37.0 38.0 60-64 37.342499999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.290949999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.237049999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.2059 38.0 38.0 38.0 36.6 38.0 80-84 37.14655 38.0 38.0 38.0 36.2 38.0 85-89 37.07185 38.0 38.0 38.0 36.0 38.0 90-94 36.99515 38.0 38.0 38.0 35.8 38.0 95-99 36.9928 38.0 38.0 38.0 35.8 38.0 100-104 36.84845 38.0 38.0 38.0 35.2 38.0 105-109 36.7738 38.0 38.0 38.0 35.0 38.0 110-114 36.70225 38.0 38.0 38.0 35.0 38.0 115-119 36.61905 38.0 38.0 38.0 34.8 38.0 120-124 36.461650000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.31 38.0 38.0 38.0 34.0 38.0 130-134 36.13415 38.0 38.0 38.0 33.8 38.0 135-139 35.820299999999996 38.0 38.0 38.0 32.8 38.0 140-144 35.6288 38.0 37.4 38.0 32.2 38.0 145-149 35.1404 38.0 36.0 38.0 30.6 38.0 150-151 32.113749999999996 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 1.0 18 5.0 19 2.0 20 4.0 21 5.0 22 4.0 23 6.0 24 7.0 25 15.0 26 5.0 27 13.0 28 19.0 29 20.0 30 25.0 31 32.0 32 46.0 33 68.0 34 95.0 35 162.0 36 406.0 37 3053.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.1 10.325 10.174999999999999 34.4 2 25.732899022801302 13.254823352543221 32.12227511901779 28.890002505637685 3 23.425 18.175 22.625 35.775 4 26.825 26.650000000000002 21.925 24.6 5 25.674999999999997 30.8 21.9 21.625 6 21.825 31.924999999999997 23.825 22.425 7 18.0 21.625 40.675 19.7 8 20.625 22.175 29.675 27.525 9 19.475 21.275 33.2 26.05 10-14 23.04 26.305 25.47 25.185000000000002 15-19 23.405 25.080000000000002 25.71 25.805 20-24 23.77 25.314999999999998 25.385 25.53 25-29 23.905 25.474999999999998 25.585 25.035 30-34 23.365 25.240000000000002 26.05 25.345000000000002 35-39 22.900000000000002 25.69 25.319999999999997 26.090000000000003 40-44 23.330000000000002 25.385 25.564999999999998 25.72 45-49 23.53617680884044 25.251262563128158 25.44627231361568 25.766288314415718 50-54 24.349999999999998 25.205 24.52 25.924999999999997 55-59 23.876193809690484 24.706235311765585 24.996249812490625 26.421321066053306 60-64 24.0 25.035 25.14 25.825 65-69 23.83953581432573 25.220088035214083 25.165066026410564 25.77531012404962 70-74 23.486174308715434 25.6112805640282 25.136256812840642 25.766288314415718 75-79 24.29 24.83 25.319999999999997 25.56 80-84 23.87 24.81 25.15 26.169999999999998 85-89 23.81357203580537 25.09376406460969 25.41381207181077 25.678851827774167 90-94 23.799999999999997 25.19 25.45 25.56 95-99 24.060000000000002 25.929999999999996 24.355 25.655 100-104 24.47 25.165 24.925 25.44 105-109 23.974999999999998 24.759999999999998 24.79 26.474999999999998 110-114 24.07 24.79 25.4 25.740000000000002 115-119 24.490000000000002 24.985 24.535 25.990000000000002 120-124 24.08 25.135 24.785 26.0 125-129 23.905 25.074999999999996 24.93 26.090000000000003 130-134 24.425 25.495 24.560000000000002 25.52 135-139 24.404999999999998 26.025 24.185000000000002 25.385 140-144 24.95 25.095 24.075 25.88 145-149 24.095 25.34 24.555 26.009999999999998 150-151 24.15 25.825 23.849999999999998 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 3.5 30 6.5 31 9.5 32 16.0 33 23.5 34 30.0 35 46.0 36 58.5 37 69.0 38 87.0 39 98.0 40 123.0 41 158.0 42 170.0 43 173.5 44 187.5 45 203.0 46 193.0 47 197.5 48 189.5 49 171.0 50 153.0 51 124.5 52 130.5 53 116.5 54 92.0 55 79.0 56 80.5 57 92.5 58 85.0 59 82.0 60 81.0 61 65.0 62 55.5 63 57.0 64 61.5 65 60.0 66 59.0 67 53.5 68 43.0 69 43.5 70 43.0 71 32.5 72 