Starting /dee2/code/volunteer_pipeline.sh SRR5578496 current disk space = 1515247980544 free memory = 1602198496 SRR5578496 SRAfilesize d85cf6cde9f5d2f3e038e9b5c8fac2ec SRR5578496.sra SRR5578496.sra file validated SRR5578496 is paired end SRR5578496 is conventional basespace SRR5578496 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578496_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23 34.0 33.0 34.0 33.0 34.0 2 33.39425 34.0 33.0 34.0 33.0 34.0 3 33.38825 34.0 33.0 34.0 33.0 34.0 4 33.3675 34.0 34.0 34.0 33.0 34.0 5 33.43075 34.0 34.0 34.0 33.0 34.0 6 37.09625 38.0 38.0 38.0 36.0 38.0 7 37.32575 38.0 38.0 38.0 37.0 38.0 8 37.4145 38.0 38.0 38.0 37.0 38.0 9 37.49 38.0 38.0 38.0 37.0 38.0 10-14 37.461349999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.48835 38.0 38.0 38.0 37.0 38.0 20-24 37.5 38.0 38.0 38.0 38.0 38.0 25-29 37.4869 38.0 38.0 38.0 37.6 38.0 30-34 37.4048 38.0 38.0 38.0 37.0 38.0 35-39 37.43865 38.0 38.0 38.0 37.4 38.0 40-44 37.341 38.0 38.0 38.0 37.0 38.0 45-49 37.31935 38.0 38.0 38.0 37.0 38.0 50-54 37.299350000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.243050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.209250000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.1942 38.0 38.0 38.0 36.4 38.0 70-74 37.15905 38.0 38.0 38.0 36.0 38.0 75-79 37.12915 38.0 38.0 38.0 36.0 38.0 80-84 37.0553 38.0 38.0 38.0 36.0 38.0 85-89 36.9957 38.0 38.0 38.0 35.8 38.0 90-94 36.95455 38.0 38.0 38.0 35.6 38.0 95-99 36.846199999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.789699999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.62564999999999 38.0 38.0 38.0 34.2 38.0 110-114 36.56535 38.0 38.0 38.0 34.0 38.0 115-119 36.439949999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.33775 38.0 38.0 38.0 33.8 38.0 125-129 36.24405 38.0 38.0 38.0 33.6 38.0 130-134 35.970600000000005 38.0 37.4 38.0 33.0 38.0 135-139 35.69635 38.0 36.2 38.0 31.8 38.0 140-144 35.299249999999994 38.0 36.0 38.0 31.0 38.0 145-149 34.96 38.0 36.0 38.0 30.4 38.0 150-151 31.402124999999998 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 1.0 20 2.0 21 4.0 22 6.0 23 7.0 24 5.0 25 10.0 26 12.0 27 18.0 28 18.0 29 21.0 30 30.0 31 51.0 32 48.0 33 89.0 34 125.0 35 197.0 36 463.0 37 2883.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.5929648241206 10.92964824120603 8.391959798994975 37.08542713567839 2 24.349999999999998 14.075 33.25 28.325 3 22.7 18.9 24.224999999999998 34.175 4 28.199999999999996 25.1 21.3 25.4 5 27.474999999999998 28.475 23.849999999999998 20.200000000000003 6 23.1 32.525 22.575 21.8 7 17.175 22.525000000000002 40.175 20.125 8 20.75 21.325 30.075000000000003 27.85 9 20.175 20.974999999999998 33.300000000000004 25.55 10-14 23.32 26.145000000000003 25.305 25.230000000000004 15-19 23.93 24.825 25.814999999999998 25.430000000000003 20-24 23.32 24.68 26.245 25.755 25-29 23.825 25.545 25.595000000000002 25.035 30-34 23.599999999999998 25.2 25.52 25.679999999999996 35-39 23.48 25.264999999999997 25.509999999999998 25.745 40-44 23.265 25.074999999999996 26.25 25.41 45-49 22.985 24.895 25.965 26.155 50-54 24.21 24.925 24.775 26.090000000000003 55-59 23.474999999999998 25.45 24.84 26.235000000000003 60-64 23.025000000000002 24.88 25.66 26.435 65-69 23.895 24.72 25.165 26.22 70-74 23.885 24.785 25.319999999999997 26.009999999999998 75-79 24.435000000000002 24.795 25.124999999999996 25.645 80-84 23.61 25.174999999999997 25.36 25.855 85-89 23.91 24.625 25.665 25.8 90-94 24.15 25.05 24.995 25.805 95-99 24.165 25.03 24.895 25.91 