Starting /dee2/code/volunteer_pipeline.sh SRR5578494 current disk space = 1521200615424 free memory = 1584542788 SRR5578494 SRAfilesize 03ae09bca3ffb929911757528652db9b SRR5578494.sra SRR5578494.sra file validated SRR5578494 is paired end SRR5578494 is conventional basespace SRR5578494 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.902 34.0 34.0 34.0 33.0 34.0 2 33.4935 34.0 34.0 34.0 33.0 34.0 3 33.54475 34.0 34.0 34.0 33.0 34.0 4 33.61675 34.0 34.0 34.0 33.0 34.0 5 33.607 34.0 34.0 34.0 33.0 34.0 6 37.318 38.0 38.0 38.0 36.0 38.0 7 37.4715 38.0 38.0 38.0 37.0 38.0 8 37.5905 38.0 38.0 38.0 38.0 38.0 9 37.64 38.0 38.0 38.0 38.0 38.0 10-14 37.6579 38.0 38.0 38.0 38.0 38.0 15-19 37.654199999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6499 38.0 38.0 38.0 38.0 38.0 25-29 37.627500000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.616249999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.5584 38.0 38.0 38.0 38.0 38.0 40-44 37.5293 38.0 38.0 38.0 38.0 38.0 45-49 37.48694999999999 38.0 38.0 38.0 37.8 38.0 50-54 37.459450000000004 38.0 38.0 38.0 37.4 38.0 55-59 37.4362 38.0 38.0 38.0 37.0 38.0 60-64 37.43195 38.0 38.0 38.0 37.0 38.0 65-69 37.317099999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.28485 38.0 38.0 38.0 37.0 38.0 75-79 37.25705 38.0 38.0 38.0 36.8 38.0 80-84 37.2139 38.0 38.0 38.0 36.2 38.0 85-89 37.098699999999994 38.0 38.0 38.0 36.0 38.0 90-94 37.0307 38.0 38.0 38.0 36.0 38.0 95-99 36.955650000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.85485 38.0 38.0 38.0 35.0 38.0 105-109 36.694849999999995 38.0 38.0 38.0 34.6 38.0 110-114 36.61579999999999 38.0 38.0 38.0 34.4 38.0 115-119 36.38035 38.0 38.0 38.0 33.8 38.0 120-124 36.3679 38.0 38.0 38.0 34.0 38.0 125-129 36.128600000000006 38.0 37.4 38.0 33.4 38.0 130-134 35.8158 38.0 36.4 38.0 32.8 38.0 135-139 35.571149999999996 38.0 36.0 38.0 31.8 38.0 140-144 35.105450000000005 38.0 35.4 38.0 29.6 38.0 145-149 34.582800000000006 38.0 35.0 38.0 28.2 38.0 150-151 30.930500000000002 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 1.0 18 2.0 19 4.0 20 1.0 21 2.0 22 3.0 23 7.0 24 0.0 25 8.0 26 13.0 27 18.0 28 19.0 29 27.0 30 27.0 31 42.0 32 41.0 33 53.0 34 103.0 35 178.0 36 612.0 37 2836.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.38154868387427 11.551239458216202 11.83235369281881 37.23485816509072 2 25.724999999999998 14.95 31.75 27.575 3 22.83070767691923 19.529882470617654 22.780695173793447 34.858714678669664 4 27.3 26.974999999999998 20.325 25.4 5 26.375 30.975 23.025000000000002 19.625 6 21.0 32.800000000000004 24.099999999999998 22.1 7 18.35 21.925 40.025 19.7 8 20.849999999999998 23.400000000000002 28.1 27.650000000000002 9 18.7 22.35 32.65 26.3 10-14 23.11 26.21 25.34 25.34 15-19 22.8 26.064999999999998 25.36 25.775 20-24 23.73 25.515 25.430000000000003 25.324999999999996 25-29 22.575 25.645 25.775 26.005 30-34 23.46852027804171 25.73386007901185 25.73386007901185 25.06375956393459 35-39 23.983597539630942 25.38380757113567 25.348802320348053 25.28379256888533 40-44 23.400850212553138 25.516379094773693 25.256314078519633 25.826456614153535 45-49 23.486174308715434 25.496274813740687 25.391269563478176 25.6262813140657 50-54 23.575 25.09 25.495 25.840000000000003 55-59 23.835 26.1 24.67 25.395 60-64 23.44 25.64 24.665 26.255 65-69 23.5 25.525 25.069999999999997 