Starting /dee2/code/volunteer_pipeline.sh SRR5578488 current disk space = 1521131094016 free memory = 1580578656 SRR5578488 SRAfilesize 1b435b651d32c88e700a66a96ed99935 SRR5578488.sra SRR5578488.sra file validated SRR5578488 is paired end SRR5578488 is conventional basespace SRR5578488 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65675 34.0 33.0 34.0 33.0 34.0 2 33.291 34.0 34.0 34.0 33.0 34.0 3 33.42475 34.0 34.0 34.0 33.0 34.0 4 33.531 34.0 34.0 34.0 33.0 34.0 5 33.368 34.0 34.0 34.0 33.0 34.0 6 37.09875 38.0 37.0 38.0 36.0 38.0 7 37.38675 38.0 38.0 38.0 37.0 38.0 8 37.50725 38.0 38.0 38.0 37.0 38.0 9 37.5765 38.0 38.0 38.0 38.0 38.0 10-14 37.5479 38.0 38.0 38.0 38.0 38.0 15-19 37.523849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.5244 38.0 38.0 38.0 38.0 38.0 25-29 37.50985 38.0 38.0 38.0 38.0 38.0 30-34 37.435550000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.41709999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.2932 38.0 38.0 38.0 37.0 38.0 45-49 37.2645 38.0 38.0 38.0 37.0 38.0 50-54 37.185950000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.1645 38.0 38.0 38.0 36.0 38.0 60-64 37.09995000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.03490000000001 38.0 38.0 38.0 35.8 38.0 70-74 37.00265 38.0 38.0 38.0 35.8 38.0 75-79 36.883250000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.80105 38.0 38.0 38.0 35.0 38.0 85-89 36.660849999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.54225 38.0 38.0 38.0 34.2 38.0 95-99 36.42909999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.33789999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.097750000000005 38.0 37.8 38.0 33.2 38.0 110-114 35.944300000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.731449999999995 38.0 36.6 38.0 31.8 38.0 120-124 35.48755 38.0 36.4 38.0 31.4 38.0 125-129 35.1461 38.0 35.8 38.0 29.2 38.0 130-134 34.974000000000004 38.0 35.2 38.0 28.4 38.0 135-139 34.56315 38.0 35.0 38.0 27.2 38.0 140-144 34.1219 38.0 35.0 38.0 23.8 38.0 145-149 33.3601 38.0 34.4 38.0 18.6 38.0 150-151 28.923375 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 4.0 16 5.0 17 1.0 18 7.0 19 7.0 20 4.0 21 4.0 22 8.0 23 8.0 24 14.0 25 17.0 26 21.0 27 23.0 28 22.0 29 28.0 30 37.0 31 52.0 32 63.0 33 78.0 34 133.0 35 257.0 36 754.0 37 2448.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.05882352941176 10.737220652453122 9.709735422553301 32.49422039558181 2 27.1 12.6 28.975 31.324999999999996 3 23.40585146286572 19.179794948737182 22.88072018004501 34.53363340835209 4 27.825 25.624999999999996 20.825 25.724999999999998 5 27.05616850551655 29.237713139418254 22.517552657973923 21.188565697091274 6 24.7 30.599999999999998 23.1 21.6 7 18.925 22.6 38.95 19.525000000000002 8 21.425 23.1 28.225 27.250000000000004 9 21.025 22.175 30.349999999999998 26.450000000000003 10-14 24.01 26.22 24.22 25.55 15-19 24.104999999999997 25.305 24.295 26.295 20-24 24.4 24.355 25.06 26.185000000000002 25-29 24.345 25.285000000000004 24.27 26.1 30-34 23.955000000000002 24.58 24.675 26.790000000000003 35-39 24.240000000000002 25.16 23.965 26.634999999999998 40-44 24.675 24.865000000000002 24.16 26.3 45-49 24.21 24.175 24.83 26.784999999999997 50-54 24.46 24.645 24.055 26.840000000000003 55-59 24.73 24.465 23.87 26.935 60-64 24.67 24.645 23.810000000000002 26.875 65-69 24.2 24.565 24.195 27.04 70-74 24.605 24.895 23.595 26.905 75-79 25.255 24.279999999999998 23.825 26.640000000000004 80-84 25.14 24.610000000000003 23.625 26.625 85-89 25.355 24.6 23.815 