Starting /dee2/code/volunteer_pipeline.sh SRR5578491 current disk space = 1521195069440 free memory = 1567918384 SRR5578491 SRAfilesize e617c99a224c8aa2227baa554b8f3225 SRR5578491.sra SRR5578491.sra file validated SRR5578491 is paired end SRR5578491 is conventional basespace SRR5578491 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0815 34.0 33.0 34.0 32.0 34.0 2 33.15825 34.0 33.0 34.0 32.0 34.0 3 33.22625 34.0 33.0 34.0 32.0 34.0 4 33.24025 34.0 33.0 34.0 33.0 34.0 5 33.37925 34.0 33.0 34.0 33.0 34.0 6 36.92225 38.0 37.0 38.0 35.0 38.0 7 37.271 38.0 38.0 38.0 36.0 38.0 8 37.43675 38.0 38.0 38.0 37.0 38.0 9 37.52225 38.0 38.0 38.0 38.0 38.0 10-14 37.4587 38.0 38.0 38.0 37.4 38.0 15-19 37.456199999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.44945 38.0 38.0 38.0 38.0 38.0 25-29 37.4721 38.0 38.0 38.0 37.8 38.0 30-34 37.403800000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.34735 38.0 38.0 38.0 37.0 38.0 40-44 37.2474 38.0 38.0 38.0 37.0 38.0 45-49 37.2952 38.0 38.0 38.0 37.0 38.0 50-54 37.20625 38.0 38.0 38.0 36.4 38.0 55-59 37.15245 38.0 38.0 38.0 36.2 38.0 60-64 37.107150000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.06575 38.0 38.0 38.0 36.0 38.0 70-74 36.99294999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.8326 38.0 38.0 38.0 35.2 38.0 80-84 36.68920000000001 38.0 38.0 38.0 34.8 38.0 85-89 36.5335 38.0 38.0 38.0 34.2 38.0 90-94 36.50485 38.0 38.0 38.0 34.0 38.0 95-99 36.41085 38.0 38.0 38.0 34.0 38.0 100-104 36.27825 38.0 38.0 38.0 34.0 38.0 105-109 36.09825 38.0 37.4 38.0 33.4 38.0 110-114 35.929050000000004 38.0 37.0 38.0 32.8 38.0 115-119 35.70125 38.0 36.6 38.0 32.2 38.0 120-124 35.41865 38.0 36.0 38.0 30.6 38.0 125-129 35.2351 38.0 36.0 38.0 30.6 38.0 130-134 34.945499999999996 38.0 35.0 38.0 28.0 38.0 135-139 34.6148 38.0 35.0 38.0 27.2 38.0 140-144 34.134499999999996 38.0 34.6 38.0 24.6 38.0 145-149 33.337300000000006 38.0 34.0 38.0 20.0 38.0 150-151 29.17725 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 0.0 16 1.0 17 4.0 18 6.0 19 12.0 20 7.0 21 8.0 22 7.0 23 5.0 24 9.0 25 9.0 26 16.0 27 15.0 28 31.0 29 33.0 30 48.0 31 37.0 32 62.0 33 89.0 34 147.0 35 297.0 36 787.0 37 2362.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.476364586053805 10.68164011491251 8.200574562548969 36.64142073648472 2 25.775 14.025000000000002 31.374999999999996 28.825 3 23.08654327163582 17.63381690845423 23.06153076538269 36.21810905452726 4 28.249999999999996 25.924999999999997 19.725 26.1 5 26.924999999999997 29.375 22.8 20.9 6 23.575 30.475 23.225 22.725 7 18.25 23.325000000000003 38.0 20.424999999999997 8 21.525 22.675 27.800000000000004 28.000000000000004 9 19.5 22.425 32.025 26.05 10-14 22.97 27.095000000000002 25.16 24.775 15-19 23.64 25.085 25.405 25.869999999999997 20-24 24.245 25.069999999999997 24.93 25.755 25-29 23.785 25.22 24.990000000000002 26.005 30-34 23.01 25.06 25.545 26.384999999999998 35-39 23.41 24.72 25.56 26.31 40-44 23.990000000000002 25.35 24.925 25.735000000000003 45-49 23.53 24.785 25.055 26.63 50-54 23.425 24.94 24.765 26.87 55-59 23.785 25.619999999999997 24.135 26.46 60-64 24.385 24.97 24.675 25.97 65-69 23.75 25.069999999999997 24.87 26.31 70-74 24.12 25.5 24.12 26.26 75-79 23.835 24.645 24.875 26.645000000000003 80-84 24.495 24.9 24.08 26.525 85-89 24.169999999999998 24.985 24.62 26.224999999999998 90-94 