Starting /dee2/code/volunteer_pipeline.sh SRR5578495 current disk space = 1521078222848 free memory = 1565050436 SRR5578495 SRAfilesize a7e6da49704cc8bf0f05388d33025def SRR5578495.sra SRR5578495.sra file validated SRR5578495 is paired end SRR5578495 is conventional basespace SRR5578495 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10325 34.0 33.0 34.0 32.0 34.0 2 33.2795 34.0 34.0 34.0 32.0 34.0 3 33.4185 34.0 34.0 34.0 33.0 34.0 4 33.5215 34.0 34.0 34.0 33.0 34.0 5 33.55975 34.0 34.0 34.0 33.0 34.0 6 37.19925 38.0 38.0 38.0 36.0 38.0 7 37.52 38.0 38.0 38.0 37.0 38.0 8 37.58975 38.0 38.0 38.0 38.0 38.0 9 37.637 38.0 38.0 38.0 38.0 38.0 10-14 37.612350000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.57565 38.0 38.0 38.0 38.0 38.0 20-24 37.60665 38.0 38.0 38.0 38.0 38.0 25-29 37.5826 38.0 38.0 38.0 38.0 38.0 30-34 37.575100000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.516 38.0 38.0 38.0 38.0 38.0 40-44 37.40725 38.0 38.0 38.0 37.0 38.0 45-49 37.35115 38.0 38.0 38.0 37.0 38.0 50-54 37.34615 38.0 38.0 38.0 37.0 38.0 55-59 37.2671 38.0 38.0 38.0 36.8 38.0 60-64 37.17185 38.0 38.0 38.0 36.2 38.0 65-69 37.13185 38.0 38.0 38.0 36.2 38.0 70-74 37.086749999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.04855 38.0 38.0 38.0 36.0 38.0 80-84 36.87294999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.84815 38.0 38.0 38.0 35.0 38.0 90-94 36.7627 38.0 38.0 38.0 35.0 38.0 95-99 36.586400000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.4933 38.0 38.0 38.0 34.0 38.0 105-109 36.3349 38.0 38.0 38.0 33.8 38.0 110-114 36.1211 38.0 37.4 38.0 33.2 38.0 115-119 35.94415 38.0 37.0 38.0 32.8 38.0 120-124 35.71125 38.0 36.2 38.0 31.8 38.0 125-129 35.31224999999999 38.0 35.6 38.0 30.2 38.0 130-134 34.92715 38.0 35.0 38.0 28.4 38.0 135-139 34.617650000000005 38.0 35.0 38.0 27.6 38.0 140-144 34.237700000000004 38.0 35.0 38.0 25.4 38.0 145-149 33.14885 38.0 34.0 38.0 18.2 38.0 150-151 28.54525 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 3.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 2.0 20 5.0 21 7.0 22 7.0 23 8.0 24 13.0 25 9.0 26 15.0 27 12.0 28 19.0 29 28.0 30 31.0 31 47.0 32 52.0 33 97.0 34 150.0 35 291.0 36 800.0 37 2394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.11358283171945 10.075896362208846 7.223239989531536 36.58728081654017 2 24.45 14.000000000000002 33.0 28.549999999999997 3 22.575 18.675 24.224999999999998 34.525 4 28.199999999999996 24.6 21.65 25.55 5 26.200000000000003 30.15 22.2 21.45 6 22.455613903475868 31.007751937984494 23.655913978494624 22.88072018004501 7 17.65 21.575 40.075 20.7 8 20.424999999999997 21.75 29.625 28.199999999999996 9 20.3 21.7 30.75 27.250000000000004 10-14 23.91 25.419999999999998 25.535000000000004 25.135 15-19 23.865 24.79 24.915000000000003 26.43 20-24 23.86 25.155 24.95 26.035000000000004 25-29 23.82 24.615000000000002 25.615 25.95 30-34 23.915 24.255 25.380000000000003 26.450000000000003 35-39 24.255 24.66 25.224999999999998 25.86 40-44 23.630000000000003 24.795 25.365 26.21 45-49 23.86 24.66 25.115 26.365 50-54 24.765 24.265 24.945 26.025 55-59 24.310000000000002 25.14 24.38 26.169999999999998 60-64 24.45 24.595 24.44 26.515 65-69 24.555 24.955 24.59 25.900000000000002 70-74 24.610000000000003 24.845 24.415 26.13 75-79 24.805 24.14 24.645 26.41 80-84 24.445 24.060000000000002 25.15 26.345000000000002 85-89 24.735 24.22 24.88 26.165 90-94 25.180000000000003 23.595 24.98 26.245 95-99 25.145 23.98 25.014999999999997 25.86 100-104 25.180000000000003 24.08 25.05 25.69 105-109 24.935 24.175 24.73 26.16 110-114 25.36 24.345 23.995 26.3 115-119 25.14 24.245 24.474999999999998 26.14 120-124 25.2 24.715 