26.229999999999997 90-94 25.480000000000004 24.695 23.605 26.22 95-99 25.72 23.84 23.735 26.705000000000002 100-104 25.115 24.925 23.5 26.46 105-109 25.369999999999997 24.59 23.3 26.740000000000002 110-114 25.0 24.63 23.565 26.805 115-119 25.66 24.33 23.11 26.900000000000002 120-124 25.19 24.705 22.39 27.715 125-129 25.715 24.57 22.994999999999997 26.72 130-134 25.724999999999998 24.08 23.095 27.1 135-139 25.45 24.355 23.415 26.779999999999998 140-144 25.28 24.42 23.845 26.455000000000002 145-149 24.83 24.985 23.200000000000003 26.985 150-151 24.098647971957938 25.037556334501755 22.984476715072606 27.879318978467705 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 2.0 29 4.0 30 8.5 31 9.5 32 7.5 33 14.0 34 23.0 35 35.0 36 45.0 37 54.5 38 70.0 39 92.0 40 121.5 41 138.5 42 143.5 43 156.5 44 167.5 45 167.5 46 170.5 47 167.5 48 162.0 49 159.0 50 144.0 51 138.0 52 135.5 53 118.0 54 101.0 55 91.0 56 91.5 57 92.0 58 88.0 59 89.0 60 91.0 61 87.5 62 75.0 63 65.5 64 68.0 65 63.0 66 65.5 67 68.0 68 63.5 69 56.5 70 47.5 71 44.5 72 42.0 73 35.5 74 26.5 75 22.0 76 18.0 77 15.5 78 10.0 79 5.0 80 6.0 81 5.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.025 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96255060728745 97.775 2 0.9615384615384616 1.9 3 0.05060728744939271 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025303643724696356 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 3 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 1.1375 0.0 0.0 0.0 0.0 84-85 1.4125 0.0 0.0 0.0 0.0 86-87 1.7 0.0 0.0 0.0 0.0 88-89 2.0875 0.0 0.0 0.0 0.0 90-91 2.425 0.0 0.0 0.0 0.0 92-93 2.825 0.0 0.0 0.0 0.0 94-95 3.3875 0.0 0.0 0.0 0.0 96-97 3.75 0.0 0.0 0.0 0.0 98-99 4.175 0.0 0.0 0.0 0.0 100-101 4.7 0.0 0.0 0.0 0.0 102-103 5.1625 0.0 0.0 0.0 0.0 104-105 5.8125 0.0 0.0 0.0 0.0 106-107 6.4625 0.0 0.0 0.0 0.0 108-109 7.175 0.0 0.0 0.0 0.0 110-111 7.949999999999999 0.0 0.0 0.0 0.0 112-113 8.600000000000001 0.0 0.0 0.0 0.0 114-115 9.3125 0.0 0.0 0.0 0.0 116-117 10.05 0.0 0.0 0.0 0.0 118-119 10.9 0.0 0.0 0.0 0.0 120-121 11.65 0.0 0.0 0.0 0.0 122-123 12.45 0.0 0.0 0.0 0.0 124-125 13.537500000000001 0.0 0.0 0.0 0.0 126-127 14.375 0.0 0.0 0.0 0.0 128-129 15.2625 0.0 0.0 0.0 0.0 130-131 16.275 0.0 0.0 0.0 0.0 132-133 16.9625 0.0 0.0 0.0 0.0 134-135 17.950000000000003 0.0 0.0 0.0 0.0 136-137 18.9 0.0 0.0 0.0 0.0 138-139 19.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578488 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84575 33.0 33.0 34.0 32.0 34.0 2 32.90075 34.0 33.0 34.0 32.0 34.0 3 32.94775 34.0 33.0 34.0 32.0 34.0 4 32.782 34.0 33.0 34.0 32.0 34.0 5 32.89675 34.0 33.0 34.0 32.0 34.0 6 36.9695 38.0 38.0 38.0 36.0 38.0 7 36.99975 38.0 38.0 38.0 36.0 38.0 8 36.93775 38.0 38.0 38.0 36.0 38.0 9 36.9865 38.0 38.0 38.0 36.0 38.0 10-14 37.0278 38.0 38.0 38.0 36.8 38.0 15-19 36.883950000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.89365 38.0 38.0 38.0 36.0 38.0 25-29 36.86985 38.0 38.0 38.0 36.0 38.0 30-34 36.82525 38.0 38.0 38.0 36.0 38.0 35-39 36.82045000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.8078 38.0 38.0 38.0 36.0 38.0 45-49 36.74225 38.0 38.0 38.0 36.0 38.0 50-54 36.6568 38.0 38.0 38.0 35.6 38.0 55-59 36.5937 38.0 38.0 38.0 35.2 38.0 60-64 36.4387 38.0 38.0 38.0 34.6 38.0 65-69 36.384299999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.16215 38.0 38.0 38.0 34.0 38.0 75-79 36.123949999999994 38.0 38.0 38.0 33.8 38.0 80-84 35.95295 38.0 38.0 38.0 33.0 38.0 85-89 35.891650000000006 38.0 38.0 38.0 33.2 