23.955000000000002 25.455 24.14 26.450000000000003 95-99 24.265 24.68 24.625 26.43 100-104 24.145 25.040000000000003 24.15 26.665 105-109 24.21 24.955 24.085 26.75 110-114 24.560000000000002 25.89 23.51 26.040000000000003 115-119 24.6 25.28 23.66 26.46 120-124 23.815 25.385 23.59 27.21 125-129 24.145 26.255 23.395 26.205000000000002 130-134 24.535 26.025 23.085 26.355 135-139 24.37 25.885 22.91 26.834999999999997 140-144 23.915 26.31 22.965 26.810000000000002 145-149 23.51 25.724999999999998 24.044999999999998 26.72 150-151 23.5125 25.55 23.8875 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 2.5 28 4.0 29 2.5 30 2.5 31 6.5 32 13.0 33 17.5 34 21.5 35 27.5 36 49.5 37 64.5 38 77.5 39 101.0 40 127.0 41 146.5 42 147.0 43 159.0 44 167.5 45 180.0 46 198.0 47 195.0 48 178.0 49 171.0 50 172.5 51 169.0 52 149.5 53 117.5 54 98.0 55 94.5 56 100.0 57 85.5 58 86.5 59 86.5 60 74.0 61 67.5 62 58.0 63 58.0 64 62.0 65 66.5 66 58.0 67 49.5 68 47.5 69 48.5 70 40.5 71 30.0 72 27.0 73 25.0 74 18.0 75 15.0 76 14.0 77 7.0 78 5.0 79 3.0 80 1.0 81 1.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85815782796244 97.39999999999999 2 0.9134737376300432 1.7999999999999998 3 0.20299416391778738 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025374270489723422 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAACATATCTCGTATGC 8 0.2 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5750000000000002 0.0 0.0 0.0 0.0 94-95 1.95 0.0 0.0 0.0 0.0 96-97 2.2125 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.025 0.0 0.0 0.0 0.0 102-103 3.45 0.0 0.0 0.0 0.0 104-105 4.0 0.0 0.0 0.0 0.0 106-107 4.6 0.0 0.0 0.0 0.0 108-109 5.1625 0.0 0.0 0.0 0.0 110-111 5.8875 0.0 0.0 0.0 0.0 112-113 6.5 0.0 0.0 0.0 0.0 114-115 7.0875 0.0 0.0 0.0 0.0 116-117 7.825 0.0 0.0 0.0 0.0 118-119 8.75 0.0 0.0 0.0 0.0 120-121 9.537500000000001 0.0 0.0 0.0 0.0 122-123 10.675 0.0 0.0 0.0 0.0 124-125 11.875 0.0 0.0 0.0 0.0 126-127 13.100000000000001 0.0 0.0 0.0 0.0 128-129 14.149999999999999 0.0 0.0 0.0 0.0 130-131 15.2 0.0 0.0 0.0 0.0 132-133 16.1875 0.0 0.0 0.0 0.0 134-135 17.299999999999997 0.0 0.0 0.0 0.0 136-137 18.3625 0.0 0.0 0.0 0.0 138-139 19.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578491 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578491_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87825 33.0 33.0 34.0 32.0 34.0 2 32.9515 33.0 33.0 34.0 32.0 34.0 3 32.94025 34.0 33.0 34.0 32.0 34.0 4 32.851 34.0 33.0 34.0 32.0 34.0 5 32.85375 34.0 33.0 34.0 32.0 34.0 6 36.96925 38.0 38.0 38.0 36.0 38.0 7 37.019 38.0 38.0 38.0 36.0 38.0 8 37.01575 38.0 38.0 38.0 36.0 38.0 9 36.942 38.0 38.0 38.0 36.0 38.0 10-14 36.99935000000001 38.0 38.0 38.0 36.4 38.0 15-19 36.924 38.0 38.0 38.0 36.0 38.0 20-24 36.90169999999999 38.0 38.0 38.0 36.2 38.0 25-29 36.875099999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.92065 38.0 38.0 38.0 36.8 38.0 35-39 36.96595 38.0 38.0 38.0 36.8 38.0 40-44 36.93135 38.0 38.0 38.0 37.0 38.0 45-49 36.85764999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.80195 38.0 38.0 38.0 36.0 38.0 55-59 36.7895 38.0 38.0 38.0 36.0 38.0 60-64 36.7385 38.0 38.0 38.0 35.8 38.0 65-69 36.672450000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.453500000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.45095 38.0 38.0 38.0 34.8 38.0 80-84 36.473 38.0 38.0 38.0 34.8 38.0 85-89 36.29925 38.0 38.0 