Starting /dee2/code/volunteer_pipeline.sh SRR5578487 current disk space = 1521168568320 free memory = 1575154172 SRR5578487 SRAfilesize 2cb492b08988868707a2475ee63a1a58 SRR5578487.sra SRR5578487.sra file validated SRR5578487 is paired end SRR5578487 is conventional basespace SRR5578487 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.45625 34.0 34.0 34.0 33.0 34.0 2 33.37375 34.0 34.0 34.0 33.0 34.0 3 33.4565 34.0 34.0 34.0 33.0 34.0 4 33.483 34.0 34.0 34.0 33.0 34.0 5 33.4615 34.0 34.0 34.0 33.0 34.0 6 37.195 38.0 38.0 38.0 36.0 38.0 7 37.41175 38.0 38.0 38.0 37.0 38.0 8 37.4865 38.0 38.0 38.0 37.0 38.0 9 37.5385 38.0 38.0 38.0 38.0 38.0 10-14 37.48295 38.0 38.0 38.0 37.8 38.0 15-19 37.49215 38.0 38.0 38.0 38.0 38.0 20-24 37.515249999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.513999999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.501349999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.48875 38.0 38.0 38.0 38.0 38.0 40-44 37.4293 38.0 38.0 38.0 37.2 38.0 45-49 37.372 38.0 38.0 38.0 37.0 38.0 50-54 37.35275 38.0 38.0 38.0 37.0 38.0 55-59 37.30275 38.0 38.0 38.0 37.0 38.0 60-64 37.2721 38.0 38.0 38.0 37.0 38.0 65-69 37.1885 38.0 38.0 38.0 36.6 38.0 70-74 37.18855 38.0 38.0 38.0 36.4 38.0 75-79 37.20225 38.0 38.0 38.0 36.4 38.0 80-84 37.1322 38.0 38.0 38.0 36.0 38.0 85-89 37.02725 38.0 38.0 38.0 36.0 38.0 90-94 36.9862 38.0 38.0 38.0 35.4 38.0 95-99 36.928999999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.89765 38.0 38.0 38.0 35.0 38.0 105-109 36.80435 38.0 38.0 38.0 35.0 38.0 110-114 36.717349999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.56645 38.0 38.0 38.0 34.0 38.0 120-124 36.401799999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.30935 38.0 38.0 38.0 33.8 38.0 130-134 36.13965 38.0 38.0 38.0 33.4 38.0 135-139 35.8941 38.0 37.2 38.0 32.6 38.0 140-144 35.69935 38.0 36.2 38.0 32.4 38.0 145-149 35.12215 38.0 36.0 38.0 30.6 38.0 150-151 32.02525 36.5 32.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 1.0 20 3.0 21 1.0 22 2.0 23 11.0 24 5.0 25 9.0 26 12.0 27 17.0 28 18.0 29 26.0 30 29.0 31 36.0 32 52.0 33 63.0 34 108.0 35 187.0 36 425.0 37 2986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.65 9.375 8.975 38.0 2 25.357411587659897 14.497115625783795 30.950589415600703 29.194883370955605 3 23.200000000000003 19.725 22.95 34.125 4 27.0 26.224999999999998 20.025000000000002 26.75 5 27.200000000000003 30.0 22.875 19.925 6 22.725 31.874999999999996 22.675 22.725 7 17.775 22.8 40.425 19.0 8 21.4 22.725 29.375 26.5 9 21.675 20.5 32.550000000000004 25.275 10-14 23.62 26.314999999999998 25.245 24.82 15-19 23.665 25.145 25.575 25.615 20-24 23.25 25.14 26.0 25.61 25-29 23.630000000000003 25.840000000000003 25.15 25.380000000000003 30-34 23.68 25.165 25.705 25.45 35-39 23.405 25.374999999999996 25.215 26.005 40-44 23.385 25.374999999999996 25.855 25.385 45-49 23.657365736573656 25.34253425342534 25.57255725572557 25.42754275427543 50-54 23.925 24.855 25.595000000000002 25.624999999999996 55-59 23.977397739773977 24.98249824982498 25.16251625162516 25.877587758775878 60-64 23.555 25.595000000000002 25.495 25.355 65-69 23.78070131559202 25.096293331999398 25.546495923165423 25.57650942924316 70-74 24.112411241124114 24.682468246824683 25.79257925792579 25.412541254125415 75-79 24.154999999999998 25.2 25.324999999999996 25.319999999999997 80-84 23.615 24.845 25.990000000000002 25.55 85-89 24.167416741674167 24.5024502450245 25.677567756775677 25.65256525652565 90-94 23.945 24.715 25.275 26.064999999999998 