38.0 90-94 35.6952 38.0 37.8 38.0 32.2 38.0 95-99 35.477199999999996 38.0 37.0 38.0 31.0 38.0 100-104 35.212900000000005 38.0 36.6 38.0 29.6 38.0 105-109 34.92145000000001 38.0 36.0 38.0 28.0 38.0 110-114 34.73115 38.0 35.8 38.0 27.2 38.0 115-119 34.3038 38.0 35.0 38.0 23.8 38.0 120-124 33.790749999999996 38.0 34.6 38.0 22.6 38.0 125-129 33.1715 38.0 34.0 38.0 16.0 38.0 130-134 32.474900000000005 38.0 33.4 38.0 14.0 38.0 135-139 31.368850000000002 37.6 31.0 38.0 13.0 38.0 140-144 30.242849999999997 36.4 29.4 38.0 4.2 38.0 145-149 28.517299999999995 36.0 23.2 38.0 2.0 38.0 150-151 22.8965 30.0 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 6.0 4 2.0 5 3.0 6 3.0 7 2.0 8 4.0 9 1.0 10 2.0 11 6.0 12 4.0 13 5.0 14 6.0 15 5.0 16 9.0 17 14.0 18 4.0 19 6.0 20 14.0 21 17.0 22 11.0 23 21.0 24 24.0 25 33.0 26 28.0 27 32.0 28 32.0 29 41.0 30 67.0 31 95.0 32 133.0 33 165.0 34 264.0 35 393.0 36 789.0 37 1746.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.65 17.525 12.275 25.55 2 31.30782695673918 20.730182545636406 23.55588897224306 24.406101525381345 3 26.950000000000003 22.75 25.275 25.025 4 28.796597448086064 28.096072054040533 18.789091818864147 24.31823867900926 5 28.87165374030523 30.397798348761572 18.939204403302476 21.79134350763072 6 24.925 32.725 18.7 23.65 7 24.75 18.95 30.9 25.4 8 24.125 21.975 23.35 30.55 9 24.9 22.675 24.175 28.249999999999996 10-14 27.155 24.529999999999998 21.61 26.705000000000002 15-19 26.810000000000002 24.12 23.075000000000003 25.995 20-24 26.87 24.43 22.935 25.765 25-29 26.845000000000002 23.635 23.1 26.419999999999998 30-34 27.07 24.39 23.27 25.27 35-39 26.919999999999998 23.815 23.085 26.179999999999996 40-44 27.400000000000002 23.580000000000002 23.05 25.97 45-49 27.400000000000002 23.755000000000003 23.22 25.624999999999996 50-54 27.365000000000002 23.225 23.405 26.005 55-59 27.865000000000002 23.14 23.294999999999998 25.7 60-64 27.105 23.335 23.200000000000003 26.36 65-69 27.765 23.799999999999997 22.975 25.46 70-74 26.86 24.025 23.68 25.435000000000002 75-79 26.57 23.355 24.205 25.869999999999997 80-84 26.695 24.275 23.44 25.590000000000003 85-89 27.375 24.060000000000002 23.369999999999997 25.195 90-94 27.065 24.375 23.165 25.395 95-99 28.01 24.165 23.23 24.595 100-104 27.58 24.915000000000003 22.345000000000002 25.16 105-109 28.155 24.25 22.919999999999998 24.675 110-114 28.189999999999998 24.529999999999998 23.044999999999998 24.235 115-119 28.215 25.15 22.52 24.115000000000002 120-124 29.04 23.98 22.869999999999997 24.11 125-129 28.87 25.095 22.495 23.54 130-134 29.599999999999998 25.39 22.165000000000003 22.845 135-139 29.125 25.21 22.84 22.825 140-144 29.189999999999998 25.650000000000002 22.56 22.6 145-149 29.054999999999996 26.045 22.720000000000002 22.18 150-151 29.9 26.275 21.987499999999997 21.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 1.5 29 2.5 30 3.5 31 3.5 32 7.0 33 13.0 34 14.0 35 21.5 36 33.0 37 38.5 38 57.0 39 80.0 40 87.5 41 103.0 42 129.0 43 138.0 44 130.0 45 136.5 46 157.0 47 157.5 48 151.5 49 154.0 50 142.0 51 136.0 52 129.5 53 119.5 54 112.5 55 106.0 56 106.5 57 103.0 58 109.0 59 115.5 60 108.0 61 99.0 62 98.0 63 93.0 64 79.5 65 79.0 66 95.0 67 90.5 68 80.5 69 74.5 70 61.5 71 55.5 72 44.0 73 31.5 74 25.0 75 22.0 76 21.5 77 14.5 78 8.0 79 5.0 80 3.0 81 3.5 82 3.