Starting /dee2/code/volunteer_pipeline.sh SRR5578485 current disk space = 1521135579136 free memory = 1571990972 SRR5578485 SRAfilesize a337049f0cdece1a49470f97a7a480d3 SRR5578485.sra SRR5578485.sra file validated SRR5578485 is paired end SRR5578485 is conventional basespace SRR5578485 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70175 34.0 33.0 34.0 32.0 34.0 2 33.13825 34.0 33.0 34.0 32.0 34.0 3 33.299 34.0 33.0 34.0 32.0 34.0 4 33.44675 34.0 33.0 34.0 33.0 34.0 5 33.454 34.0 34.0 34.0 33.0 34.0 6 37.004 38.0 37.0 38.0 35.0 38.0 7 37.3265 38.0 38.0 38.0 37.0 38.0 8 37.514 38.0 38.0 38.0 37.0 38.0 9 37.578 38.0 38.0 38.0 38.0 38.0 10-14 37.5295 38.0 38.0 38.0 38.0 38.0 15-19 37.5102 38.0 38.0 38.0 37.4 38.0 20-24 37.52795 38.0 38.0 38.0 38.0 38.0 25-29 37.514500000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.43575 38.0 38.0 38.0 37.2 38.0 35-39 37.3791 38.0 38.0 38.0 37.0 38.0 40-44 37.29145 38.0 38.0 38.0 36.6 38.0 45-49 37.19785 38.0 38.0 38.0 36.0 38.0 50-54 37.185050000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.06935 38.0 38.0 38.0 36.0 38.0 60-64 36.983050000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.928349999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.768049999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.73445 38.0 38.0 38.0 34.8 38.0 80-84 36.75785 38.0 38.0 38.0 34.8 38.0 85-89 36.60895000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.437400000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.29805 38.0 37.8 38.0 33.8 38.0 100-104 36.1346 38.0 37.0 38.0 33.0 38.0 105-109 35.974149999999995 38.0 37.0 38.0 33.0 38.0 110-114 35.6623 38.0 36.4 38.0 31.4 38.0 115-119 35.4827 38.0 36.0 38.0 31.0 38.0 120-124 35.1473 38.0 35.6 38.0 28.4 38.0 125-129 35.001799999999996 38.0 35.0 38.0 28.2 38.0 130-134 34.74405 38.0 35.0 38.0 27.6 38.0 135-139 34.2029 38.0 34.6 38.0 24.2 38.0 140-144 33.802550000000004 38.0 34.0 38.0 22.6 38.0 145-149 32.79559999999999 38.0 33.6 38.0 16.6 38.0 150-151 28.4135 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 2.0 17 0.0 18 1.0 19 7.0 20 4.0 21 2.0 22 12.0 23 7.0 24 7.0 25 17.0 26 16.0 27 20.0 28 34.0 29 36.0 30 49.0 31 66.0 32 79.0 33 118.0 34 190.0 35 323.0 36 838.0 37 2165.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.752713794016415 11.49060100608949 7.598623245962403 39.15806195393169 2 25.025 13.425 33.35 28.199999999999996 3 21.45 18.675 23.875 36.0 4 26.35 26.174999999999997 20.849999999999998 26.625 5 26.450000000000003 30.15 22.425 20.974999999999998 6 21.675 33.5 22.875 21.95 7 16.925 23.0 39.7 20.375 8 20.0 20.775 30.7 28.525 9 19.3 22.45 32.725 25.525 10-14 23.48 26.26 25.259999999999998 25.0 15-19 23.395 24.73 26.314999999999998 25.56 20-24 23.055 25.495 25.845000000000002 25.605 25-29 23.135 25.16 26.495 25.21 30-34 22.805 26.155 25.22 25.82 35-39 22.645 25.52 26.13 25.705 40-44 23.09 25.585 25.509999999999998 25.814999999999998 45-49 23.075000000000003 25.590000000000003 25.540000000000003 25.795 50-54 23.03 25.305 26.115 25.55 55-59 23.265 24.610000000000003 26.185000000000002 25.94 60-64 22.99 25.7 25.195 26.115 65-69 23.794999999999998 24.9 25.435000000000002 25.869999999999997 70-74 23.400000000000002 25.555 24.905 26.14 75-79 22.98 25.074999999999996 25.745 26.200000000000003 80-84 23.315 25.095 25.424999999999997 26.165 85-89 23.785 25.35 25.515 25.35 90-94 23.669999999999998 24.455 26.13 25.745 95-99 23.665 25.290000000000003 25.635 25.41 100-104 23.62 25.369999999999997 25.235000000000003 25.775 105-109 23.849999999999998 25.56 24.834999999999997 25.755 110-114 23.98 25.255 25.72 25.045 