Starting /dee2/code/volunteer_pipeline.sh SRR5578493 current disk space = 1521134723072 free memory = 1567735040 SRR5578493 SRAfilesize b7131ea2ac11d6d974ba90702b9878cb SRR5578493.sra SRR5578493.sra file validated SRR5578493 is paired end SRR5578493 is conventional basespace SRR5578493 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48025 34.0 34.0 34.0 33.0 34.0 2 33.3805 34.0 34.0 34.0 33.0 34.0 3 33.43775 34.0 34.0 34.0 33.0 34.0 4 33.5605 34.0 34.0 34.0 33.0 34.0 5 33.53 34.0 34.0 34.0 33.0 34.0 6 37.27575 38.0 38.0 38.0 36.0 38.0 7 37.52275 38.0 38.0 38.0 37.0 38.0 8 37.6265 38.0 38.0 38.0 38.0 38.0 9 37.66275 38.0 38.0 38.0 38.0 38.0 10-14 37.6393 38.0 38.0 38.0 38.0 38.0 15-19 37.6609 38.0 38.0 38.0 38.0 38.0 20-24 37.64605 38.0 38.0 38.0 38.0 38.0 25-29 37.6277 38.0 38.0 38.0 38.0 38.0 30-34 37.5857 38.0 38.0 38.0 38.0 38.0 35-39 37.55645 38.0 38.0 38.0 38.0 38.0 40-44 37.4878 38.0 38.0 38.0 37.6 38.0 45-49 37.434 38.0 38.0 38.0 37.0 38.0 50-54 37.366049999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.3394 38.0 38.0 38.0 37.0 38.0 60-64 37.31585 38.0 38.0 38.0 36.8 38.0 65-69 37.2503 38.0 38.0 38.0 36.4 38.0 70-74 37.22214999999999 38.0 38.0 38.0 36.2 38.0 75-79 37.1601 38.0 38.0 38.0 36.2 38.0 80-84 37.1104 38.0 38.0 38.0 36.0 38.0 85-89 37.018649999999994 38.0 38.0 38.0 35.8 38.0 90-94 36.987849999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.865050000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.784 38.0 38.0 38.0 35.0 38.0 105-109 36.5909 38.0 38.0 38.0 34.2 38.0 110-114 36.38105 38.0 38.0 38.0 34.0 38.0 115-119 36.18835 38.0 37.6 38.0 33.4 38.0 120-124 36.01005 38.0 36.8 38.0 33.0 38.0 125-129 35.811099999999996 38.0 36.4 38.0 32.2 38.0 130-134 35.688550000000006 38.0 36.0 38.0 31.4 38.0 135-139 35.364 38.0 35.8 38.0 30.6 38.0 140-144 35.00705000000001 38.0 35.4 38.0 28.8 38.0 145-149 34.2713 38.0 35.0 38.0 26.8 38.0 150-151 29.897125000000003 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 4.0 19 3.0 20 4.0 21 2.0 22 5.0 23 5.0 24 4.0 25 8.0 26 7.0 27 12.0 28 14.0 29 27.0 30 30.0 31 28.0 32 59.0 33 66.0 34 133.0 35 219.0 36 694.0 37 2667.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.63867288750648 10.134784862623121 8.631415241057542 38.59512700881286 2 24.4 14.825 33.125 27.650000000000002 3 23.275000000000002 20.45 24.025 32.25 4 27.875 27.375 19.6 25.15 5 26.897069872276486 30.65364387678437 22.514400200350615 19.93488605058853 6 22.975 32.025 23.575 21.425 7 18.375 22.15 39.25 20.225 8 22.0 21.675 28.4 27.925 9 21.175 21.05 30.95 26.825 10-14 23.845 26.235000000000003 24.435000000000002 25.485000000000003 15-19 24.245 25.005 25.435000000000002 25.314999999999998 20-24 23.76 25.165 25.19 25.885 25-29 23.810000000000002 24.945 25.115 26.13 30-34 23.59 25.385 24.85 26.174999999999997 35-39 23.685000000000002 25.195 24.88 26.240000000000002 40-44 24.36 24.67 24.955 26.015 45-49 24.25 25.535000000000004 24.43 25.785000000000004 50-54 24.505 25.074999999999996 24.81 25.61 55-59 24.740000000000002 25.005 24.58 25.674999999999997 60-64 24.325 24.68 24.635 26.36 65-69 24.25 24.625 25.155 25.97 70-74 24.85 24.575 24.82 25.755 75-79 24.63 24.48 24.905 25.985000000000003 80-84 24.55 24.52 24.875 26.055 85-89 24.19 24.82 24.84 26.150000000000002 90-94 25.465 24.565 24.235 25.735000000000003 95-99 24.57 24.595 24.595 26.240000000000002 100-104 24.905 24.765 24.09 26.240000000000002 105-109 24.68 25.040000000000003 24.14 26.14 110-114 24.675 24.715 