24.015 26.07 125-129 25.105 24.834999999999997 24.085 25.974999999999998 130-134 25.074999999999996 24.585 23.965 26.375 135-139 24.85 25.085 23.59 26.474999999999998 140-144 25.05 24.525 23.945 26.479999999999997 145-149 24.645 24.474999999999998 24.64 26.240000000000002 150-151 24.9875 24.775 23.962500000000002 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 4.0 29 6.0 30 6.5 31 11.5 32 15.0 33 20.0 34 27.5 35 30.5 36 44.5 37 67.0 38 78.5 39 91.0 40 122.0 41 146.0 42 154.0 43 167.5 44 178.0 45 184.5 46 188.5 47 177.5 48 163.5 49 158.5 50 139.0 51 117.0 52 117.0 53 121.0 54 106.5 55 97.5 56 93.5 57 86.5 58 89.0 59 81.0 60 76.5 61 77.0 62 83.5 63 80.0 64 71.5 65 75.0 66 68.5 67 51.0 68 45.5 69 43.5 70 40.0 71 40.5 72 36.5 73 30.0 74 22.0 75 19.0 76 16.5 77 10.0 78 5.5 79 4.0 80 1.5 81 1.5 82 2.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2125 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.5499999999999998 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.9125 0.0 0.0 0.0 0.0 106-107 3.35 0.0 0.0 0.0 0.0 108-109 3.8499999999999996 0.0 0.0 0.0 0.0 110-111 4.35 0.0 0.0 0.0 0.0 112-113 4.9125 0.0 0.0 0.0 0.0 114-115 5.5625 0.0 0.0 0.0 0.0 116-117 6.1 0.0 0.0 0.0 0.0 118-119 6.55 0.0 0.0 0.0 0.0 120-121 7.2375 0.0 0.0 0.0 0.0 122-123 8.025 0.0 0.0 0.0 0.0 124-125 8.8625 0.0 0.0 0.0 0.0 126-127 9.6 0.0 0.0 0.0 0.0 128-129 10.3125 0.0 0.0 0.0 0.0 130-131 11.15 0.0 0.0 0.0 0.0 132-133 12.0625 0.0 0.0 0.0 0.0 134-135 12.825 0.0 0.0 0.0 0.0 136-137 13.675 0.0 0.0 0.0 0.0 138-139 14.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 4.9877126E-4 28.99 40-44 >>END_MODULE SRR5578495 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578495_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06075 33.0 33.0 34.0 32.0 34.0 2 33.171 34.0 33.0 34.0 33.0 34.0 3 33.1975 34.0 33.0 34.0 33.0 34.0 4 33.15725 34.0 33.0 34.0 33.0 34.0 5 33.267 34.0 33.0 34.0 33.0 34.0 6 37.367 38.0 38.0 38.0 37.0 38.0 7 37.32575 38.0 38.0 38.0 38.0 38.0 8 37.3625 38.0 38.0 38.0 38.0 38.0 9 37.32525 38.0 38.0 38.0 37.0 38.0 10-14 37.32285 38.0 38.0 38.0 37.0 38.0 15-19 37.309000000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.29075 38.0 38.0 38.0 37.0 38.0 25-29 37.266949999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.2759 38.0 38.0 38.0 37.0 38.0 35-39 37.29235 38.0 38.0 38.0 37.2 38.0 40-44 37.312349999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.250350000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2406 38.0 38.0 38.0 37.0 38.0 55-59 37.179649999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.16545 38.0 38.0 38.0 37.0 38.0 65-69 37.0426 38.0 38.0 38.0 36.4 38.0 70-74 36.94385 38.0 38.0 38.0 36.2 38.0 75-79 36.851350000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.813 38.0 38.0 38.0 35.6 38.0 85-89 36.7599 38.0 38.0 38.0 35.2 38.0 90-94 36.71095 38.0 38.0 38.0 35.0 38.0 95-99 36.536699999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.43599999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.26215 38.0 38.0 38.0 34.0 38.0 110-114 36.076 38.0 38.0 38.0 33.6 38.0 115-119 35.88785 38.0 37.8 38.0 33.0 38.0 120-124 35.64375 38.0 36.6 38.0 31.6 38.0 125-129 35.320350000000005 38.0 36.0 38.0 30.6 38.0 130-134 34.90305 38.0 35.4 38.0 28.2 38.0 135-139 34.38575 38.0 34.4 38.0 26.4 38.0 140-144 33.780449999999995 38.0 33.0 38.0 23.4 38.0 145-149 32.387950000000004 38.0 33.0 38.0 11.6 38.0 150-151 27.524375 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 2.0 14 3.0 15 2.0 16 2.0 17 2.0 18 3.0 19 6.0 20 5.0 21 8.0 22 9.0 23 13.0 24 13.0 25 15.0 26 13.0 27 22.0 28 29.0 29 41.0 30 31.0 31 47.0 32 63.0 33 105.0 34 146.0 35 247.0 36 632.0 37 