95-99 24.125 25.259999999999998 24.95 25.665 100-104 24.54 25.405 24.404999999999998 25.650000000000002 105-109 24.39 24.85 24.765 25.995 110-114 23.955000000000002 25.355 25.009999999999998 25.679999999999996 115-119 24.740000000000002 24.89 24.795 25.575 120-124 24.487448744874488 24.877487748774875 24.597459745974597 26.037603760376037 125-129 24.055 25.95 24.165 25.83 130-134 24.759999999999998 25.130000000000003 24.529999999999998 25.580000000000002 135-139 24.34 25.69 24.515 25.455 140-144 24.095 25.28 24.335 26.290000000000003 145-149 24.525 25.480000000000004 24.29 25.705 150-151 24.425 25.0125 24.9 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 3.5 29 6.0 30 8.5 31 12.0 32 16.5 33 24.5 34 33.5 35 39.0 36 45.0 37 60.5 38 80.5 39 94.5 40 117.0 41 137.0 42 162.5 43 177.5 44 189.0 45 211.5 46 210.0 47 199.5 48 178.5 49 168.5 50 169.5 51 154.0 52 136.5 53 116.0 54 107.0 55 106.5 56 97.0 57 79.0 58 62.0 59 71.5 60 79.0 61 71.0 62 62.0 63 52.5 64 56.0 65 57.5 66 53.5 67 53.5 68 43.0 69 34.5 70 35.5 71 26.0 72 19.0 73 19.0 74 16.5 75 14.0 76 10.5 77 7.0 78 5.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.045 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8875000000000002 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.3125 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.699999999999999 0.0 0.0 0.0 0.0 120-121 5.3375 0.0 0.0 0.0 0.0 122-123 5.862500000000001 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 7.1625 0.0 0.0 0.0 0.0 128-129 7.8375 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.1375 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGTT 10 0.006843168 144.91249 8 GAAGTTT 10 0.006843168 144.91249 9 AAGAAGT 10 0.006843168 144.91249 7 GCACACG 45 0.008978676 48.30417 145 >>END_MODULE SRR5578487 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7375 33.0 32.0 33.0 28.0 34.0 2 31.896 33.0 32.0 34.0 28.0 34.0 3 31.69575 33.0 31.0 34.0 28.0 34.0 4 31.71725 33.0 33.0 34.0 28.0 34.0 5 31.682 33.0 33.0 34.0 28.0 34.0 6 35.73175 38.0 37.0 38.0 29.0 38.0 7 35.756 38.0 37.0 38.0 31.0 38.0 8 35.7035 38.0 37.0 38.0 31.0 38.0 9 35.6835 38.0 37.0 38.0 31.0 38.0 10-14 35.60405 38.0 37.0 38.0 29.4 38.0 15-19 35.47305 38.0 37.0 38.0 29.0 38.0 20-24 35.30445 38.0 37.0 38.0 28.6 38.0 25-29 35.12265 38.0 36.0 38.0 28.2 38.0 30-34 34.8561 38.0 36.0 38.0 27.0 38.0 35-39 34.772149999999996 38.0 36.0 38.0 26.6 38.0 40-44 34.4945 38.0 36.0 38.0 25.4 38.0 45-49 34.29424999999999 38.0 35.0 38.0 24.6 38.0 50-54 34.056850000000004 38.0 34.8 38.0 22.8 38.0 55-59 33.83905 38.0 34.2 38.0 16.0 38.0 60-64 33.51675 38.0 34.0 38.0 16.0 38.0 65-69 33.161950000000004 38.0 33.4 38.0 16.0 38.0 70-74 32.846799999999995 37.8 32.4 38.0 16.0 38.0 75-79 32.46835 37.0 31.8 38.0 15.8 38.0 80-84 31.85855 37.0 29.0 38.0 15.0 38.0 85-89 31.28615 36.6 28.6 38.0 14.8 38.0 90-94 30.638299999999997 36.0 27.0 38.0 14.2 38.0 95-99 30.02475 35.6 25.6 38.0 13.6 38.0 100-104 29.2879 35.0 23.0 38.0 13.0 38.0 105-109 28.43245 34.2 20.2 38.0 6.4 38.0 110-114 27.6293 34.0 16.2 38.0 2.0 38.0 115-119 26.436799999999998 33.8 15.0 38.0 2.0 38.0 120-124 25.47645 32.4 14.4 37.8 2.0 38.0 125-129 23.995900000000002 30.2 13.2 36.8 2.0 38.0 130-134 22.48655 27.0 6.4 36.0 2.0 38.0 135-139 21.1274 23.4 2.0 35.0 2.0 38.0 140-144 19.32515 20.0 2.0 35.0 2.0 38.0 145-149 16.52025 8.6 2.0 33.4 2.0 38.0 150-151 12.434375 2.0 2.0 28.