24.474999999999998 26.135 115-119 24.97 25.03 24.135 25.865 120-124 25.259999999999998 24.325 23.695 26.72 125-129 24.715 25.525 23.77 25.990000000000002 130-134 25.424999999999997 24.85 24.05 25.674999999999997 135-139 25.5 25.05 23.380000000000003 26.07 140-144 24.834999999999997 25.605 23.825 25.735000000000003 145-149 24.19 25.674999999999997 23.810000000000002 26.325 150-151 23.46312758232127 24.802804557405782 24.327031426067357 27.407036434205583 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 1.5 29 5.0 30 10.0 31 10.0 32 14.0 33 27.0 34 32.0 35 38.0 36 55.5 37 71.0 38 84.0 39 94.5 40 118.0 41 147.0 42 168.5 43 170.0 44 166.5 45 176.5 46 179.5 47 172.5 48 154.5 49 149.0 50 138.0 51 122.5 52 120.5 53 109.0 54 97.0 55 92.5 56 94.0 57 94.5 58 92.0 59 93.0 60 94.0 61 97.0 62 81.5 63 63.0 64 67.0 65 66.0 66 63.0 67 65.5 68 64.0 69 51.5 70 45.5 71 37.5 72 24.0 73 21.5 74 17.0 75 13.0 76 9.0 77 5.5 78 5.5 79 3.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.55 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.6562342251388188 1.3 3 0.1514386673397274 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.9750000000000001 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.325 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 2.85 0.0 0.0 0.0 0.0 104-105 3.2874999999999996 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.225 0.0 0.0 0.0 0.0 110-111 4.800000000000001 0.0 0.0 0.0 0.0 112-113 5.5 0.0 0.0 0.0 0.0 114-115 6.050000000000001 0.0 0.0 0.0 0.0 116-117 6.7375 0.0 0.0 0.0 0.0 118-119 7.449999999999999 0.0 0.0 0.0 0.0 120-121 8.35 0.0 0.0 0.0 0.0 122-123 9.162500000000001 0.0 0.0 0.0 0.0 124-125 9.8875 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 11.7 0.0 0.0 0.0 0.0 130-131 12.6375 0.0 0.0 0.0 0.0 132-133 13.475 0.0 0.0 0.0 0.0 134-135 14.6125 0.0 0.0 0.0 0.0 136-137 15.575 0.0 0.0 0.0 0.0 138-139 16.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCCGT 10 0.006346246 148.5641 145 CCGAGGA 10 0.006346246 148.5641 3 CGTAAGT 10 0.006346246 148.5641 1 >>END_MODULE SRR5578493 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578493_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04225 33.0 33.0 34.0 32.0 34.0 2 33.199 34.0 33.0 34.0 33.0 34.0 3 33.191 34.0 33.0 34.0 33.0 34.0 4 33.11975 34.0 33.0 34.0 33.0 34.0 5 33.123 34.0 33.0 34.0 33.0 34.0 6 37.33025 38.0 38.0 38.0 38.0 38.0 7 37.44275 38.0 38.0 38.0 38.0 38.0 8 37.40075 38.0 38.0 38.0 38.0 38.0 9 37.3885 38.0 38.0 38.0 38.0 38.0 10-14 37.394999999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.350049999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.3629 38.0 38.0 38.0 38.0 38.0 25-29 37.3574 38.0 38.0 38.0 37.8 38.0 30-34 37.40425 38.0 38.0 38.0 37.8 38.0 35-39 37.3946 38.0 38.0 38.0 37.6 38.0 40-44 37.399350000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.38435 38.0 38.0 38.0 38.0 38.0 50-54 37.339 38.0 38.0 38.0 37.8 38.0 55-59 37.270799999999994 38.0 38.0 38.0 37.4 38.0 60-64 37.233450000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.14315 38.0 38.0 38.0 37.0 38.0 70-74 37.0798 38.0 38.0 38.0 37.0 38.0 75-79 37.003949999999996 38.0 38.0 38.0 36.2 38.0 80-84 36.9925 38.0 38.0 38.0 36.0 38.0 85-89 36.86775 38.0 38.0 38.0 36.0 38.0 90-94 36.8299 38.0 38.0 38.0 35.8 38.0 95-99 36.68275 38.0 38.0 38.0 35.0 38.0 100-104 36.57365 38.0 38.0 38.0 35.0 38.0 105-109 36.3965 38.0 38.0 38.0 34.0 38.0 110-114 36.22025 38.0 38.0 38.0 34.0 38.0 115-119 36.02265 38.0 38.0 38.0 33.8 