100-104 23.555 24.945 25.56 25.94 105-109 24.240000000000002 24.605 25.685000000000002 25.47 110-114 24.355 24.97 24.560000000000002 26.115 115-119 24.565 24.7 24.625 26.11 120-124 24.536226811340565 24.776238811940594 24.511225561278064 26.176308815440773 125-129 24.385 24.959999999999997 25.15 25.505 130-134 24.745 25.165 24.22 25.869999999999997 135-139 24.34 25.195 24.41 26.055 140-144 24.685000000000002 25.595000000000002 23.7 26.02 145-149 24.779999999999998 25.324999999999996 23.825 26.07 150-151 24.212500000000002 26.5625 23.7375 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 3.5 29 7.0 30 9.0 31 12.0 32 17.0 33 18.5 34 33.0 35 39.5 36 43.5 37 59.0 38 77.0 39 93.0 40 112.0 41 133.0 42 153.0 43 174.0 44 194.5 45 199.0 46 186.0 47 181.0 48 182.5 49 172.0 50 158.5 51 149.5 52 145.5 53 139.5 54 112.5 55 100.0 56 106.5 57 95.5 58 69.0 59 68.0 60 89.0 61 89.0 62 73.5 63 65.0 64 60.0 65 58.0 66 57.5 67 57.0 68 49.5 69 35.5 70 27.0 71 25.0 72 17.0 73 12.5 74 12.5 75 8.0 76 5.0 77 2.5 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8604710053178 97.6 2 1.0129146619397316 2.0 3 0.10129146619397315 0.3 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.2750000000000004 0.0 0.0 0.0 0.0 114-115 3.8375000000000004 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.475 0.0 0.0 0.0 0.0 122-123 5.925000000000001 0.0 0.0 0.0 0.0 124-125 6.325 0.0 0.0 0.0 0.0 126-127 7.025 0.0 0.0 0.0 0.0 128-129 7.8375 0.0 0.0 0.0 0.0 130-131 8.4 0.0 0.0 0.0 0.0 132-133 8.9625 0.0 0.0 0.0 0.0 134-135 9.975 0.0 0.0 0.0 0.0 136-137 10.8 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACAAT 10 0.006830828 145.0 6 >>END_MODULE SRR5578496 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578496_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.054 33.0 32.0 33.0 25.0 34.0 2 31.24725 33.0 32.0 34.0 27.0 34.0 3 31.35975 33.0 32.0 34.0 27.0 34.0 4 30.9325 33.0 31.0 34.0 27.0 34.0 5 30.91775 33.0 31.0 34.0 27.0 34.0 6 34.88775 38.0 36.0 38.0 27.0 38.0 7 34.854 38.0 36.0 38.0 28.0 38.0 8 35.05025 38.0 36.0 38.0 28.0 38.0 9 34.96875 38.0 36.0 38.0 28.0 38.0 10-14 34.730650000000004 38.0 36.0 38.0 27.0 38.0 15-19 34.456950000000006 38.0 35.8 38.0 25.8 38.0 20-24 34.3439 38.0 35.6 38.0 25.0 38.0 25-29 34.231550000000006 38.0 35.2 38.0 23.0 38.0 30-34 33.9052 38.0 34.6 38.0 17.6 38.0 35-39 33.734500000000004 38.0 34.0 38.0 16.0 38.0 40-44 33.413799999999995 38.0 34.0 38.0 16.0 38.0 45-49 33.1826 38.0 33.6 38.0 16.0 38.0 50-54 33.027550000000005 38.0 33.2 38.0 16.0 38.0 55-59 32.655 38.0 32.4 38.0 16.0 38.0 60-64 32.385999999999996 37.4 31.8 38.0 15.8 38.0 65-69 31.833050000000004 37.0 29.0 38.0 15.2 38.0 70-74 31.31055 36.8 28.8 38.0 15.0 38.0 75-79 30.9249 36.6 27.8 38.0 14.6 38.0 80-84 30.331349999999997 36.0 26.6 38.0 14.0 38.0 85-89 29.6572 35.6 25.4 38.0 13.2 38.0 90-94 29.08365 35.0 23.0 38.0 10.8 38.0 95-99 28.133300000000002 34.2 17.4 38.0 2.0 38.0 100-104 27.210500000000003 34.0 15.0 38.0 2.0 38.0 105-109 26.263749999999998 33.6 15.0 38.0 2.0 38.0 110-114 25.1765 31.2 14.6 37.0 2.0 38.0 115-119 24.483399999999996 31.0 13.6 37.0 2.0 38.0 120-124 23.34825 28.4 13.0 36.6 2.0 38.0 125-129 21.996499999999997 25.6 2.0 35.8 2.0 38.0 130-134 20.500399999999996 23.0 2.0 35.0 2.0 38.0 135-139 18.8714 18.2 2.0 34.6 2.0 38.0 140-144 16.786949999999997 13.6 2.0 33.6 2.0 38.0 145-149 14.641300000000001 2.0 2.0 33.8 2.0 38.0 150-151 11.11325 2.0 2.0 27.0 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 21.0 4 12.0 5 17.0 6 12.0 7 15.0 8 10.0 9 19.0 10 22.0 11 23.0 12 23.0 