23.0 73 21.0 74 17.5 75 11.5 76 9.0 77 5.5 78 2.0 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.04 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01465386558868 97.975 2 0.9348155634158665 1.8499999999999999 3 0.025265285497726126 0.075 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.4500000000000002 0.0 0.0 0.0 0.0 96-97 1.725 0.0 0.0 0.0 0.0 98-99 1.95 0.0 0.0 0.0 0.0 100-101 2.1500000000000004 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 4.8625 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 5.85 0.0 0.0 0.0 0.0 118-119 6.2375 0.0 0.0 0.0 0.0 120-121 6.7125 0.0 0.0 0.0 0.0 122-123 7.3875 0.0 0.0 0.0 0.0 124-125 8.075 0.0 0.0 0.0 0.0 126-127 8.575 0.0 0.0 0.0 0.0 128-129 9.2625 0.0 0.0 0.0 0.0 130-131 10.125 0.0 0.0 0.0 0.0 132-133 10.9875 0.0 0.0 0.0 0.0 134-135 11.525 0.0 0.0 0.0 0.0 136-137 12.4375 0.0 0.0 0.0 0.0 138-139 13.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAC 10 0.006830828 145.0 3 CAACTTC 10 0.006830828 145.0 3 >>END_MODULE SRR5578484 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2315 33.0 33.0 34.0 31.0 34.0 2 32.3955 33.0 33.0 34.0 31.0 34.0 3 32.278 33.0 33.0 34.0 31.0 34.0 4 32.3395 33.0 33.0 34.0 31.0 34.0 5 32.2645 33.0 33.0 34.0 31.0 34.0 6 36.389 38.0 38.0 38.0 34.0 38.0 7 36.344 38.0 38.0 38.0 34.0 38.0 8 36.34775 38.0 38.0 38.0 34.0 38.0 9 36.30175 38.0 38.0 38.0 34.0 38.0 10-14 36.290000000000006 38.0 38.0 38.0 34.0 38.0 15-19 36.17665 38.0 38.0 38.0 33.6 38.0 20-24 36.044549999999994 38.0 38.0 38.0 33.0 38.0 25-29 35.95545 38.0 37.8 38.0 32.8 38.0 30-34 35.737700000000004 38.0 37.2 38.0 31.6 38.0 35-39 35.55935 38.0 37.0 38.0 30.0 38.0 40-44 35.47435 38.0 37.0 38.0 29.0 38.0 45-49 35.241249999999994 38.0 36.6 38.0 28.6 38.0 50-54 34.958749999999995 38.0 36.0 38.0 27.8 38.0 55-59 34.6926 38.0 36.0 38.0 27.0 38.0 60-64 34.45545 38.0 35.0 38.0 25.4 38.0 65-69 34.1589 38.0 35.0 38.0 23.0 38.0 70-74 33.85095 38.0 34.2 38.0 17.6 38.0 75-79 33.4077 38.0 34.0 38.0 16.0 38.0 80-84 32.81675 37.8 33.0 38.0 15.4 38.0 85-89 32.3152 37.2 31.6 38.0 15.0 38.0 90-94 31.672299999999996 37.0 29.8 38.0 15.0 38.0 95-99 31.0058 36.4 28.4 38.0 14.2 38.0 100-104 30.429000000000002 36.0 26.8 38.0 13.4 38.0 105-109 29.6582 35.0 24.2 38.0 13.0 38.0 110-114 28.80915 34.8 22.2 38.0 8.6 38.0 115-119 27.593399999999995 34.0 16.2 38.0 2.0 38.0 120-124 26.708999999999996 34.0 14.8 38.0 2.0 38.0 125-129 25.1056 32.6 13.6 37.8 2.0 38.0 130-134 23.464249999999996 29.4 13.0 36.2 2.0 38.0 135-139 21.935900000000004 25.6 2.0 35.4 2.0 38.0 140-144 20.37405 23.0 2.0 35.0 2.0 38.0 145-149 17.692050000000002 12.6 2.0 33.6 2.0 38.0 150-151 13.021125 2.0 2.0 30.5 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 7.0 4 4.0 5 12.0 6 1.0 7 4.0 8 9.0 9 6.0 10 10.0 11 11.0 12 9.0 13 11.0 14 11.0 15 30.0 16 25.0 17 28.0 18 49.0 19 36.0 20 39.0 21 50.0 22 50.0 23 52.0 24 61.0 25 97.0 26 123.0 27 125.0 28 146.0 29 173.0 30 205.0 31 239.0 32 291.0 33 364.0 34 434.0 35 519.0 36 531.0 37 213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.01701701701702 17.96796796796797 12.087087087087086 27.927927927927925 2 29.719579369053577 23.360040060090135 25.78868302453681 21.13169754631948 3 24.749247743229688 25.47642928786359 25.92778335005015 23.846539618856568 4 26.880641925777333 31.64493480441324 19.157472417251757 22.316950852557675 5 27.65104036099273 34.06868889445976 18.62622211080471 19.654048633742793 6 24.356089022255563 33.633408352088026 20.155038759689923 