38.0 120-124 35.78265 38.0 37.8 38.0 32.6 38.0 125-129 35.55285 38.0 36.8 38.0 32.2 38.0 130-134 35.2248 38.0 36.0 38.0 31.0 38.0 135-139 34.509750000000004 38.0 35.4 38.0 26.2 38.0 140-144 33.93345000000001 38.0 33.8 38.0 23.8 38.0 145-149 32.59355 38.0 33.0 38.0 12.8 38.0 150-151 27.17125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 4.0 13 2.0 14 3.0 15 3.0 16 3.0 17 5.0 18 7.0 19 4.0 20 6.0 21 7.0 22 11.0 23 11.0 24 10.0 25 13.0 26 19.0 27 16.0 28 26.0 29 24.0 30 26.0 31 42.0 32 61.0 33 84.0 34 126.0 35 236.0 36 569.0 37 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.16024036054081 16.72508763144717 10.640961442163245 32.473710565848776 2 29.054054054054053 22.52252252252252 27.427427427427425 20.995995995995994 3 22.55883825738608 24.41161742613921 26.84026039058588 26.189283925888834 4 26.86529794692038 30.345518277416122 19.053580370555835 23.73560340510766 5 27.427427427427425 32.75775775775776 18.543543543543546 21.27127127127127 6 23.525 33.650000000000006 20.225 22.6 7 23.150000000000002 17.349999999999998 34.849999999999994 24.65 8 22.75 22.95 24.65 29.65 9 24.05 21.8 25.624999999999996 28.525 10-14 26.39 25.355 22.400000000000002 25.855 15-19 26.025 24.23 23.915 25.83 20-24 26.015 24.88 23.61 25.495 25-29 25.635 24.825 23.835 25.705 30-34 25.845000000000002 25.130000000000003 23.7 25.324999999999996 35-39 26.01130056502825 24.8162408120406 23.77618880944047 25.396269813490672 40-44 26.33 24.085 24.195 25.39 45-49 25.995 24.685000000000002 23.990000000000002 25.330000000000002 50-54 25.724999999999998 24.855 23.54 25.88 55-59 26.705000000000002 24.060000000000002 23.925 25.31 60-64 26.17761776177618 23.85238523852385 24.412441244124413 25.557555755575557 65-69 26.043906585987898 24.5636845526829 24.398659798969845 24.993749062359356 70-74 26.04520904180836 24.13982796559312 24.084816963392676 25.73014602920584 75-79 26.025410164065626 24.469787915166066 24.264705882352942 25.240096038415366 80-84 26.543981597239586 24.933740061009154 23.933590038505777 24.588688303245487 85-89 26.76 24.675 23.735 24.83 90-94 26.314999999999998 24.825 23.905 24.955 95-99 26.595000000000002 25.0 23.95 24.455 100-104 27.189999999999998 24.815 23.65 24.345 105-109 26.8 24.92 23.435 24.845 110-114 27.051762940735184 25.291322830707674 23.25581395348837 24.401100275068767 115-119 26.924999999999997 25.405 24.04 23.630000000000003 120-124 27.155 25.81 23.169999999999998 23.865 125-129 27.9813990699535 24.65623281164058 23.826191309565477 23.53617680884044 130-134 28.241412070603527 25.726286314315715 23.62618130906545 22.4061203060153 135-139 28.105000000000004 25.585 23.580000000000002 22.73 140-144 28.035 26.240000000000002 23.145 22.58 145-149 28.435 26.590000000000003 22.884999999999998 22.09 150-151 30.112499999999997 25.887500000000003 22.2 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 3.5 27 4.0 28 2.5 29 4.0 30 6.5 31 10.5 32 14.0 33 17.5 34 24.5 35 32.5 36 45.0 37 56.5 38 71.5 39 100.5 40 115.5 41 123.5 42 129.0 43 143.0 44 177.0 45 177.0 46 154.5 47 154.5 48 150.0 49 139.0 50 131.5 51 126.5 52 125.5 53 117.0 54 105.0 55 99.0 56 94.0 57 85.5 58 98.0 59 103.5 60 88.0 61 88.0 62 99.5 63 92.0 64 84.5 65 86.0 66 75.0 67 73.0 68 73.5 69 59.0 70 50.5 71 47.5 72 44.0 73 33.0 74 19.0 75 13.5 76 12.5 77 9.0 78 2.0 79 2.5 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.15 4 0.15 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.015 70-74 0.02 75-79 0.04 