25.905 70-74 23.990000000000002 25.15 24.935 25.924999999999997 75-79 23.815 25.405 25.180000000000003 25.6 80-84 23.905 25.014999999999997 25.1 25.979999999999997 85-89 24.035 24.69 25.34 25.935000000000002 90-94 23.976198809940495 24.321216060803042 25.28626431321566 26.416320816040802 95-99 24.275 25.27 25.215 25.240000000000002 100-104 24.92 24.975 24.775 25.330000000000002 105-109 24.575 24.995 24.54 25.89 110-114 24.485 25.27 24.79 25.455 115-119 24.29 24.915000000000003 24.535 26.26 120-124 24.3498699739948 25.38507701540308 24.08981796359272 26.175235047009405 125-129 24.306076519129782 25.43635908977244 24.901225306326584 25.35633908477119 130-134 24.88122030507627 25.111277819454862 24.14603650912728 25.861465366341584 135-139 24.274854970994202 25.595119023804763 24.1498299659932 25.980196039207843 140-144 24.436221811090554 25.146257312865643 24.57122856142807 25.84629231461573 145-149 24.601230061503074 25.616280814040703 23.891194559727985 25.891294564728234 150-151 23.95898461923221 25.409528573214956 23.971489308490685 26.65999749906215 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.5 28 3.5 29 7.0 30 11.0 31 21.0 32 23.0 33 20.0 34 34.5 35 46.0 36 60.5 37 82.5 38 92.0 39 99.5 40 123.5 41 149.5 42 164.5 43 172.0 44 179.5 45 190.5 46 188.5 47 186.5 48 165.0 49 147.0 50 149.0 51 141.0 52 136.0 53 130.0 54 104.0 55 85.0 56 87.0 57 85.0 58 83.0 59 82.5 60 70.0 61 61.5 62 69.5 63 66.5 64 72.5 65 67.5 66 61.0 67 59.5 68 38.0 69 30.5 70 30.0 71 28.0 72 21.5 73 16.5 74 16.0 75 11.0 76 5.5 77 5.0 78 7.0 79 5.5 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.015 40-44 0.025 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.025 130-134 0.025 135-139 0.02 140-144 0.005 145-149 0.005 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16750756811302 98.275 2 0.7820383451059535 1.55 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 3.0374999999999996 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.2625 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 5.987500000000001 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.8625 0.0 0.0 0.0 0.0 134-135 9.337499999999999 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGTCG 10 0.006836113 144.9625 3 CTGTCGA 10 0.006836113 144.9625 4 >>END_MODULE SRR5578494 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578494_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03 33.0 33.0 34.0 32.0 34.0 2 33.1575 34.0 33.0 34.0 33.0 34.0 3 33.148 34.0 33.0 34.0 33.0 34.0 4 33.07925 34.0 33.0 34.0 33.0 34.0 5 33.08125 34.0 33.0 34.0 33.0 34.0 6 37.243 38.0 38.0 38.0 37.0 38.0 7 37.25575 38.0 38.0 38.0 38.0 38.0 8 37.34575 38.0 38.0 38.0 37.0 38.0 9 37.25025 38.0 38.0 38.0 37.0 38.0 10-14 37.2792 38.0 38.0 38.0 37.0 38.0 15-19 37.23515 38.0 38.0 38.0 37.0 38.0 20-24 37.2175 38.0 38.0 38.0 37.0 38.0 25-29 37.1694 38.0 38.0 38.0 37.0 38.0 30-34 37.1654 38.0 38.0 38.0 37.0 38.0 35-39 37.1585 38.0 38.0 38.0 37.0 38.0 40-44 37.1597 38.0 38.0 38.0 37.0 38.0 45-49 37.059599999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.06035000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.038599999999995 38.0 38.0 38.0 36.8 38.0 60-64 36.90665 38.0 38.0 38.0 36.0 38.0 65-69 36.861999999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.73135 38.0 38.0 38.0 35.4 38.0 75-79 36.71155 38.0 38.0 