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96097313735427 97.625 2 0.8362899138367968 1.6500000000000001 3 0.15205271160669032 0.44999999999999996 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025342118601115054 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.7250000000000001 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 1.1875 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.75 0.0 0.0 0.0 0.0 88-89 2.1500000000000004 0.0 0.0 0.0 0.0 90-91 2.55 0.0 0.0 0.0 0.0 92-93 2.9375 0.0 0.0 0.0 0.0 94-95 3.5875 0.0 0.0 0.0 0.0 96-97 3.9375 0.0 0.0 0.0 0.0 98-99 4.3625 0.0 0.0 0.0 0.0 100-101 4.9125 0.0 0.0 0.0 0.0 102-103 5.35 0.0 0.0 0.0 0.0 104-105 5.9875 0.0 0.0 0.0 0.0 106-107 6.6 0.0 0.0 0.0 0.0 108-109 7.35 0.0 0.0 0.0 0.0 110-111 8.1625 0.0 0.0 0.0 0.0 112-113 8.875 0.0 0.0 0.0 0.0 114-115 9.6375 0.0 0.0 0.0 0.0 116-117 10.425 0.0 0.0 0.0 0.0 118-119 11.275 0.0 0.0 0.0 0.0 120-121 11.9375 0.0 0.0 0.0 0.0 122-123 12.675 0.0 0.0 0.0 0.0 124-125 13.7125 0.0 0.0 0.0 0.0 126-127 14.525 0.0 0.0 0.0 0.0 128-129 15.3625 0.0 0.0 0.0 0.0 130-131 16.35 0.0 0.0 0.0 0.0 132-133 17.075000000000003 0.0 0.0 0.0 0.0 134-135 18.0625 0.0 0.0 0.0 0.0 136-137 18.95 0.0 0.0 0.0 0.0 138-139 19.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 140-144 >>END_MODULE Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957535 spots for SRR5578488.sra Written 957535 spots for SRR5578488.sra Read 957540 spots for SRR5578488.sra Written 957540 spots for SRR5578488.sra SRR ids: ['SRR5578488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0p2qz8u SRR5578488.sra spots: 19150705 blocks: [[1, 957535], [957536, 1915070], [1915071, 2872605], [2872606, 3830140], [3830141, 4787675], [4787676, 5745210], [5745211, 6702745], [6702746, 7660280], [7660281, 8617815], [8617816, 9575350], [9575351, 10532885], [10532886, 11490420], [11490421, 12447955], [12447956, 13405490], [13405491, 14363025], [14363026, 15320560], [15320561, 16278095], [16278096, 17235630], [17235631, 18193165], [18193166, 19150705]] SRR5578488 file size 6467845 SRR5578488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578488 SRR5578488_1.fastq SRR5578488_2.fastq Input file: SRR5578488_1.fastq Paired file: SRR5578488_2.fastq trimmed: SRR5578488-trimmed-pair1.fastq, SRR5578488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:34:21 2024 >> started Mon Dec 9 20:34:44 2024 >> done (22.312s) 19150705 read pairs processed; of these: 45461 ( 0.24%) short read pairs filtered out after trimming by size control 67330 ( 0.35%) empty read pairs filtered out after trimming by size control 19037914 (99.41%) read pairs available; of these: 11765759 (61.80%) trimmed read pairs available after processing 7272155 (38.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 16 0.00% 21 23 0.00% 22 18 0.00% 23 16 0.00% 24 27 0.00% 25 29 0.00% 26 28 0.00% 27 21 0.00% 28 35 0.00% 29 39 0.00% 30 41 0.00% 31 51 0.00% 32 41 0.00% 33 59 0.00% 34 55 0.00% 35 68 0.00% 36 77 0.00% 37 73 0.00% 38 100 0.00% 39 105 0.00% 40 121 0.00% 41 160 0.00% 42 179 0.00% 43 195 0.00% 44 228 0.00% 45 248 0.00% 46 307 0.00% 47 357 0.00% 48 443 0.00% 49 516 0.00% 50 575 0.00% 51 652 0.00% 52 777 0.00% 53 826 0.00% 54 957 0.01% 55 1049 0.01% 56 1142 0.01% 57 1402 0.01% 58 1613 0.01% 59 1893 0.01% 60 2159 0.01% 61 2491 0.01% 62 2930 0.02% 63 3378 0.02% 64 3550 0.02% 65 4137 0.02% 66 4791 0.03% 67 5804 0.03% 68 6684 0.04% 69 10632 0.06% 70 11404 0.06% 71 10171 0.05% 72 10599 0.06% 73 11665 0.06% 74 12570 0.07% 75 14257 0.07% 76 15076 0.08% 77 16285 0.09% 78 17935 0.09% 79 19759 0.10% 80 21910 0.12% 81 24121 0.13% 82 27255 0.14% 83 29342 0.15% 84 32824 0.17% 85 34731 0.18% 86 36308 0.19% 87 37899 0.20% 88 39824 0.21% 89 