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80801420238397 97.39999999999999 2 1.0144559979710879 2.0 3 0.10144559979710879 0.3 4 0.0760841998478316 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 1.05 0.0 0.0 0.0 0.0 90-91 1.3375 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.75 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.425 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 2.95 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.8 0.0 0.0 0.0 0.0 108-109 4.35 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.675 0.0 0.0 0.0 0.0 114-115 6.2125 0.0 0.0 0.0 0.0 116-117 6.8875 0.0 0.0 0.0 0.0 118-119 7.574999999999999 0.0 0.0 0.0 0.0 120-121 8.475 0.0 0.0 0.0 0.0 122-123 9.3 0.0 0.0 0.0 0.0 124-125 10.0625 0.0 0.0 0.0 0.0 126-127 11.05 0.0 0.0 0.0 0.0 128-129 11.8875 0.0 0.0 0.0 0.0 130-131 12.7625 0.0 0.0 0.0 0.0 132-133 13.65 0.0 0.0 0.0 0.0 134-135 14.8125 0.0 0.0 0.0 0.0 136-137 15.8125 0.0 0.0 0.0 0.0 138-139 16.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGTAT 10 0.006830828 145.0 145 >>END_MODULE Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874213 spots for SRR5578493.sra Written 874213 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra Read 874211 spots for SRR5578493.sra Written 874211 spots for SRR5578493.sra SRR ids: ['SRR5578493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cw32gx53 SRR5578493.sra spots: 17484222 blocks: [[1, 874211], [874212, 1748422], [1748423, 2622633], [2622634, 3496844], [3496845, 4371055], [4371056, 5245266], [5245267, 6119477], [6119478, 6993688], [6993689, 7867899], [7867900, 8742110], [8742111, 9616321], [9616322, 10490532], [10490533, 11364743], [11364744, 12238954], [12238955, 13113165], [13113166, 13987376], [13987377, 14861587], [14861588, 15735798], [15735799, 16610009], [16610010, 17484222]] SRR5578493 file size 5903128 SRR5578493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578493 SRR5578493_1.fastq SRR5578493_2.fastq Input file: SRR5578493_1.fastq Paired file: SRR5578493_2.fastq trimmed: SRR5578493-trimmed-pair1.fastq, SRR5578493-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:43:46 2024 >> started Mon Dec 9 20:44:56 2024 >> done (70.223s) 17484222 read pairs processed; of these: 14232 ( 0.08%) short read pairs filtered out after trimming by size control 17954 ( 0.10%) empty read pairs filtered out after trimming by size control 17452036 (99.82%) read pairs available; of these: 9472057 (54.27%) trimmed read pairs available after processing 7979979 (45.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 5 0.00% 21 17 0.00% 22 13 0.00% 23 11 0.00% 24 19 0.00% 25 11 0.00% 26 14 0.00% 27 19 0.00% 28 18 0.00% 29 25 0.00% 30 35 0.00% 31 27 0.00% 32 28 0.00% 33 32 0.00% 34 35 0.00% 35 29 0.00% 36 41 0.00% 37 46 0.00% 38 40 0.00% 39 63 0.00% 40 69 0.00% 41 82 0.00% 42 90 0.00% 43 80 0.00% 44 81 0.00% 45 108 0.00% 46 129 0.00% 47 142 0.00% 48 158 0.00% 49 168 0.00% 50 187 0.00% 51 258 0.00% 52 250 0.00% 53 315 0.00% 54 355 0.00% 55 375 0.00% 56 419 0.00% 57 470 0.00% 58 554 0.00% 59 641 0.00% 60 737 0.00% 61 908 0.01% 62 1009 0.01% 63 1085 0.01% 64 1254 0.01% 65 1396 0.01% 66 1642 0.01% 67 1837 0.01% 68 2138 0.01% 69 2653 0.02% 70 3019 0.02% 71 3303 0.02% 72 3599 0.02% 73 4088 0.02% 74 4422 0.03% 75 4992 0.03% 76 5539 0.03% 77 6214 0.04% 78 6834 0.04% 79 7683 0.04% 80 8781 0.05% 81 9713 0.06% 82 10910 0.06% 83 12055 0.07% 84 13840 0.08% 85 15166 0.09% 86 15969 0.09% 87 17308 0.10% 88 18732 0.11% 89 19839 