2527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.125 15.925 9.4 32.550000000000004 2 26.906726681670417 23.905976494123532 27.28182045511378 21.905476369092273 3 22.911455727863935 25.6128064032016 25.162581290645324 26.313156578289142 4 27.738869434717362 30.340170085042523 18.75937968984492 23.1615807903952 5 26.638319159579787 32.816408204102046 19.50975487743872 21.03551775887944 6 23.23080770192548 34.53363340835209 19.654913728432106 22.58064516129032 7 21.930482620655166 17.65441360340085 35.25881470367592 25.156289072268066 8 24.099999999999998 21.325 23.95 30.625000000000004 9 25.256314078519633 19.954988747186796 26.85671417854464 27.93198299574894 10-14 25.739008653028563 25.023758315410394 22.427849747411592 26.80938328414945 15-19 25.92314620234164 24.492144501150808 23.306314420094065 26.27839487641349 20-24 25.78418129971484 24.94371904547501 23.903146730701884 25.368952924108264 25-29 26.38346842789953 24.902431702191535 23.43140198138697 25.282697888521966 30-34 25.74589507408891 24.329195034040847 23.93872647176612 25.986183420104126 35-39 25.759471497923027 25.073820129122666 23.592412792152544 25.57429558080176 40-44 26.033016508254125 24.657328664332166 23.676838419209606 25.6328164082041 45-49 26.008004002001 24.242121060530263 24.06703351675838 25.682841420710357 50-54 26.388194097048522 23.826913456728363 24.392196098049023 25.392696348174088 55-59 26.22311155577789 24.29214607303652 23.856928464232116 25.627813906953477 60-64 26.829756366001302 24.20831457301516 23.617989894441944 25.343939166541595 65-69 26.55522746609279 24.623392222611482 23.9477503628447 24.87362994845103 70-74 25.91332198979081 24.892403162846563 23.921529376438794 25.27274547092383 75-79 26.37219551282051 24.774639423076923 23.677884615384613 25.175280448717945 80-84 26.65765224358974 24.313902243589745 23.968349358974358 25.060096153846157 85-89 26.839761869027967 24.398419130521788 23.71804492470859 25.04377407574166 90-94 26.717022660197088 24.53103896753539 23.70566755039768 25.046270821869843 95-99 26.752389052884375 24.746084955220894 23.355180867563917 25.146345124330814 100-104 26.96483065686127 24.948721796988345 23.52293761568863 24.563509930461755 105-109 27.14900430301211 24.822375662964074 22.986090263184227 25.04252977083959 110-114 27.467574740848317 24.768391006059392 23.11082177374931 24.653212479342983 115-119 27.68630198688754 24.818577648766325 22.98683749562084 24.50828286872529 120-124 27.3946551896707 25.33279951956761 23.245921329196275 24.026623961565406 125-129 27.952361889511607 25.010008006405126 23.258606885508406 23.77902321857486 130-134 28.163306148996845 25.486566268074245 23.029969480162105 23.3201581027668 135-139 27.84252913811215 25.361412635686058 23.640638287229255 23.15541993897254 140-144 28.765067773720805 25.493922873005552 22.82798979642875 22.913019556844898 145-149 28.38277224751138 26.466910109549296 22.980341153519085 22.16997648942024 150-151 28.978622327790976 25.240655081885237 22.652831603950492 23.1278909863733 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 1.5 27 1.5 28 3.5 29 4.0 30 7.0 31 14.0 32 13.5 33 13.5 34 25.0 35 35.0 36 48.5 37 55.0 38 64.0 39 86.0 40 99.5 41 123.5 42 135.5 43 142.0 44 168.5 45 172.0 46 158.0 47 156.5 48 156.5 49 148.0 50 134.0 51 136.5 52 125.0 53 103.5 54 109.5 55 95.5 56 80.5 57 85.5 58 83.0 59 92.0 60 96.0 61 102.5 62 106.0 63 94.0 64 90.5 65 82.5 66 82.5 67 80.0 68 68.0 69 62.0 70 56.0 71 44.0 72 41.5 73 37.5 74 27.5 75 20.0 76 10.5 77 5.5 78 3.5 79 3.0 80 2.