41513 0.22% 90 43891 0.23% 91 47093 0.25% 92 49809 0.26% 93 52270 0.27% 94 54555 0.29% 95 56786 0.30% 96 58119 0.31% 97 59805 0.31% 98 60502 0.32% 99 62093 0.33% 100 64467 0.34% 101 66879 0.35% 102 69825 0.37% 103 72167 0.38% 104 74092 0.39% 105 76219 0.40% 106 78208 0.41% 107 77854 0.41% 108 79000 0.41% 109 80498 0.42% 110 82181 0.43% 111 84350 0.44% 112 87354 0.46% 113 89165 0.47% 114 92101 0.48% 115 94458 0.50% 116 94827 0.50% 117 95536 0.50% 118 95221 0.50% 119 96191 0.51% 120 98208 0.52% 121 98465 0.52% 122 100517 0.53% 123 103510 0.54% 124 106349 0.56% 125 107643 0.57% 126 110120 0.58% 127 108865 0.57% 128 108558 0.57% 129 110515 0.58% 130 110863 0.58% 131 112466 0.59% 132 115333 0.61% 133 118557 0.62% 134 120700 0.63% 135 122507 0.64% 136 125062 0.66% 137 126640 0.67% 138 130321 0.68% 139 133797 0.70% 140 137302 0.72% 141 144708 0.76% 142 154158 0.81% 143 166026 0.87% 144 182642 0.96% 145 207004 1.09% 146 246292 1.29% 147 315357 1.66% 148 452175 2.38% 149 873647 4.59% 150 3895340 20.46% 151 7272155 38.20% 19037914 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=14 prefix-density=0.97 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=13.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=9 prefix-density=0.98 prefix-fanout=3.3 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=27.09 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATATCAAAGCG SRR5578488 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:35:33 Started mapping on | Dec 09 20:35:34 Finished on | Dec 09 20:39:17 Mapping speed, Million of reads per hour | 307.34 Number of input reads | 19037914 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 17291188 Uniquely mapped reads % | 90.83% Average mapped length | 280.51 Number of splices: Total | 15310064 Number of splices: Annotated (sjdb) | 14456849 Number of splices: GT/AG | 15111417 Number of splices: GC/AG | 179059 Number of splices: AT/AC | 6983 Number of splices: Non-canonical | 12605 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283645 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 56075 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 1.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1487434 1487434 1487434 N_multimapping 283645 283645 283645 N_noFeature 482214 16777320 626245 N_ambiguous 450451 2001 80832 UnstrandedReadsAssigned:16358523 PositiveStrandReadsAssigned:511867 NegativeStrandReadsAssigned:16584111 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=131 echo kmer=127 SRR5578488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578488-trimmed-pair1.fastq SRR5578488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,037,914 reads, 16,701,116 reads pseudoaligned [quant] estimated average fragment length: 210.947 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 SRR5578488.ke.tsv 35125 SRR5578488.se.tsv 88098 total ==> SRR5578488.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.29 6.11631 0.621776 PNS24247 1044 834.053 32.3296 2.86194 PNS24249 1928 1718.05 104.017 4.47015 PNS24246 1044 834.053 32.3296 2.86194 PNS24248 1044 834.053 32.3296 2.86194 PNS24244 1471 1261.05 52.8778 3.09596 PNS24243 293 120.94 0 0 KQK14069 1603 1393.05 3623.69 192.061 KQK14071 474 274.098 125.141 33.7091 ==> SRR5578488.se.tsv <== BRADI_1g14170v3 4009 BRADI_1g53295v3 33 BRADI_1g59795v3 404 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1818 BRADI_1g74790v3 154 BRADI_1g09890v3 8 BRADI_1g77505v3 393 BRADI_1g48960v3 0 SRR5578488 completed mapping pipeline successfully