38.0 34.0 38.0 90-94 36.1898 38.0 38.0 38.0 34.0 38.0 95-99 36.1078 38.0 38.0 38.0 34.0 38.0 100-104 35.8391 38.0 38.0 38.0 33.2 38.0 105-109 35.63525 38.0 37.6 38.0 32.4 38.0 110-114 35.6112 38.0 37.4 38.0 31.8 38.0 115-119 35.42125 38.0 37.0 38.0 31.2 38.0 120-124 35.102999999999994 38.0 36.0 38.0 29.6 38.0 125-129 34.73315 38.0 35.6 38.0 27.0 38.0 130-134 34.25355 38.0 34.4 38.0 25.0 38.0 135-139 33.6452 38.0 33.4 38.0 22.2 38.0 140-144 32.9334 38.0 33.0 38.0 16.6 38.0 145-149 31.26535 38.0 31.2 38.0 6.0 38.0 150-151 25.9955 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 3.0 5 2.0 6 0.0 7 2.0 8 0.0 9 2.0 10 2.0 11 5.0 12 3.0 13 7.0 14 0.0 15 5.0 16 6.0 17 12.0 18 8.0 19 5.0 20 5.0 21 8.0 22 4.0 23 15.0 24 12.0 25 20.0 26 23.0 27 22.0 28 29.0 29 40.0 30 50.0 31 56.0 32 82.0 33 105.0 34 172.0 35 298.0 36 718.0 37 2259.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 18.875 11.65 31.7 2 30.925000000000004 22.125 25.7 21.25 3 23.75 24.7 25.95 25.6 4 28.1 29.425 19.650000000000002 22.825 5 28.4 32.2 18.975 20.424999999999997 6 23.35 32.35 20.375 23.925 7 23.425 18.275 33.925 24.375 8 23.724999999999998 21.75 24.099999999999998 30.425 9 24.6 21.349999999999998 26.1 27.950000000000003 10-14 26.695 25.240000000000002 22.264999999999997 25.8 15-19 26.68 24.64 24.099999999999998 24.58 20-24 26.87 24.725 23.415 24.990000000000002 25-29 26.705000000000002 24.615000000000002 23.365 25.314999999999998 30-34 27.07 24.37 23.724999999999998 24.834999999999997 35-39 26.88 24.2 23.775 25.145 40-44 27.105 24.505 23.78 24.610000000000003 45-49 27.065 24.14 23.849999999999998 24.945 50-54 26.61 24.605 23.89 24.895 55-59 27.175 24.535 23.995 24.295 60-64 26.685 24.255 24.315 24.745 65-69 26.21 25.165 23.875 24.75 70-74 26.38 24.995 24.185000000000002 24.44 75-79 26.27 24.545 24.035 25.15 80-84 26.424999999999997 24.07 25.045 24.46 85-89 27.015 24.490000000000002 24.279999999999998 24.215 90-94 26.435 24.935 24.555 24.075 95-99 27.115000000000002 24.98 24.095 23.810000000000002 100-104 27.08 25.590000000000003 23.169999999999998 24.16 105-109 27.505000000000003 25.0 23.830000000000002 23.665 110-114 27.01 24.9 24.22 23.87 115-119 27.650000000000002 25.240000000000002 22.939999999999998 24.169999999999998 120-124 27.58 25.35 23.41 23.66 125-129 28.825 26.155 22.585 22.435 130-134 28.59 25.945 23.125 22.34 135-139 29.044999999999998 25.435000000000002 23.53 21.990000000000002 140-144 28.665000000000003 26.009999999999998 23.46 21.865000000000002 145-149 29.799999999999997 26.195 23.035 20.97 150-151 29.7375 26.237500000000004 23.525 20.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 1.5 29 1.0 30 2.5 31 3.5 32 6.0 33 9.5 34 12.0 35 22.5 36 39.0 37 48.0 38 64.5 39 86.5 40 106.0 41 142.5 42 163.0 43 152.5 44 152.5 45 169.0 46 173.5 47 168.5 48 163.0 49 155.0 50 148.5 51 130.0 52 121.5 53 129.5 54 124.0 55 118.5 56 109.5 57 102.5 58 105.0 59 104.0 60 96.0 61 97.5 62 94.5 63 72.5 64 64.5 65 61.5 66 59.5 67 65.0 68 68.5 69 62.5 70 51.0 71 39.5 72 32.0 73 27.5 74 21.0 75 15.0 76 9.5 77 6.5 78 6.0 79 5.0 80 1.5 81 0.5 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88438133874239 97.5 2 0.9888438133874239 1.95 3 0.07606490872210953 0.22499999999999998 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02535496957403651 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.4500000000000002 