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 12.0 4 10.0 5 10.0 6 7.0 7 7.0 8 8.0 9 7.0 10 15.0 11 11.0 12 13.0 13 20.0 14 21.0 15 20.0 16 33.0 17 38.0 18 46.0 19 37.0 20 56.0 21 69.0 22 75.0 23 83.0 24 90.0 25 103.0 26 109.0 27 146.0 28 153.0 29 220.0 30 191.0 31 253.0 32 299.0 33 350.0 34 396.0 35 456.0 36 429.0 37 169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.390390390390394 18.493493493493492 11.286286286286286 29.82982982982983 2 29.06539714357304 23.402655975945876 27.637183663242293 19.894763217238786 3 24.661654135338345 25.36340852130326 26.340852130325814 23.63408521303258 4 26.56641604010025 32.280701754385966 19.248120300751882 21.904761904761905 5 27.142857142857142 32.606516290726816 19.223057644110277 21.027568922305765 6 22.136068034017008 35.66783391695848 19.884942471235618 22.311155577788895 7 22.678347934918648 17.897371714643302 35.66958698372966 23.754693366708384 8 22.80130293159609 24.129290904535207 24.204460035078927 28.864946128789775 9 23.452768729641694 22.225006264094212 26.33425206715109 27.987972939113003 10-14 25.875808149150505 26.351927028517014 22.963965318498474 24.80829950383401 15-19 25.512402906539716 25.88824855925833 24.30468554247056 24.294662991731393 20-24 25.172793749373934 26.23960733246519 24.121005709706502 24.466593208454373 25-29 25.80322290061055 25.232709438494645 24.131718546692024 24.83234911420278 30-34 25.736915981552034 25.857228794866653 23.997393222378182 24.40846200120313 35-39 25.030090270812437 25.42126379137412 24.914744232698094 24.633901705115345 40-44 26.246180051099643 25.209157857822756 24.21221381694304 24.332448274134563 45-49 25.53639462602767 25.345899338279526 24.127732103469018 24.989973932223783 50-54 25.64513704464599 25.559953900886907 24.6580147316731 24.136894322794006 55-59 25.586289837642813 25.255562236921225 24.754459811585487 24.40368811385047 60-64 25.085170340681362 25.38577154308617 24.243486973947896 25.285571142284567 65-69 25.829241406954605 25.548652169556068 23.634632728730335 24.987473694758993 70-74 25.741482965931862 25.67635270541082 24.298597194388776 24.283567134268537 75-79 25.75066419369392 25.645395759185924 24.472404631811116 24.13153541530904 80-84 25.269113302958996 25.99008661693286 24.07249787212737 24.668302207980773 85-89 25.852144751989588 25.35662445567846 24.42564692927574 24.36558386305621 90-94 25.82310197945377 25.757955399649212 24.134302179904786 24.284640440992234 95-99 25.665046841340615 25.845398527127898 23.951705826361405 24.537848805170082 100-104 26.30815407703852 26.50825412706353 22.98649324662331 24.19709854927464 105-109 25.96693386773547 26.077154308617235 23.657314629258515 24.298597194388776 110-114 25.741037452433407 26.006408972561584 23.923492890046063 24.329060684958943 115-119 26.276787502503506 26.236731423993593 23.658121369917883 23.82835970358502 120-124 26.45248461192013 26.987939748786467 23.37486863834259 23.18470700095081 125-129 26.281248434447175 27.19302640148289 23.100045087921448 23.42568007614849 130-134 26.941370850648376 26.971411405397287 22.850848645671658 23.23636909828268 135-139 26.460137130273758 27.250888343926732 23.131975376607777 23.15699914919173 140-144 27.12398679075353 27.179025317722406 22.210547383168215 23.486440508355848 145-149 26.710684273709482 27.926170468187273 22.524009603841534 22.839135654261707 150-151 27.45686421605401 29.08227056764191 21.442860715178792 22.018004501125283 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 2.0 10 1.