21.85546386596649 7 22.516887665749312 19.16437327995997 33.72529397047786 24.59344508381286 8 23.258145363408524 24.93734335839599 23.182957393483708 28.62155388471178 9 23.741547708489858 22.238918106686704 27.548209366391184 26.471324818432258 10-14 25.94800380704303 25.632419976957372 22.977508390522466 25.44206782547713 15-19 25.112691575678653 25.949113492937993 23.93569067414605 25.0025042572373 20-24 25.842134240953 25.912207818209122 23.82001101156214 24.42564692927574 25-29 25.142571285642823 25.61780890445223 24.00200100050025 25.237618809404704 30-34 25.47004261719729 25.32464276761093 24.492353973426926 24.71296064176485 35-39 24.875821584466408 25.74883347549044 24.53966183332497 24.83568310671818 40-44 26.289692477211258 25.603525994190125 23.895622558349196 24.211158970249425 45-49 25.65670743934229 25.080208542209746 24.684178865049127 24.578905153398836 50-54 26.314998497144575 24.907323915439335 24.336238853822262 24.441438733593827 55-59 25.92147435897436 25.150240384615387 24.489182692307693 24.439102564102562 60-64 25.53084935897436 25.28545673076923 24.23377403846154 24.949919871794872 65-69 26.434939396974855 24.91735951116899 24.28127817289392 24.366422918962236 70-74 25.78997446041364 25.479493214482446 23.942110270919926 24.788422054183982 75-79 25.475056405114067 24.883429430935074 24.41213336675859 25.22938079719228 80-84 26.755769134504682 25.389197577213796 24.047654803023477 23.807378485258045 85-89 26.048233763634542 25.292704893425398 24.322025417792457 24.337035925147603 90-94 26.20693108974359 25.015024038461537 24.39403044871795 24.384014423076923 95-99 26.482371794871796 25.570913461538463 23.83313301282051 24.113581730769234 100-104 26.650660264105642 25.945378151260506 23.664465786314526 23.739495798319325 105-109 26.45261470647165 25.74133440192346 24.05329593267882 23.75275495892607 110-114 27.337372928038462 25.659772647603784 23.23100806249687 23.771846361860884 115-119 26.855512737100245 26.09479005054802 23.25709423952755 23.792602972824184 120-124 27.088962273591516 25.878114680276195 23.541479035324727 23.491444010807566 125-129 27.498873817508386 26.262575704489716 22.63376545372641 23.60478502427549 130-134 26.89824315531308 26.828169578056958 22.663796986836175 23.60979027979378 135-139 27.452353559101596 26.827072182482116 22.74523535591016 22.975338902506127 140-144 28.234882208773072 27.00945330865803 22.147751713099584 22.607912769469316 145-149 27.855571114222844 27.470494098819763 21.904380876175235 22.769553910782157 150-151 28.441055131891485 28.6160770096262 21.09013626703338 21.852731591448933 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 3.5 25 1.5 26 4.0 27 6.5 28 4.5 29 5.5 30 7.0 31 5.0 32 9.5 33 18.5 34 26.0 35 39.0 36 55.0 37 60.5 38 66.5 39 100.5 40 130.5 41 145.0 42 155.0 43 154.0 44 156.5 45 173.5 46 172.5 47 156.5 48 159.0 49 174.5 50 170.0 51 157.0 52 138.5 53 103.0 54 94.5 55 96.0 56 89.5 57 91.5 58 87.0 59 79.5 60 83.0 61 84.5 62 84.5 63 76.5 64 74.0 65 77.5 66 67.0 67 53.5 68 52.0 69 52.0 70 47.0 71 36.5 72 29.5 73 26.0 74 18.5 75 13.5 76 8.0 77 5.5 78 2.