13 38.0 14 39.0 15 29.0 16 51.0 17 49.0 18 59.0 19 57.0 20 73.0 21 84.0 22 86.0 23 100.0 24 101.0 25 108.0 26 130.0 27 162.0 28 186.0 29 184.0 30 211.0 31 255.0 32 281.0 33 304.0 34 353.0 35 376.0 36 334.0 37 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.975 17.1 10.35 31.574999999999996 2 30.725 23.200000000000003 25.05 21.025 3 24.34934934934935 25.025025025025027 26.376376376376378 24.24924924924925 4 28.360450563204004 29.962453066332916 19.02377972465582 22.65331664580726 5 27.820865649236925 32.524393294971226 18.563922942206652 21.09081811358519 6 22.92658481583563 36.18140816837885 19.468804810824356 21.42320220496116 7 22.074668003006764 18.566775244299674 34.47757454272112 24.880982209972437 8 23.884711779448622 22.957393483709275 23.05764411027569 30.100250626566417 9 23.182957393483708 22.957393483709275 26.64160401002506 27.21804511278195 10-14 26.45245375708056 26.22687854027771 22.11138402927465 25.209283673367082 15-19 26.260651629072683 25.3483709273183 23.398496240601503 24.992481203007518 20-24 26.1203007518797 25.05263157894737 24.040100250626566 24.786967418546364 25-29 26.220551378446117 25.523809523809526 23.72932330827068 24.526315789473685 30-34 25.908657943550406 25.888604802727226 23.22655035844989 24.976186895272473 35-39 26.527951867636002 25.31962897969416 23.223865630483832 24.92855352218601 40-44 25.83345866546348 25.903644658344614 23.376948914623753 24.885947761568154 45-49 25.630357411399068 25.414807759787454 23.760589503233245 25.194245325580226 50-54 26.30840184479647 25.42109484660116 23.596350511329454 24.67415279727291 55-59 25.99127775828362 25.179206977793374 23.56509098200411 25.264424281918895 60-64 25.31328320802005 25.654135338345863 24.110275689223055 24.922305764411025 65-69 25.6390977443609 25.86466165413534 24.200501253132835 24.295739348370926 70-74 25.93502456632909 25.428657374912262 23.919582873759147 24.7167351849995 75-79 25.759550787125242 25.904943347037 23.53855409605936 24.796951769778403 80-84 25.789632006417328 25.478792740399076 23.518499949864633 25.21307530331896 85-89 25.820843150032584 25.359667151235648 24.0413053285879 24.778184370143865 90-94 25.19929806969165 26.542993231386312 23.68012033091 24.577588368012034 95-99 25.632927257231664 26.013936932872113 23.592520178472952 24.76061563142327 100-104 25.914786967418546 26.45112781954887 23.293233082706767 24.340852130325814 105-109 26.326080417126242 25.904943347037 23.418229218891007 24.350747016945753 110-114 26.0416144397092 27.11456505389822 23.118576084231638 23.725244422160944 115-119 26.25087736889602 26.486513586684048 23.363080316855513 23.899528727564423 120-124 26.154308918634385 26.976487692384822 22.950819672131146 23.91838371684965 125-129 26.738530960140388 26.919027325144146 22.657307595888692 23.685134118826774 130-134 26.62321383805465 27.33517172223615 22.481825018801704 23.559789420907496 135-139 26.462479322271793 28.347285578224472 21.785553160559427 23.404681938944307 140-144 27.26179138890281 27.868277279334368 21.73825873389805 23.131672597864767 145-149 27.195708842991777 28.438941247242834 20.979546821736513 23.385803088028876 150-151 27.13372603083093 30.392279734302548 20.127835568366965 22.346158666499562 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 2.0 3 3.0 4 2.