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.6 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.3375 0.0 0.0 0.0 0.0 104-105 3.875 0.0 0.0 0.0 0.0 106-107 4.512499999999999 0.0 0.0 0.0 0.0 108-109 5.0875 0.0 0.0 0.0 0.0 110-111 5.8125 0.0 0.0 0.0 0.0 112-113 6.45 0.0 0.0 0.0 0.0 114-115 7.0625 0.0 0.0 0.0 0.0 116-117 7.825 0.0 0.0 0.0 0.0 118-119 8.774999999999999 0.0 0.0 0.0 0.0 120-121 9.537500000000001 0.0 0.0 0.0 0.0 122-123 10.712499999999999 0.0 0.0 0.0 0.0 124-125 11.925 0.0 0.0 0.0 0.0 126-127 13.1 0.0 0.0 0.0 0.0 128-129 14.1625 0.0 0.0 0.0 0.0 130-131 15.125 0.0 0.0 0.0 0.0 132-133 16.1875 0.0 0.0 0.0 0.0 134-135 17.325000000000003 0.0 0.0 0.0 0.0 136-137 18.4125 0.0 0.0 0.0 0.0 138-139 19.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176700 spots for SRR5578491.sra Written 1176700 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra Read 1176683 spots for SRR5578491.sra Written 1176683 spots for SRR5578491.sra SRR ids: ['SRR5578491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hzox689w SRR5578491.sra spots: 23533677 blocks: [[1, 1176683], [1176684, 2353366], [2353367, 3530049], [3530050, 4706732], [4706733, 5883415], [5883416, 7060098], [7060099, 8236781], [8236782, 9413464], [9413465, 10590147], [10590148, 11766830], [11766831, 12943513], [12943514, 14120196], [14120197, 15296879], [15296880, 16473562], [16473563, 17650245], [17650246, 18826928], [18826929, 20003611], [20003612, 21180294], [21180295, 22356977], [22356978, 23533677]] SRR5578491 file size 7953090 SRR5578491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578491 SRR5578491_1.fastq SRR5578491_2.fastq Input file: SRR5578491_1.fastq Paired file: SRR5578491_2.fastq trimmed: SRR5578491-trimmed-pair1.fastq, SRR5578491-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:38:58 2024 >> started Mon Dec 9 20:39:25 2024 >> done (27.531s) 23533677 read pairs processed; of these: 31661 ( 0.13%) short read pairs filtered out after trimming by size control 50743 ( 0.22%) empty read pairs filtered out after trimming by size control 23451273 (99.65%) read pairs available; of these: 13707715 (58.45%) trimmed read pairs available after processing 9743558 (41.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 14 0.00% 20 17 0.00% 21 18 0.00% 22 15 0.00% 23 14 0.00% 24 13 0.00% 25 18 0.00% 26 21 0.00% 27 18 0.00% 28 28 0.00% 29 51 0.00% 30 33 0.00% 31 24 0.00% 32 43 0.00% 33 41 0.00% 34 43 0.00% 35 54 0.00% 36 42 0.00% 37 55 0.00% 38 78 0.00% 39 92 0.00% 40 90 0.00% 41 102 0.00% 42 113 0.00% 43 128 0.00% 44 145 0.00% 45 171 0.00% 46 192 0.00% 47 224 0.00% 48 244 0.00% 49 296 0.00% 50 364 0.00% 51 385 0.00% 52 434 0.00% 53 452 0.00% 54 549 0.00% 55 596 0.00% 56 628 0.00% 57 728 0.00% 58 867 0.00% 59 993 0.00% 60 1184 0.01% 61 1306 0.01% 62 1518 0.01% 63 1766 0.01% 64 2064 0.01% 65 2380 0.01% 66 2456 0.01% 67 2974 0.01% 68 3340 0.01% 69 4628 0.02% 70 5473 0.02% 71 5392 0.02% 72 5695 0.02% 73 6572 0.03% 74 7147 0.03% 75 7976 0.03% 76 9127 0.04% 77 9840 0.04% 78 11152 0.05% 79 12510 0.05% 80 13976 0.06% 81 15555 0.07% 82 17567 0.07% 83 19939 0.09% 84 23030 0.10% 85 25702 0.11% 86 27022 0.12% 87 29386 0.13% 88 31606 0.13% 89 33577 0.14% 90 35730 0.15% 91 38981 0.17% 92 41798 0.18% 93 44794 0.19% 94 47942 0.20% 95 50865 0.22% 96 53449 0.23% 97 56359 0.24% 98 57821 0.25% 99 61280 0.26% 100 63967 0.27% 