115-119 24.02 25.355 25.195 25.430000000000003 120-124 24.385 25.44 25.035 25.14 125-129 23.69 25.845000000000002 24.42 26.045 130-134 23.72 25.905 24.495 25.88 135-139 23.27 25.540000000000003 25.05 26.14 140-144 23.5 25.77 24.77 25.96 145-149 23.575 26.14 24.6 25.685000000000002 150-151 23.7375 25.137500000000003 25.35 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 3.0 28 3.5 29 7.0 30 9.5 31 11.0 32 18.0 33 22.0 34 22.0 35 35.0 36 47.0 37 61.5 38 79.5 39 94.0 40 124.5 41 151.0 42 180.5 43 197.5 44 192.0 45 197.0 46 207.0 47 201.0 48 178.5 49 166.5 50 167.0 51 153.0 52 135.0 53 130.0 54 109.0 55 90.0 56 95.0 57 99.0 58 99.5 59 93.5 60 81.5 61 66.5 62 54.0 63 50.5 64 50.5 65 51.0 66 42.5 67 35.0 68 37.0 69 32.5 70 25.5 71 23.5 72 18.5 73 11.5 74 11.0 75 13.5 76 7.5 77 1.0 78 0.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.7 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 3.0374999999999996 0.0 0.0 0.0 0.0 108-109 3.5250000000000004 0.0 0.0 0.0 0.0 110-111 4.0875 0.0 0.0 0.0 0.0 112-113 4.625 0.0 0.0 0.0 0.0 114-115 5.1625 0.0 0.0 0.0 0.0 116-117 5.8375 0.0 0.0 0.0 0.0 118-119 6.35 0.0 0.0 0.0 0.0 120-121 6.9875 0.0 0.0 0.0 0.0 122-123 7.6875 0.0 0.0 0.0 0.0 124-125 8.524999999999999 0.0 0.0 0.0 0.0 126-127 9.3 0.0 0.0 0.0 0.0 128-129 10.0 0.0 0.0 0.0 0.0 130-131 10.7 0.0 0.0 0.0 0.0 132-133 11.625 0.0 0.0 0.0 0.0 134-135 12.4375 0.0 0.0 0.0 0.0 136-137 13.3375 0.0 0.0 0.0 0.0 138-139 14.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 110 0.0017675259 10.5427265 135-139 GAAGAGC 110 0.0017675259 10.5427265 140-144 TCGGAAG 130 0.0070456504 8.92077 135-139 >>END_MODULE SRR5578485 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8675 33.0 33.0 34.0 32.0 34.0 2 32.932 33.0 33.0 34.0 32.0 34.0 3 33.015 34.0 33.0 34.0 32.0 34.0 4 32.9475 34.0 33.0 34.0 32.0 34.0 5 33.04075 34.0 33.0 34.0 32.0 34.0 6 37.05225 38.0 38.0 38.0 36.0 38.0 7 37.23025 38.0 38.0 38.0 37.0 38.0 8 37.19725 38.0 38.0 38.0 37.0 38.0 9 37.1925 38.0 38.0 38.0 37.0 38.0 10-14 37.06515 38.0 38.0 38.0 36.8 38.0 15-19 37.09375 38.0 38.0 38.0 37.0 38.0 20-24 37.05735 38.0 38.0 38.0 37.0 38.0 25-29 37.044650000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.0576 38.0 38.0 38.0 37.0 38.0 35-39 37.04065 38.0 38.0 38.0 37.0 38.0 40-44 37.05185 38.0 38.0 38.0 37.0 38.0 45-49 36.97240000000001 38.0 38.0 38.0 36.8 38.0 50-54 36.9533 38.0 38.0 38.0 36.4 38.0 55-59 36.8932 38.0 38.0 38.0 36.2 38.0 60-64 36.8292 38.0 38.0 38.0 36.0 38.0 65-69 36.769549999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.719500000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.6465 38.0 38.0 38.0 35.2 38.0 80-84 36.5366 38.0 38.0 38.0 35.0 38.0 85-89 36.4581 38.0 38.0 38.0 34.6 38.0 90-94 36.3526 38.0 38.0 38.0 34.0 38.0 95-99 36.190999999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.0618 38.0 38.0 38.0 33.6 38.0 105-109 35.90045 38.0 38.0 38.0 33.2 38.0 110-114 35.682100000000005 38.0 37.4 38.0 32.2 38.0 115-119 35.42315 38.0 36.8 38.0 31.0 38.0 120-124 35.02905 38.0 36.0 38.0 28.6 38.0 125-129 34.74250000000001 38.0 35.8 38.0 27.8 38.0 130-134 34.30215 38.0 34.8 38.0 25.0 38.0 135-139 33.8284 38.0 33.4 38.0 23.0 38.0 140-144 33.224599999999995 38.0 33.0 38.0 20.4 38.0 145-149 32.05915 38.0 33.0 38.0 10.0 38.0 150-151 26.678874999999998 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 4.0 5 1.0 6 1.0 7 1.0 8 1.0 9 3.0 10 3.0 11 3.0 12 2.0 13 5.0 14 5.0 15 7.0 16 4.0 17 3.0 18 3.0 19 6.0 20 9.0 21 8.0 22 9.0 23 6.0 24 12.0 25 21.0 26 14.0 27 38.0 28 33.0 29 34.0 30 58.0 31 40.0 32 79.0 33 105.0 34 152.0 35 262.0 36 647.0 37 2408.