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.05 5 0.05 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.034999999999999996 15-19 0.06999999999999999 20-24 0.055 25-29 0.06999999999999999 30-34 0.12 35-39 0.095 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.055 65-69 0.095 70-74 0.09 75-79 0.16 80-84 0.16 85-89 0.055 90-94 0.045 95-99 0.065 100-104 0.055 105-109 0.06999999999999999 110-114 0.155 115-119 0.095 120-124 0.09 125-129 0.08 130-134 0.065 135-139 0.045 140-144 0.034999999999999996 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98836621143147 97.85000000000001 2 0.8851795649974709 1.7500000000000002 3 0.10116337885685382 0.3 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.4625 0.0 0.0 0.0 0.0 104-105 2.9375 0.0 0.0 0.0 0.0 106-107 3.3875 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.425 0.0 0.0 0.0 0.0 112-113 5.0375 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.75 0.0 0.0 0.0 0.0 120-121 7.3875 0.0 0.0 0.0 0.0 122-123 8.1625 0.0 0.0 0.0 0.0 124-125 8.9875 0.0 0.0 0.0 0.0 126-127 9.725 0.0 0.0 0.0 0.0 128-129 10.4625 0.0 0.0 0.0 0.0 130-131 11.3125 0.0 0.0 0.0 0.0 132-133 12.25 0.0 0.0 0.0 0.0 134-135 12.9875 0.0 0.0 0.0 0.0 136-137 13.7875 0.0 0.0 0.0 0.0 138-139 14.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTCA 10 0.006830828 145.0 6 AAGTGTG 10 0.006830828 145.0 4 CCCTCAG 10 0.006830828 145.0 6 CTGCAAA 10 0.006830828 145.0 8 ATTTTCG 10 0.006830828 145.0 3 >>END_MODULE Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104718 spots for SRR5578495.sra Written 1104718 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra Read 1104700 spots for SRR5578495.sra Written 1104700 spots for SRR5578495.sra SRR ids: ['SRR5578495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_suyww3fp SRR5578495.sra spots: 22094018 blocks: [[1, 1104700], [1104701, 2209400], [2209401, 3314100], [3314101, 4418800], [4418801, 5523500], [5523501, 6628200], [6628201, 7732900], [7732901, 8837600], [8837601, 9942300], [9942301, 11047000], [11047001, 12151700], [12151701, 13256400], [13256401, 14361100], [14361101, 15465800], [15465801, 16570500], [16570501, 17675200], [17675201, 18779900], [18779901, 19884600], [19884601, 20989300], [20989301, 22094018]] SRR5578495 file size 7465237 SRR5578495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578495 SRR5578495_1.fastq SRR5578495_2.fastq Input file: SRR5578495_1.fastq Paired file: SRR5578495_2.fastq trimmed: SRR5578495-trimmed-pair1.fastq, SRR5578495-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 20:49:18 2024 >> started Mon Dec 9 20:49:45 2024 >> done (27.332s) 22094018 read pairs processed; of these: 24673 ( 0.11%) short read pairs filtered out after trimming by size control 18367 ( 0.08%) empty read pairs filtered out after trimming by size control 22050978 (99.81%) read pairs available; of these: 12512521 (56.74%) trimmed read pairs available after processing 9538457 (43.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 7 0.00% 20 12 0.00% 21 14 0.00% 22 21 0.00% 23 20 0.00% 24 19 0.00% 25 18 0.00% 26 22 0.00% 27 17 0.00% 28 21 0.00% 29 21 0.00% 30 16 0.00% 31 30 0.00% 32 35 0.00% 33 24 0.00% 34 39 0.00% 35 34 0.00% 36 37 0.00% 37 41 0.00% 38 55 0.00% 39 58 0.00% 40 51 0.00% 41 73 0.00% 42 60 0.00% 43 73 0.00% 44 98 0.00% 45 91 0.00% 46 107 0.00% 47 132 0.00% 48 131 0.00% 49 166 0.00% 50 181 0.00% 51 208 0.00% 52 230 0.00% 53 258 0.00% 54 287 0.00% 55 355 0.00% 56 387 0.00% 57 438 0.00% 58 481 0.00% 59 555 0.00% 60 693 0.00% 61 736 0.00% 62 909 0.00% 63 1024 0.00% 64 1321 0.01% 65 1345 0.01% 66 1502 0.01% 67 1759 0.01% 68 2064 0.01% 69 2390 0.01% 70 2740 0.01% 71 2987 0.01% 72 3378 0.02% 73 3812 0.02% 74 4418 0.02% 75 4918 0.02% 76 5383 0.02% 77 5945 0.03% 78 6717 0.03% 79 7662 0.03% 80 8581 0.04% 81 9664 