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 2.5 27 3.0 28 5.5 29 8.0 30 9.0 31 13.0 32 19.0 33 28.5 34 31.5 35 33.5 36 41.5 37 53.0 38 77.0 39 98.5 40 113.0 41 135.0 42 151.0 43 169.0 44 174.0 45 170.5 46 185.0 47 194.0 48 183.5 49 164.5 50 158.5 51 152.0 52 126.5 53 102.0 54 106.5 55 105.5 56 80.5 57 80.5 58 85.5 59 87.5 60 80.5 61 67.0 62 78.5 63 70.5 64 57.0 65 56.0 66 60.5 67 65.5 68 55.5 69 48.5 70 48.5 71 37.0 72 27.5 73 24.0 74 20.0 75 15.0 76 8.0 77 5.5 78 4.0 79 3.0 80 1.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.22499999999999998 3 0.25 4 0.25 5 0.25 6 0.05 7 0.125 8 0.22499999999999998 9 0.22499999999999998 10-14 0.23500000000000001 15-19 0.22499999999999998 20-24 0.16999999999999998 25-29 0.09 30-34 0.26 35-39 0.3 40-44 0.19499999999999998 45-49 0.26 50-54 0.215 55-59 0.22 60-64 0.2 65-69 0.21 70-74 0.2 75-79 0.255 80-84 0.135 85-89 0.105 90-94 0.22499999999999998 95-99 0.19499999999999998 100-104 0.05 105-109 0.2 110-114 0.13999999999999999 115-119 0.13999999999999999 120-124 0.08499999999999999 125-129 0.19499999999999998 130-134 0.135 135-139 0.095 140-144 0.06999999999999999 145-149 0.04 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.9 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.425 0.0 0.0 0.0 0.0 136-137 5.737500000000001 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCGT 10 0.006822205 145.03798 5 CAATCCG 10 0.006822205 145.03798 4 AGAACTG 10 0.006822205 145.03798 4 ATCCGTG 10 0.006822205 145.03798 6 >>END_MODULE Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra Read 978851 spots for SRR5578487.sra Written 978851 spots for SRR5578487.sra Read 978844 spots for SRR5578487.sra Written 978844 spots for SRR5578487.sra SRR ids: ['SRR5578487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4cmhr6wo SRR5578487.sra spots: 19576887 blocks: [[1, 978844], [978845, 1957688], [1957689, 2936532], [2936533, 3915376], [3915377, 4894220], [4894221, 5873064], [5873065, 6851908], [6851909, 7830752], [7830753, 8809596], [8809597, 9788440], [9788441, 10767284], [10767285, 11746128], [11746129, 12724972], [12724973, 13703816], [13703817, 14682660], [14682661, 15661504], [15661505, 16640348], [16640349, 17619192], [17619193, 18598036], [18598037, 19576887]] SRR5578487 file size 6612264 SRR5578487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578487 SRR5578487_1.fastq SRR5578487_2.fastq Input file: SRR5578487_1.fastq Paired file: SRR5578487_2.fastq trimmed: SRR5578487-trimmed-pair1.fastq, SRR5578487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:29:02 2024 >> started Mon Dec 9 20:29:26 2024 >> done (23.695s) 19576887 read pairs processed; of these: 62131 ( 0.32%) short read pairs filtered out after trimming by size control 63276 ( 0.32%) empty read pairs filtered out after trimming by size control 19451480 (99.36%) read pairs available; of these: 11069757 (56.91%) trimmed read pairs available after processing 8381723 (43.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 6 0.00% 21 5 0.00% 22 12 0.00% 23 17 0.00% 24 15 0.00% 25 10 0.00% 26 14 0.00% 27 14 0.00% 28 20 0.00% 29 19 0.00% 30 22 0.00% 31 21 0.00% 32 21 0.00% 33 24 0.00% 34 19 0.00% 35 39 0.00% 36 37 0.00% 37 29 0.00% 38 38 0.00% 39 30 0.00% 40 43 0.00% 41 46 0.00% 42 50 0.00% 43 59 0.00% 44 69 0.00% 45 71 0.00% 46 69 0.00% 47 96 0.00% 48 112 0.00% 49 122 0.00% 50 162 0.00% 51 194 0.00% 52 190 0.00% 53 211 0.00% 54 261 0.00% 55 263 0.00% 56 285 0.00% 57 348 0.00% 58 414 0.00% 59 417 0.00% 60 509 0.00% 61 621 0.00% 62 706 0.00% 63 838 0.00% 64 941 0.00% 65 993 0.01% 66 1136 0.01% 67 1287 0.01% 68 1525 0.01% 69 1674 0.01% 70 1982 0.01% 71 2152 0.01% 72 2558 0.01% 73 2887 0.01% 74 3067 0.02% 75 3609 0.02% 76 4043 0.02% 