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 17.325 11.450000000000001 32.6 2 30.099999999999998 23.075000000000003 26.375 20.45 3 22.5 25.724999999999998 26.174999999999997 25.6 4 26.474999999999998 31.65 19.175 22.7 5 28.225 33.0 19.45 19.325 6 23.011505752876438 35.79289644822411 20.58529264632316 20.610305152576288 7 22.83070767691923 19.454863715928983 35.0587646911728 22.655663915978995 8 23.280820205051263 23.23080770192548 24.131032758189548 29.35733933483371 9 24.112056028014006 22.461230615307652 27.463731865932967 25.962981490745374 10-14 25.501877346683354 26.608260325406757 23.053817271589487 24.8360450563204 15-19 25.011270851074485 25.487151229775083 24.27490858087462 25.22666933827581 20-24 25.839094279130347 25.593627892996697 24.301172227231742 24.266105600641218 25-29 25.81533991283002 25.629978457993086 23.966735133510344 24.58794649566655 30-34 26.193697079011972 24.926098501928955 24.089383235633047 24.790821183426022 35-39 26.00330677889674 25.34696127060474 23.97915727240844 24.670574678090084 40-44 26.052104208416832 24.914829659318638 24.253507014028056 24.77955911823647 45-49 25.64629258517034 25.185370741482966 24.98997995991984 24.178356713426854 50-54 25.561122244488978 25.706412825651302 24.65931863727455 24.07314629258517 55-59 26.593186372745492 25.04008016032064 24.258517034068134 24.10821643286573 60-64 26.082164328657313 25.200400801603205 24.634268537074146 24.083166332665332 65-69 25.66646622569653 26.117458408498695 24.393666065343755 23.822409300461015 70-74 26.284396772091622 24.66041802415919 25.086461831487146 23.96872337226204 75-79 25.65786176131522 25.863365244849884 24.790737306400683 23.688035687434216 80-84 26.225563909774436 25.468671679197996 24.847117794486216 23.458646616541355 85-89 25.923142442006114 25.883060273560798 24.184578385690667 24.00921889874242 90-94 25.926853707414832 25.400801603206414 24.524048096192384 24.148296593186373 95-99 25.926853707414832 25.806613226452907 24.15330661322645 24.113226452905813 100-104 26.57815631262525 25.66132264529058 24.559118236472948 23.201402805611224 105-109 25.96693386773547 25.54108216432866 24.69438877755511 23.79759519038076 110-114 26.34190347316193 25.650278153661105 24.487545732471308 23.52027264070566 115-119 27.0003507189739 25.93316298411744 24.32486597524926 22.7416203216594 120-124 27.034068136272545 25.881763527054108 24.248496993987974 22.83567134268537 125-129 27.46492985971944 25.83166332665331 24.04809619238477 22.655310621242485 130-134 27.500000000000004 26.04208416833667 23.917835671342687 22.54008016032064 135-139 27.600200400801604 26.157314629258515 24.128256513026052 22.11422845691383 140-144 28.06147992390107 26.334234504856312 24.041253629718636 21.56303194152398 145-149 28.232229624805893 26.724440214396633 23.73891699644342 21.304413164354056 150-151 28.741241241241237 26.58908908908909 23.536036036036037 21.133633633633632 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.5 6 1.5 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 1.5 25 0.0 26 0.0 27 2.0 28 3.0 29 4.0 30 6.0 31 9.5 32 14.5 33 20.5 34 32.5 35 39.5 36 44.0 37 55.5 38 64.5 39 83.5 40 109.0 41 125.5 42 156.5 43 175.5 44 182.0 45 190.5 46 178.5 47 182.0 48 182.0 49 161.0 50 149.0 51 149.5 52 139.0 53 124.5 54 115.0 55 101.5 56 97.5 57 99.5 58 107.0 59 105.5 60 88.5 61 78.0 62 75.5 63 72.5 64 67.0 65 61.0 66 50.5 67 48.0 68 46.5 69 38.0 70 32.0 71 28.0 72 25.5 73 17.0 74 16.5 75 14.0 76 7.0 77 5.0 78 2.