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 3.0 26 1.5 27 1.5 28 4.5 29 5.5 30 8.0 31 12.5 32 14.0 33 19.5 34 25.0 35 30.5 36 35.5 37 49.5 38 71.5 39 86.0 40 101.0 41 122.5 42 138.5 43 145.5 44 156.0 45 166.0 46 176.0 47 184.0 48 167.5 49 158.0 50 172.5 51 158.5 52 123.0 53 111.5 54 117.0 55 116.5 56 114.5 57 101.5 58 95.0 59 98.0 60 98.0 61 100.5 62 91.0 63 73.5 64 72.0 65 69.0 66 54.0 67 61.5 68 67.0 69 51.0 70 41.5 71 36.5 72 24.0 73 17.0 74 13.5 75 8.5 76 6.5 77 3.0 78 2.5 79 2.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.125 5 0.075 6 0.22499999999999998 7 0.22499999999999998 8 0.25 9 0.25 10-14 0.255 15-19 0.25 20-24 0.25 25-29 0.25 30-34 0.265 35-39 0.27499999999999997 40-44 0.265 45-49 0.255 50-54 0.26 55-59 0.255 60-64 0.25 65-69 0.25 70-74 0.27 75-79 0.27 80-84 0.27 85-89 0.255 90-94 0.27499999999999997 95-99 0.265 100-104 0.25 105-109 0.27 110-114 0.27499999999999997 115-119 0.27 120-124 0.265 125-129 0.27499999999999997 130-134 0.27499999999999997 135-139 0.255 140-144 0.245 145-149 0.26 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1154915339904 98.05 2 0.7328784432650998 1.4500000000000002 3 0.10108668182966893 0.3 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.375 0.025 0.0 0.0 0.0 128-129 4.737500000000001 0.025 0.0 0.0 0.0 130-131 5.0625 0.025 0.0 0.0 0.0 132-133 5.3375 0.025 0.0 0.0 0.0 134-135 5.85 0.025 0.0 0.0 0.0 136-137 6.225 0.025 0.0 0.0 0.0 138-139 6.5375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTGA 10 0.006830828 145.0 3 GCCGCCC 10 0.006830828 145.0 145 >>END_MODULE Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra Read 1180057 spots for SRR5578496.sra Written 1180057 spots for SRR5578496.sra SRR ids: ['SRR5578496.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qv1kfqcl SRR5578496.sra spots: 23601140 blocks: [[1, 1180057], [1180058, 2360114], [2360115, 3540171], [3540172, 4720228], [4720229, 5900285], [5900286, 7080342], [7080343, 8260399], [8260400, 9440456], [9440457, 10620513], [10620514, 11800570], [11800571, 12980627], [12980628, 14160684], [14160685, 15340741], [15340742, 16520798], [16520799, 17700855], [17700856, 18880912], [18880913, 20060969], [20060970, 21241026], [21241027, 22421083], [22421084, 23601140]] SRR5578496 file size 7975951 SRR5578496 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578496 SRR5578496_1.fastq SRR5578496_2.fastq Input file: SRR5578496_1.fastq Paired file: SRR5578496_2.fastq trimmed: SRR5578496-trimmed-pair1.fastq, SRR5578496-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:17:42 2024 >> started Thu Dec 12 03:18:07 2024 >> done (25.357s) 23601140 read pairs processed; of these: 93680 ( 0.40%) short read pairs filtered out after trimming by size control 90212 ( 0.38%) empty read pairs filtered out after trimming by size control 23417248 (99.22%) read pairs available; of these: 12698240 (54.23%) trimmed read pairs available after processing 10719008 (45.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 18 0.00% 21 19 0.00% 22 10 0.00% 23 18 0.00% 24 21 0.00% 25 26 0.00% 26 22 0.00% 27 27 0.00% 28 22 0.00% 29 29 0.00% 30 37 0.00% 31 26 0.00% 32 30 0.00% 33 24 0.00% 34 38 0.00% 35 37 0.00% 36 36 0.00% 37 56 0.00% 38 55 0.00% 39 45 0.00% 40 68 0.00% 41 54 0.00% 42 83 0.00% 43 80 0.00% 44 93 0.00% 45 100 0.00% 46 103 0.00% 47 124 0.00% 48 142 0.00% 49 158 0.00% 50 185 0.00% 51 225 0.00% 52 260 0.00% 53 258 0.00% 54 339 0.00% 55 365 0.00% 56 383 0.00% 57 451 0.00% 58 522 0.00% 59 580 0.00% 60 633 0.00% 61 750 0.00% 62 842 0.00% 63 1088 0.00% 64 1125 0.00% 65 1226 0.01% 66 1356 0.01% 67 1555 0.01% 68 1782 0.01% 69 2150 0.01% 70 2443 0.01% 71 2622 0.01% 72 2955 0.01% 73 3252 0.01% 74 3655 0.02% 75 4321 0.02% 76 4655 0.02% 77 4988 0.02% 78 5877 0.03% 79 6770 0.03% 80 7477 