38.0 35.2 38.0 80-84 36.6263 38.0 38.0 38.0 34.8 38.0 85-89 36.5279 38.0 38.0 38.0 34.8 38.0 90-94 36.4915 38.0 38.0 38.0 34.4 38.0 95-99 36.2424 38.0 38.0 38.0 34.0 38.0 100-104 36.0847 38.0 38.0 38.0 34.0 38.0 105-109 35.874399999999994 38.0 38.0 38.0 33.0 38.0 110-114 35.589150000000004 38.0 37.6 38.0 31.8 38.0 115-119 35.27015 38.0 36.4 38.0 30.2 38.0 120-124 35.0925 38.0 36.0 38.0 29.0 38.0 125-129 34.725300000000004 38.0 35.6 38.0 26.8 38.0 130-134 34.278499999999994 38.0 34.6 38.0 24.8 38.0 135-139 33.7793 38.0 33.2 38.0 22.6 38.0 140-144 32.95355 38.0 33.0 38.0 16.6 38.0 145-149 31.57255 38.0 31.8 38.0 8.0 38.0 150-151 26.180374999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 1.0 6 1.0 7 0.0 8 2.0 9 0.0 10 2.0 11 3.0 12 3.0 13 3.0 14 2.0 15 4.0 16 3.0 17 9.0 18 5.0 19 6.0 20 3.0 21 9.0 22 17.0 23 16.0 24 16.0 25 25.0 26 15.0 27 20.0 28 33.0 29 34.0 30 49.0 31 59.0 32 64.0 33 102.0 34 157.0 35 259.0 36 691.0 37 2374.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.425000000000004 16.85 13.55 32.175 2 28.675 23.425 26.400000000000002 21.5 3 23.599999999999998 26.125 25.5 24.775 4 27.35 30.575000000000003 19.275000000000002 22.8 5 27.0 32.45 19.925 20.625 6 22.75 34.075 21.275 21.9 7 22.85 17.95 34.449999999999996 24.75 8 23.474999999999998 22.575 23.35 30.599999999999998 9 23.5 22.725 26.275 27.500000000000004 10-14 25.874999999999996 26.445 22.61 25.069999999999997 15-19 26.26 25.445 23.755000000000003 24.54 20-24 25.874999999999996 25.635 23.985 24.505 25-29 26.68 24.375 23.974999999999998 24.97 30-34 25.290000000000003 25.77 24.47 24.47 35-39 25.96 24.295 24.740000000000002 25.005 40-44 26.5 25.09 23.580000000000002 24.83 45-49 25.865 24.72 24.4 25.014999999999997 50-54 26.345000000000002 24.79 24.465 24.4 55-59 26.06 24.705 24.585 24.65 60-64 25.77 24.945 24.335 24.95 65-69 26.015 25.19 24.575 24.22 70-74 25.564999999999998 25.064999999999998 24.635 24.735 75-79 25.974999999999998 24.81 24.755 24.46 80-84 26.279999999999998 24.725 24.435000000000002 24.560000000000002 85-89 25.985000000000003 24.635 24.785 24.595 90-94 26.525 24.425 24.58 24.47 95-99 26.045 25.215 24.645 24.095 100-104 26.5 25.105 24.495 23.9 105-109 25.8 25.465 24.385 24.349999999999998 110-114 26.43 26.075 23.635 23.86 115-119 27.38 25.355 24.185000000000002 23.080000000000002 120-124 26.900000000000002 25.71 24.48 22.91 125-129 27.235 25.845000000000002 23.72 23.200000000000003 130-134 26.974999999999998 25.665 24.38 22.98 135-139 27.105 25.695 24.169999999999998 23.03 140-144 27.584999999999997 25.915 23.965 22.535 145-149 28.249999999999996 25.174999999999997 24.085 22.49 150-151 28.675 26.025 23.3375 21.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 3.0 27 2.5 28 0.5 29 2.5 30 9.5 31 14.5 32 13.5 33 18.0 34 27.0 35 34.0 36 48.0 37 70.5 38 97.5 39 99.5 40 106.0 41 120.5 42 122.0 43 135.5 44 154.5 45 172.5 46 186.0 47 181.5 48 171.5 49 149.0 50 146.0 51 150.5 52 127.5 53 123.0 54 114.0 55 102.5 56 100.5 57 99.0 58 96.5 59 98.0 60 96.0 61 88.5 62 82.0 63 78.0 64 77.0 65 68.5 66 58.0 67 55.0 68 51.5 69 45.0 70 39.5 71 35.5 72 35.0 73 28.0 74 18.5 75 14.5 76 8.5 77 5.5 78 5.5 79 3.