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.025 9 0.05 10-14 0.125 15-19 0.185 20-24 0.19 25-29 0.19499999999999998 30-34 0.20500000000000002 35-39 0.20500000000000002 40-44 0.2 45-49 0.2 50-54 0.2 55-59 0.2 60-64 0.2 65-69 0.22 70-74 0.245 75-79 0.245 80-84 0.25 85-89 0.20500000000000002 90-94 0.2 95-99 0.2 100-104 0.2 105-109 0.2 110-114 0.23500000000000001 115-119 0.20500000000000002 120-124 0.2 125-129 0.2 130-134 0.2 135-139 0.2 140-144 0.13 145-149 0.185 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.528834046839587 1.05 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 2.9625000000000004 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 4.112500000000001 0.0 0.0 0.0 0.0 112-113 4.65 0.0 0.0 0.0 0.0 114-115 5.1875 0.0 0.0 0.0 0.0 116-117 5.8375 0.0 0.0 0.0 0.0 118-119 6.3125 0.0 0.0 0.0 0.0 120-121 6.9875 0.0 0.0 0.0 0.0 122-123 7.675 0.0 0.0 0.0 0.0 124-125 8.5 0.0 0.0 0.0 0.0 126-127 9.3 0.0 0.0 0.0 0.0 128-129 9.975 0.0 0.0 0.0 0.0 130-131 10.6875 0.0 0.0 0.0 0.0 132-133 11.575 0.0 0.0 0.0 0.0 134-135 12.3875 0.0 0.0 0.0 0.0 136-137 13.2875 0.0 0.0 0.0 0.0 138-139 14.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATA 10 0.006830828 145.0 5 GAGCGTC 100 0.005388326 29.0 145 AGAGCGT 105 0.0011959262 11.047619 140-144 TCGGAAG 110 0.0017637183 10.545455 135-139 GAAGAGC 115 0.0025531333 10.086957 140-144 GATCGGA 120 0.0036335043 9.666667 135-139 >>END_MODULE Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251775 spots for SRR5578485.sra Written 1251775 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra Read 1251767 spots for SRR5578485.sra Written 1251767 spots for SRR5578485.sra SRR ids: ['SRR5578485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ck0oz2ca SRR5578485.sra spots: 25035348 blocks: [[1, 1251767], [1251768, 2503534], [2503535, 3755301], [3755302, 5007068], [5007069, 6258835], [6258836, 7510602], [7510603, 8762369], [8762370, 10014136], [10014137, 11265903], [11265904, 12517670], [12517671, 13769437], [13769438, 15021204], [15021205, 16272971], [16272972, 17524738], [17524739, 18776505], [18776506, 20028272], [20028273, 21280039], [21280040, 22531806], [22531807, 23783573], [23783574, 25035348]] SRR5578485 file size 8461957 SRR5578485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578485 SRR5578485_1.fastq SRR5578485_2.fastq Input file: SRR5578485_1.fastq Paired file: SRR5578485_2.fastq trimmed: SRR5578485-trimmed-pair1.fastq, SRR5578485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:27:49 2024 >> started Mon Dec 9 20:29:28 2024 >> done (98.491s) 25035348 read pairs processed; of these: 45094 ( 0.18%) short read pairs filtered out after trimming by size control 32341 ( 0.13%) empty read pairs filtered out after trimming by size control 24957913 (99.69%) read pairs available; of these: 13738395 (55.05%) trimmed read pairs available after processing 11219518 (44.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 16 0.00% 20 12 0.00% 21 14 0.00% 22 19 0.00% 23 14 0.00% 24 14 0.00% 25 17 0.00% 26 18 0.00% 27 27 0.00% 28 23 0.00% 29 18 0.00% 30 28 0.00% 31 28 0.00% 32 30 0.00% 33 32 0.00% 34 42 0.00% 35 34 0.00% 36 47 0.00% 37 52 0.00% 38 46 0.00% 39 64 0.00% 40 74 0.00% 41 87 0.00% 42 98 0.00% 43 98 0.00% 44 101 0.00% 45 104 0.00% 46 119 0.00% 47 148 0.00% 48 202 0.00% 49 186 0.00% 50 237 0.00% 51 257 0.00% 52 280 0.00% 53 312 0.00% 54 354 0.00% 55 394 0.00% 56 434 0.00% 57 510 0.00% 58 669 0.00% 59 659 0.00% 60 749 0.00% 61 905 0.00% 62 1035 0.00% 63 1175 0.00% 64 1354 0.01% 65 1423 0.01% 66 1603 0.01% 67 1940 0.01% 68 2341 0.01% 69 2894 0.01% 70 3022 0.01% 71 3246 0.01% 72 3694 0.01% 73 4094 0.02% 74 4649 0.02% 75 5353 0.02% 76 5880 0.02% 77 6493 0.03% 78 7643 0.03% 79 