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.15 3 0.3 4 0.3 5 0.27499999999999997 6 0.025 7 0.075 8 0.25 9 0.17500000000000002 10-14 0.185 15-19 0.16999999999999998 20-24 0.105 25-29 0.05 30-34 0.27499999999999997 35-39 0.345 40-44 0.16999999999999998 45-49 0.26 50-54 0.19 55-59 0.16 60-64 0.16 65-69 0.16999999999999998 70-74 0.155 75-79 0.27499999999999997 80-84 0.11499999999999999 85-89 0.06999999999999999 90-94 0.16 95-99 0.16 100-104 0.04 105-109 0.18 110-114 0.155 115-119 0.095 120-124 0.06999999999999999 125-129 0.105 130-134 0.105 135-139 0.045 140-144 0.034999999999999996 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90973630831643 97.52499999999999 2 0.8874239350912779 1.7500000000000002 3 0.15212981744421905 0.44999999999999996 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02535496957403651 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.2125000000000004 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9749999999999996 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.15 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.6875 0.0 0.0 0.0 0.0 122-123 4.95 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.449999999999999 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.325 0.0 0.0 0.0 0.0 136-137 7.8 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTCT 10 0.006843168 144.91249 9 CTCAGCA 10 0.006843168 144.91249 9 >>END_MODULE Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075818 spots for SRR5578484.sra Written 1075818 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra Read 1075812 spots for SRR5578484.sra Written 1075812 spots for SRR5578484.sra SRR ids: ['SRR5578484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8u9_i0s9 SRR5578484.sra spots: 21516246 blocks: [[1, 1075812], [1075813, 2151624], [2151625, 3227436], [3227437, 4303248], [4303249, 5379060], [5379061, 6454872], [6454873, 7530684], [7530685, 8606496], [8606497, 9682308], [9682309, 10758120], [10758121, 11833932], [11833933, 12909744], [12909745, 13985556], [13985557, 15061368], [15061369, 16137180], [16137181, 17212992], [17212993, 18288804], [18288805, 19364616], [19364617, 20440428], [20440429, 21516246]] SRR5578484 file size 7269449 SRR5578484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578484 SRR5578484_1.fastq SRR5578484_2.fastq Input file: SRR5578484_1.fastq Paired file: SRR5578484_2.fastq trimmed: SRR5578484-trimmed-pair1.fastq, SRR5578484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:27:05 2024 >> started Mon Dec 9 20:27:30 2024 >> done (24.501s) 21516246 read pairs processed; of these: 60788 ( 0.28%) short read pairs filtered out after trimming by size control 67023 ( 0.31%) empty read pairs filtered out after trimming by size control 21388435 (99.41%) read pairs available; of these: 12071005 (56.44%) trimmed read pairs available after processing 9317430 (43.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 13 0.00% 20 10 0.00% 21 14 0.00% 22 14 0.00% 23 12 0.00% 24 14 0.00% 25 11 0.00% 26 23 0.00% 27 14 0.00% 28 27 0.00% 29 31 0.00% 30 31 0.00% 31 16 0.00% 32 32 0.00% 33 30 0.00% 34 45 0.00% 35 50 0.00% 36 36 0.00% 37 51 0.00% 38 49 0.00% 39 83 0.00% 40 59 0.00% 41 67 0.00% 42 97 0.00% 43 86 0.00% 44 98 0.00% 45 116 0.00% 46 122 0.00% 47 140 0.00% 48 180 0.00% 49 188 0.00% 50 270 0.00% 51 249 0.00% 52 287 0.00% 53 303 0.00% 54 375 0.00% 55 379 0.00% 56 451 0.00% 57 509 0.00% 58 612 0.00% 59 643 0.00% 60 763 0.00% 61 866 0.00% 62 1030 0.00% 63 1118 0.01% 64 1273 0.01% 65 1396 0.01% 66 1678 0.01% 67 1922 0.01% 68 2209 0.01% 69 2887 0.01% 70 4264 0.02% 71 3881 0.02% 72 3831 0.02% 73 4194 0.02% 74 4731 0.02% 75 5132 0.02% 76 5602 0.03% 77 6120 0.03% 78 6961 0.03% 79 8172 0.04% 80 8693 0.04% 81 10029 0.05% 82 11434 0.05% 83 12779 0.06% 84 15524 0.07% 85 17371 0.08% 86 18488 