0.11% 90 21223 0.12% 91 22998 0.13% 92 24644 0.14% 93 26630 0.15% 94 28504 0.16% 95 29652 0.17% 96 31235 0.18% 97 33260 0.19% 98 34034 0.20% 99 35870 0.21% 100 37454 0.21% 101 39503 0.23% 102 41553 0.24% 103 43470 0.25% 104 45619 0.26% 105 47144 0.27% 106 49763 0.29% 107 50221 0.29% 108 51137 0.29% 109 53350 0.31% 110 54606 0.31% 111 57125 0.33% 112 59642 0.34% 113 60921 0.35% 114 63319 0.36% 115 66088 0.38% 116 67449 0.39% 117 68276 0.39% 118 68718 0.39% 119 70119 0.40% 120 71923 0.41% 121 73440 0.42% 122 75036 0.43% 123 77377 0.44% 124 80136 0.46% 125 82482 0.47% 126 83865 0.48% 127 84794 0.49% 128 85941 0.49% 129 87877 0.50% 130 89231 0.51% 131 90294 0.52% 132 93522 0.54% 133 95973 0.55% 134 97997 0.56% 135 100228 0.57% 136 103421 0.59% 137 104956 0.60% 138 106818 0.61% 139 111979 0.64% 140 115463 0.66% 141 121566 0.70% 142 130045 0.75% 143 138620 0.79% 144 152166 0.87% 145 170515 0.98% 146 199651 1.14% 147 253876 1.45% 148 363632 2.08% 149 709246 4.06% 150 3724320 21.34% 151 7979979 45.73% 17452036 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=14 prefix-density=1.05 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.20 sequence-density-rank=30 fanout-score=23.48 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=8.9 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=12 prefix-density=0.81 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=48.32 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578493 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:46:00 Started mapping on | Dec 09 20:46:00 Finished on | Dec 09 20:49:31 Mapping speed, Million of reads per hour | 297.76 Number of input reads | 17452036 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 16209670 Uniquely mapped reads % | 92.88% Average mapped length | 287.11 Number of splices: Total | 16100655 Number of splices: Annotated (sjdb) | 15241414 Number of splices: GT/AG | 15891713 Number of splices: GC/AG | 189350 Number of splices: AT/AC | 7131 Number of splices: Non-canonical | 12461 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230921 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 39290 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1021317 1021317 1021317 N_multimapping 230921 230921 230921 N_noFeature 581462 15740460 725236 N_ambiguous 380669 1861 55600 UnstrandedReadsAssigned:15247539 PositiveStrandReadsAssigned:467349 NegativeStrandReadsAssigned:15428834 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5578493 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578493-trimmed-pair1.fastq SRR5578493-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,452,036 reads, 15,496,375 reads pseudoaligned [quant] estimated average fragment length: 222.942 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR5578493.ke.tsv 35125 SRR5578493.se.tsv 88098 total ==> SRR5578493.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.379 0 0 PNS24247 1044 822.058 28.8649 3.1642 PNS24249 1928 1706.06 31.2483 1.65055 PNS24246 1044 822.058 28.8649 3.1642 PNS24248 1044 822.058 28.8649 3.1642 PNS24244 1471 1249.06 56.1569 4.0515 PNS24243 293 113.496 0 0 KQK14069 1603 1381.06 388.013 25.318 KQK14071 474 265.171 15.3855 5.22856 ==> SRR5578493.se.tsv <== BRADI_1g14170v3 469 BRADI_1g53295v3 48 BRADI_1g59795v3 463 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 2128 BRADI_1g74790v3 44 BRADI_1g09890v3 6 BRADI_1g77505v3 220 BRADI_1g48960v3 0 SRR5578493 completed mapping pipeline successfully