8469 0.03% 80 9150 0.04% 81 10542 0.04% 82 11975 0.05% 83 13274 0.05% 84 15763 0.06% 85 18016 0.07% 86 18747 0.08% 87 20630 0.08% 88 22221 0.09% 89 22961 0.09% 90 24540 0.10% 91 26446 0.11% 92 28280 0.11% 93 30267 0.12% 94 32545 0.13% 95 34839 0.14% 96 36756 0.15% 97 39132 0.16% 98 40629 0.16% 99 42630 0.17% 100 45116 0.18% 101 47188 0.19% 102 50178 0.20% 103 52902 0.21% 104 54801 0.22% 105 57003 0.23% 106 60380 0.24% 107 62143 0.25% 108 64069 0.26% 109 66886 0.27% 110 68050 0.27% 111 71173 0.29% 112 73971 0.30% 113 76579 0.31% 114 80077 0.32% 115 83273 0.33% 116 85589 0.34% 117 87699 0.35% 118 89885 0.36% 119 91475 0.37% 120 95056 0.38% 121 97564 0.39% 122 99390 0.40% 123 102932 0.41% 124 106772 0.43% 125 109159 0.44% 126 112520 0.45% 127 114659 0.46% 128 117834 0.47% 129 120135 0.48% 130 123499 0.49% 131 126019 0.50% 132 129504 0.52% 133 132950 0.53% 134 137266 0.55% 135 141471 0.57% 136 146908 0.59% 137 150355 0.60% 138 156560 0.63% 139 164383 0.66% 140 172601 0.69% 141 182096 0.73% 142 197504 0.79% 143 212937 0.85% 144 237010 0.95% 145 273315 1.10% 146 325068 1.30% 147 422315 1.69% 148 614139 2.46% 149 1163655 4.66% 150 5511146 22.08% 151 11219518 44.95% 24957913 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.66 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.4 sequence=TCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=14 prefix-density=0.62 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=84.18 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5578485 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:32:32 Started mapping on | Dec 09 20:32:32 Finished on | Dec 09 20:37:17 Mapping speed, Million of reads per hour | 315.26 Number of input reads | 24957913 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 23381622 Uniquely mapped reads % | 93.68% Average mapped length | 288.66 Number of splices: Total | 25701464 Number of splices: Annotated (sjdb) | 24218272 Number of splices: GT/AG | 25361154 Number of splices: GC/AG | 309601 Number of splices: AT/AC | 13781 Number of splices: Non-canonical | 16928 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405308 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 48564 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 1.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1193041 1193041 1193041 N_multimapping 405308 405308 405308 N_noFeature 956886 22748539 1166450 N_ambiguous 504309 3423 81381 UnstrandedReadsAssigned:21920427 PositiveStrandReadsAssigned:629660 NegativeStrandReadsAssigned:22133791 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR5578485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578485-trimmed-pair1.fastq SRR5578485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,957,913 reads, 22,355,680 reads pseudoaligned [quant] estimated average fragment length: 234.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR5578485.ke.tsv 35125 SRR5578485.se.tsv 88098 total ==> SRR5578485.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.767 0 0 PNS24247 1044 810.353 57.8996 4.70817 PNS24249 1928 1694.35 86.9478 3.38148 PNS24246 1044 810.353 57.8996 4.70817 PNS24248 1044 810.353 57.8996 4.70817 PNS24244 1471 1237.35 109.353 5.82358 PNS24243 293 109.267 0 0 KQK14069 1603 1369.35 3611.63 173.796 KQK14071 474 256.969 143.543 36.8088 ==> SRR5578485.se.tsv <== BRADI_1g14170v3 4427 BRADI_1g53295v3 159 BRADI_1g59795v3 528 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 3213 BRADI_1g74790v3 237 BRADI_1g09890v3 2 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR5578485 completed mapping pipeline successfully