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93590068406385 97.625 2 0.8867494299467951 1.7500000000000002 3 0.12667848999239928 0.375 4 0.0 0.0 5 0.05067139599695972 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 5 0.125 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.7125000000000004 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.7875 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 4.8 0.0 0.0 0.0 0.0 118-119 5.2875 0.0 0.0 0.0 0.0 120-121 5.625 0.0 0.0 0.0 0.0 122-123 6.025 0.0 0.0 0.0 0.0 124-125 6.575 0.0 0.0 0.0 0.0 126-127 7.2875 0.0 0.0 0.0 0.0 128-129 7.7875 0.0 0.0 0.0 0.0 130-131 8.2125 0.0 0.0 0.0 0.0 132-133 8.8875 0.0 0.0 0.0 0.0 134-135 9.3875 0.0 0.0 0.0 0.0 136-137 10.1375 0.0 0.0 0.0 0.0 138-139 10.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAACG 10 0.006830828 145.0 5 AAAAAAA 65 4.1823133E-4 15.615384 135-139 >>END_MODULE Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905832 spots for SRR5578494.sra Written 905832 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra Read 905822 spots for SRR5578494.sra Written 905822 spots for SRR5578494.sra SRR ids: ['SRR5578494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s9kmhkaq SRR5578494.sra spots: 18116450 blocks: [[1, 905822], [905823, 1811644], [1811645, 2717466], [2717467, 3623288], [3623289, 4529110], [4529111, 5434932], [5434933, 6340754], [6340755, 7246576], [7246577, 8152398], [8152399, 9058220], [9058221, 9964042], [9964043, 10869864], [10869865, 11775686], [11775687, 12681508], [12681509, 13587330], [13587331, 14493152], [14493153, 15398974], [15398975, 16304796], [16304797, 17210618], [17210619, 18116450]] SRR5578494 file size 6117370 SRR5578494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578494 SRR5578494_1.fastq SRR5578494_2.fastq Input file: SRR5578494_1.fastq Paired file: SRR5578494_2.fastq trimmed: SRR5578494-trimmed-pair1.fastq, SRR5578494-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:42:57 2024 >> started Mon Dec 9 20:43:17 2024 >> done (20.357s) 18116450 read pairs processed; of these: 19428 ( 0.11%) short read pairs filtered out after trimming by size control 21992 ( 0.12%) empty read pairs filtered out after trimming by size control 18075030 (99.77%) read pairs available; of these: 9083627 (50.26%) trimmed read pairs available after processing 8991403 (49.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 9 0.00% 21 9 0.00% 22 7 0.00% 23 16 0.00% 24 20 0.00% 25 18 0.00% 26 25 0.00% 27 24 0.00% 28 22 0.00% 29 820 0.00% 30 30 0.00% 31 33 0.00% 32 25 0.00% 33 27 0.00% 34 24 0.00% 35 62 0.00% 36 45 0.00% 37 39 0.00% 38 51 0.00% 39 47 0.00% 40 55 0.00% 41 71 0.00% 42 57 0.00% 43 55 0.00% 44 78 0.00% 45 77 0.00% 46 77 0.00% 47 116 0.00% 48 136 0.00% 49 160 0.00% 50 178 0.00% 51 208 0.00% 52 204 0.00% 53 242 0.00% 54 232 0.00% 55 278 0.00% 56 286 0.00% 57 357 0.00% 58 410 0.00% 59 475 0.00% 60 547 0.00% 61 648 0.00% 62 703 0.00% 63 806 0.00% 64 885 0.00% 65 918 0.01% 66 1076 0.01% 67 1275 0.01% 68 1678 0.01% 69 2650 0.01% 70 2983 0.02% 71 2600 0.01% 72 2577 0.01% 73 2833 0.02% 74 3088 0.02% 75 3447 0.02% 76 3828 0.02% 77 4220 0.02% 78 4599 0.03% 79 5197 0.03% 80 5735 0.03% 81 6503 0.04% 82 7359 0.04% 83 8412 0.05% 84 9957 0.06% 85 11044 0.06% 86 11482 0.06% 87 12221 0.07% 88 13204 0.07% 89 13736 0.08% 90 14762 0.08% 91 15925 0.09% 92 17255 0.10% 93 18353 0.10% 94 19774 0.11% 95 20753 0.11% 96 22041 0.12% 97 22766 0.13% 98 23740 0.13% 99 25101 0.14% 100 26163 0.14% 101 26910 0.15% 102 29310 0.16% 103 30563 0.17% 