77 4443 0.02% 78 5215 0.03% 79 5792 0.03% 80 6395 0.03% 81 7321 0.04% 82 8149 0.04% 83 9353 0.05% 84 12261 0.06% 85 14137 0.07% 86 14760 0.08% 87 15829 0.08% 88 16652 0.09% 89 17795 0.09% 90 18828 0.10% 91 20058 0.10% 92 21001 0.11% 93 22678 0.12% 94 24224 0.12% 95 25106 0.13% 96 26802 0.14% 97 28549 0.15% 98 29768 0.15% 99 31363 0.16% 100 33155 0.17% 101 34414 0.18% 102 36297 0.19% 103 38223 0.20% 104 40787 0.21% 105 41962 0.22% 106 44317 0.23% 107 45678 0.23% 108 47521 0.24% 109 50010 0.26% 110 52275 0.27% 111 54423 0.28% 112 56852 0.29% 113 59170 0.30% 114 61927 0.32% 115 64521 0.33% 116 66749 0.34% 117 68637 0.35% 118 71304 0.37% 119 73738 0.38% 120 76529 0.39% 121 79437 0.41% 122 81271 0.42% 123 85707 0.44% 124 88554 0.46% 125 92084 0.47% 126 94909 0.49% 127 99369 0.51% 128 101087 0.52% 129 105154 0.54% 130 108847 0.56% 131 112015 0.58% 132 116870 0.60% 133 121986 0.63% 134 126543 0.65% 135 133431 0.69% 136 138756 0.71% 137 146104 0.75% 138 153796 0.79% 139 163747 0.84% 140 171612 0.88% 141 183248 0.94% 142 201674 1.04% 143 220110 1.13% 144 243027 1.25% 145 281468 1.45% 146 339021 1.74% 147 435318 2.24% 148 605694 3.11% 149 1021467 5.25% 150 3678048 18.91% 151 8381723 43.09% 19451480 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=18 prefix-density=0.88 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=55.10 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.1 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=29.11 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578487 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:30:10 Started mapping on | Dec 09 20:30:10 Finished on | Dec 09 20:33:19 Mapping speed, Million of reads per hour | 370.50 Number of input reads | 19451480 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18204512 Uniquely mapped reads % | 93.59% Average mapped length | 287.99 Number of splices: Total | 19408099 Number of splices: Annotated (sjdb) | 18247374 Number of splices: GT/AG | 19162636 Number of splices: GC/AG | 223674 Number of splices: AT/AC | 8591 Number of splices: Non-canonical | 13198 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279278 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 30894 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1002018 1002018 1002018 N_multimapping 279278 279278 279278 N_noFeature 825063 17689967 1006901 N_ambiguous 408527 2671 76329 UnstrandedReadsAssigned:16970922 PositiveStrandReadsAssigned:511874 NegativeStrandReadsAssigned:17121282 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5578487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578487-trimmed-pair1.fastq SRR5578487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,451,480 reads, 17,262,565 reads pseudoaligned [quant] estimated average fragment length: 249.42 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR5578487.ke.tsv 35125 SRR5578487.se.tsv 88098 total ==> SRR5578487.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.047 0 0 PNS24247 1044 795.58 43.0235 4.657 PNS24249 1928 1679.58 80.5003 4.12745 PNS24246 1044 795.58 43.0235 4.657 PNS24248 1044 795.58 43.0235 4.657 PNS24244 1471 1222.58 46.4293 3.27039 PNS24243 293 102.348 0 0 KQK14069 1603 1354.58 899.159 57.1632 KQK14071 474 244.567 44.2913 15.5957 ==> SRR5578487.se.tsv <== BRADI_1g14170v3 1030 BRADI_1g53295v3 168 BRADI_1g59795v3 334 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 2180 BRADI_1g74790v3 93 BRADI_1g09890v3 7 BRADI_1g77505v3 297 BRADI_1g48960v3 0 SRR5578487 completed mapping pipeline successfully