0.09% 87 19536 0.09% 88 20654 0.10% 89 22251 0.10% 90 23854 0.11% 91 24880 0.12% 92 26555 0.12% 93 28464 0.13% 94 30586 0.14% 95 31795 0.15% 96 33357 0.16% 97 35277 0.16% 98 36624 0.17% 99 38648 0.18% 100 41214 0.19% 101 43045 0.20% 102 45143 0.21% 103 47706 0.22% 104 50216 0.23% 105 51348 0.24% 106 54064 0.25% 107 55920 0.26% 108 58292 0.27% 109 60313 0.28% 110 62981 0.29% 111 65283 0.31% 112 68986 0.32% 113 71454 0.33% 114 73985 0.35% 115 76939 0.36% 116 79214 0.37% 117 81912 0.38% 118 84382 0.39% 119 86319 0.40% 120 89518 0.42% 121 92814 0.43% 122 94992 0.44% 123 99140 0.46% 124 103367 0.48% 125 106598 0.50% 126 109324 0.51% 127 112751 0.53% 128 116038 0.54% 129 119132 0.56% 130 122601 0.57% 131 127017 0.59% 132 133238 0.62% 133 135525 0.63% 134 140589 0.66% 135 145963 0.68% 136 151425 0.71% 137 158618 0.74% 138 165113 0.77% 139 175764 0.82% 140 183973 0.86% 141 196249 0.92% 142 212378 0.99% 143 230778 1.08% 144 254659 1.19% 145 292817 1.37% 146 351085 1.64% 147 450778 2.11% 148 622698 2.91% 149 1050608 4.91% 150 3926060 18.36% 151 9317430 43.56% 21388435 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=21 prefix-density=0.50 prefix-fanout=3.2 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=22.86 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=1.8 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=13 fanout-score=53.15 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=11.4 sequence=GCCGCCGCCGCC SRR5578484 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:28:21 Started mapping on | Dec 09 20:28:21 Finished on | Dec 09 20:31:35 Mapping speed, Million of reads per hour | 396.90 Number of input reads | 21388435 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 20329588 Uniquely mapped reads % | 95.05% Average mapped length | 287.04 Number of splices: Total | 20992278 Number of splices: Annotated (sjdb) | 19767952 Number of splices: GT/AG | 20717978 Number of splices: GC/AG | 252002 Number of splices: AT/AC | 7420 Number of splices: Non-canonical | 14878 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201415 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 14932 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 890097 890097 890097 N_multimapping 201415 201415 201415 N_noFeature 721509 19669262 951943 N_ambiguous 518912 2880 90808 UnstrandedReadsAssigned:19089167 PositiveStrandReadsAssigned:657446 NegativeStrandReadsAssigned:19286837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5578484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578484-trimmed-pair1.fastq SRR5578484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,388,435 reads, 19,326,714 reads pseudoaligned [quant] estimated average fragment length: 238.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR5578484.ke.tsv 35125 SRR5578484.se.tsv 88098 total ==> SRR5578484.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.515 0 0 PNS24247 1044 806.045 58.7354 5.37802 PNS24249 1928 1690.05 107.195 4.6812 PNS24246 1044 806.045 58.7354 5.37802 PNS24248 1044 806.045 58.7354 5.37802 PNS24244 1471 1233.05 15.5988 0.933673 PNS24243 293 107.141 0 0 KQK14069 1603 1365.05 5442.84 294.28 KQK14071 474 252.843 182.942 53.4003 ==> SRR5578484.se.tsv <== BRADI_1g14170v3 6550 BRADI_1g53295v3 132 BRADI_1g59795v3 405 BRADI_1g07683v3 1 BRADI_1g00485v3 3 BRADI_1g20270v3 172 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 262 BRADI_1g48960v3 0 SRR5578484 completed mapping pipeline successfully