104 31967 0.18% 105 33587 0.19% 106 34961 0.19% 107 35844 0.20% 108 36353 0.20% 109 37708 0.21% 110 38744 0.21% 111 40746 0.23% 112 41894 0.23% 113 44133 0.24% 114 46047 0.25% 115 48157 0.27% 116 49727 0.28% 117 50064 0.28% 118 51321 0.28% 119 51999 0.29% 120 53700 0.30% 121 55091 0.30% 122 56765 0.31% 123 59122 0.33% 124 62170 0.34% 125 63758 0.35% 126 65286 0.36% 127 67251 0.37% 128 67412 0.37% 129 69633 0.39% 130 71020 0.39% 131 72772 0.40% 132 75061 0.42% 133 78138 0.43% 134 81074 0.45% 135 83338 0.46% 136 86808 0.48% 137 89220 0.49% 138 92972 0.51% 139 97624 0.54% 140 101612 0.56% 141 107893 0.60% 142 117686 0.65% 143 126901 0.70% 144 141420 0.78% 145 164272 0.91% 146 199280 1.10% 147 259912 1.44% 148 382064 2.11% 149 782023 4.33% 150 4114341 22.76% 151 8991403 49.74% 18075030 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=32 prefix-density=0.75 prefix-fanout=2.7 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=169.39 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.1 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=118.82 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=14.8 sequence=AAGAAGAAGGTCGCGGGCGCCTCTGCGGAGATCCTGGACTCCGCCTCCGCCTACGCCAAGCTGGAGGACAAGCCGGTGGGGCAGTACATGGAGAAGGCCGAGGTGTAC SRR5578494 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:44:10 Started mapping on | Dec 09 20:44:10 Finished on | Dec 09 20:47:54 Mapping speed, Million of reads per hour | 290.49 Number of input reads | 18075030 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16918589 Uniquely mapped reads % | 93.60% Average mapped length | 291.00 Number of splices: Total | 17390805 Number of splices: Annotated (sjdb) | 16356760 Number of splices: GT/AG | 17172111 Number of splices: GC/AG | 199225 Number of splices: AT/AC | 7196 Number of splices: Non-canonical | 12273 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 188013 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 16167 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.75% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 981155 981155 981155 N_multimapping 188013 188013 188013 N_noFeature 618319 16387826 758572 N_ambiguous 458397 2228 67889 UnstrandedReadsAssigned:15841873 PositiveStrandReadsAssigned:528535 NegativeStrandReadsAssigned:16092128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5578494 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578494-trimmed-pair1.fastq SRR5578494-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,075,030 reads, 16,146,409 reads pseudoaligned [quant] estimated average fragment length: 239.011 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR5578494.ke.tsv 35125 SRR5578494.se.tsv 88098 total ==> SRR5578494.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.548 0 0 PNS24247 1044 805.989 54.1881 5.60441 PNS24249 1928 1689.99 54.5604 2.69122 PNS24246 1044 805.989 54.1881 5.60441 PNS24248 1044 805.989 54.1881 5.60441 PNS24244 1471 1232.99 121.875 8.23972 PNS24243 293 102.145 1 0.816093 KQK14069 1603 1364.99 14143.9 863.765 KQK14071 474 249.878 389.192 129.835 ==> SRR5578494.se.tsv <== BRADI_1g14170v3 16000 BRADI_1g53295v3 165 BRADI_1g59795v3 963 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 204 BRADI_1g74790v3 72 BRADI_1g09890v3 0 BRADI_1g77505v3 488 BRADI_1g48960v3 0 SRR5578494 completed mapping pipeline successfully