101 67024 0.29% 102 70031 0.30% 103 72988 0.31% 104 76093 0.32% 105 79098 0.34% 106 82987 0.35% 107 85434 0.36% 108 87836 0.37% 109 89860 0.38% 110 91509 0.39% 111 94543 0.40% 112 98304 0.42% 113 100902 0.43% 114 105049 0.45% 115 109027 0.46% 116 110800 0.47% 117 112181 0.48% 118 114115 0.49% 119 114470 0.49% 120 117073 0.50% 121 120005 0.51% 122 122234 0.52% 123 124744 0.53% 124 128030 0.55% 125 130457 0.56% 126 134332 0.57% 127 135089 0.58% 128 136065 0.58% 129 139448 0.59% 130 139869 0.60% 131 141539 0.60% 132 144997 0.62% 133 148193 0.63% 134 150395 0.64% 135 154035 0.66% 136 157865 0.67% 137 160168 0.68% 138 163927 0.70% 139 170808 0.73% 140 175972 0.75% 141 183068 0.78% 142 194363 0.83% 143 204939 0.87% 144 226382 0.97% 145 253041 1.08% 146 295891 1.26% 147 374562 1.60% 148 531703 2.27% 149 1005589 4.29% 150 4777392 20.37% 151 9743558 41.55% 23451273 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=24 prefix-density=0.55 prefix-fanout=2.1 sequence=CCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=29.06 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=12 prefix-density=0.63 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=19 fanout-score=75.37 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=16.6 sequence=CAAGAAGAAGGT SRR5578491 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:40:18 Started mapping on | Dec 09 20:40:19 Finished on | Dec 09 20:45:00 Mapping speed, Million of reads per hour | 300.44 Number of input reads | 23451273 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 21465814 Uniquely mapped reads % | 91.53% Average mapped length | 284.17 Number of splices: Total | 20199479 Number of splices: Annotated (sjdb) | 18988082 Number of splices: GT/AG | 19934230 Number of splices: GC/AG | 241303 Number of splices: AT/AC | 10465 Number of splices: Non-canonical | 13481 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381352 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 74088 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 1.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1622555 1622555 1622555 N_multimapping 381352 381352 381352 N_noFeature 662771 20821523 838618 N_ambiguous 542545 2561 74602 UnstrandedReadsAssigned:20260498 PositiveStrandReadsAssigned:641730 NegativeStrandReadsAssigned:20552594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR5578491 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578491-trimmed-pair1.fastq SRR5578491-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,451,273 reads, 20,704,917 reads pseudoaligned [quant] estimated average fragment length: 212.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR5578491.ke.tsv 35125 SRR5578491.se.tsv 88098 total ==> SRR5578491.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.52 17.5414 1.5207 PNS24247 1044 832.21 44.2458 3.3394 PNS24249 1928 1716.21 105.901 3.87578 PNS24246 1044 832.21 44.2458 3.3394 PNS24248 1044 832.21 44.2458 3.3394 PNS24244 1471 1259.21 182.82 9.11919 PNS24243 293 117.283 0 0 KQK14069 1603 1391.21 2671.12 120.595 KQK14071 474 272.131 58.8557 13.5844 ==> SRR5578491.se.tsv <== BRADI_1g14170v3 2916 BRADI_1g53295v3 82 BRADI_1g59795v3 494 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 2687 BRADI_1g74790v3 264 BRADI_1g09890v3 1 BRADI_1g77505v3 398 BRADI_1g48960v3 0 SRR5578491 completed mapping pipeline successfully