0.03% 81 8656 0.04% 82 9661 0.04% 83 10915 0.05% 84 15148 0.06% 85 17582 0.08% 86 18148 0.08% 87 19301 0.08% 88 20565 0.09% 89 21365 0.09% 90 22894 0.10% 91 24640 0.11% 92 25738 0.11% 93 27430 0.12% 94 29116 0.12% 95 30927 0.13% 96 32490 0.14% 97 34762 0.15% 98 36665 0.16% 99 38730 0.17% 100 41115 0.18% 101 43337 0.19% 102 46155 0.20% 103 48184 0.21% 104 50751 0.22% 105 53028 0.23% 106 55783 0.24% 107 57533 0.25% 108 60334 0.26% 109 63900 0.27% 110 66277 0.28% 111 69759 0.30% 112 72541 0.31% 113 75062 0.32% 114 78930 0.34% 115 82698 0.35% 116 85188 0.36% 117 88187 0.38% 118 90606 0.39% 119 93663 0.40% 120 96962 0.41% 121 100449 0.43% 122 103450 0.44% 123 107264 0.46% 124 112652 0.48% 125 117404 0.50% 126 120519 0.51% 127 123905 0.53% 128 127375 0.54% 129 132870 0.57% 130 136363 0.58% 131 141174 0.60% 132 144964 0.62% 133 150396 0.64% 134 155899 0.67% 135 163717 0.70% 136 169252 0.72% 137 175441 0.75% 138 180480 0.77% 139 189448 0.81% 140 201683 0.86% 141 212953 0.91% 142 230819 0.99% 143 248506 1.06% 144 272671 1.16% 145 310922 1.33% 146 363468 1.55% 147 448965 1.92% 148 613829 2.62% 149 1029144 4.39% 150 4180813 17.85% 151 10719008 45.77% 23417248 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.3 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGCTTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=17.79 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.3 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=68.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR5578496 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:18:49 Started mapping on | Dec 12 03:18:49 Finished on | Dec 12 03:22:22 Mapping speed, Million of reads per hour | 395.78 Number of input reads | 23417248 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 22125536 Uniquely mapped reads % | 94.48% Average mapped length | 287.70 Number of splices: Total | 23106476 Number of splices: Annotated (sjdb) | 21683363 Number of splices: GT/AG | 22807144 Number of splices: GC/AG | 275201 Number of splices: AT/AC | 8195 Number of splices: Non-canonical | 15936 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272221 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 21420 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1068038 1068038 1068038 N_multimapping 272221 272221 272221 N_noFeature 807561 21421426 1025612 N_ambiguous 578236 3049 94490 UnstrandedReadsAssigned:20739739 PositiveStrandReadsAssigned:701061 NegativeStrandReadsAssigned:21005434 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5578496 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578496-trimmed-pair1.fastq SRR5578496-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,417,248 reads, 21,110,135 reads pseudoaligned [quant] estimated average fragment length: 236.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 SRR5578496.ke.tsv 35125 SRR5578496.se.tsv 88098 total ==> SRR5578496.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.138 0 0 PNS24247 1044 808.615 57.9698 4.75322 PNS24249 1928 1692.62 60.9757 2.38851 PNS24246 1044 808.615 57.9698 4.75322 PNS24248 1044 808.615 57.9698 4.75322 PNS24244 1471 1235.62 98.1148 5.26477 PNS24243 293 106.345 0 0 KQK14069 1603 1367.62 6153.28 298.312 KQK14071 474 254.81 125.422 32.635 ==> SRR5578496.se.tsv <== BRADI_1g14170v3 7042 BRADI_1g53295v3 136 BRADI_1g59795v3 501 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 222 BRADI_1g74790v3 123 BRADI_1g09890v3 0 BRADI_1g77505v3 265 BRADI_1g48960v3 0 SRR5578496 completed mapping pipeline successfully