0.04% 82 10920 0.05% 83 12203 0.06% 84 14167 0.06% 85 15634 0.07% 86 16714 0.08% 87 17718 0.08% 88 19280 0.09% 89 20698 0.09% 90 22325 0.10% 91 24222 0.11% 92 25721 0.12% 93 27939 0.13% 94 29941 0.14% 95 31578 0.14% 96 33306 0.15% 97 35839 0.16% 98 36885 0.17% 99 38612 0.18% 100 41750 0.19% 101 43061 0.20% 102 45072 0.20% 103 48070 0.22% 104 49983 0.23% 105 52018 0.24% 106 54766 0.25% 107 56083 0.25% 108 57654 0.26% 109 60323 0.27% 110 62396 0.28% 111 64030 0.29% 112 67828 0.31% 113 70196 0.32% 114 72450 0.33% 115 76145 0.35% 116 76872 0.35% 117 79337 0.36% 118 80687 0.37% 119 81820 0.37% 120 84584 0.38% 121 86579 0.39% 122 88713 0.40% 123 92125 0.42% 124 94882 0.43% 125 97164 0.44% 126 100142 0.45% 127 101676 0.46% 128 103690 0.47% 129 106792 0.48% 130 108533 0.49% 131 110953 0.50% 132 114670 0.52% 133 117960 0.53% 134 120897 0.55% 135 124748 0.57% 136 128755 0.58% 137 131787 0.60% 138 137571 0.62% 139 145106 0.66% 140 150401 0.68% 141 160354 0.73% 142 172488 0.78% 143 186655 0.85% 144 208997 0.95% 145 241207 1.09% 146 288513 1.31% 147 375941 1.70% 148 550095 2.49% 149 1088515 4.94% 150 5132894 23.28% 151 9538457 43.26% 22050978 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=17 prefix-density=0.83 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=28 fanout-score=43.06 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=12.6 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=11 prefix-density=0.64 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=13.16 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5578495 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 20:50:31 Started mapping on | Dec 09 20:50:31 Finished on | Dec 09 20:53:38 Mapping speed, Million of reads per hour | 424.51 Number of input reads | 22050978 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 20677088 Uniquely mapped reads % | 93.77% Average mapped length | 288.40 Number of splices: Total | 20907879 Number of splices: Annotated (sjdb) | 19725104 Number of splices: GT/AG | 20633832 Number of splices: GC/AG | 248079 Number of splices: AT/AC | 9987 Number of splices: Non-canonical | 15981 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316487 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 45831 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 1.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1068164 1068164 1068164 N_multimapping 316487 316487 316487 N_noFeature 786702 20084916 980579 N_ambiguous 471278 2702 73296 UnstrandedReadsAssigned:19419108 PositiveStrandReadsAssigned:589470 NegativeStrandReadsAssigned:19623213 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR5578495 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578495-trimmed-pair1.fastq SRR5578495-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,050,978 reads, 19,744,222 reads pseudoaligned [quant] estimated average fragment length: 229.772 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,378 rounds 52973 SRR5578495.ke.tsv 35125 SRR5578495.se.tsv 88098 total ==> SRR5578495.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.524 0 0 PNS24247 1044 815.228 55.9208 4.89933 PNS24249 1928 1699.23 106.028 4.45668 PNS24246 1044 815.228 55.9208 4.89933 PNS24248 1044 815.228 55.9208 4.89933 PNS24244 1471 1242.23 57.2095 3.28934 PNS24243 293 110.374 0 0 KQK14069 1603 1374.23 3071.84 159.655 KQK14071 474 260.922 125.283 34.2944 ==> SRR5578495.se.tsv <== BRADI_1g14170v3 3556 BRADI_1g53295v3 75 BRADI_1g59795v3 677 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2595 BRADI_1g74790v3 132 BRADI_1g09890v3 1 BRADI_1g77505v3 276 BRADI_1g48960v3 2 SRR5578495 completed mapping pipeline successfully