Starting /dee2/code/volunteer_pipeline.sh SRR5578499 current disk space = 1521559441408 free memory = 1573522316 SRR5578499 SRAfilesize e409d887ed8ad3e9b6a104a59ac935f9 SRR5578499.sra SRR5578499.sra file validated SRR5578499 is paired end SRR5578499 is conventional basespace SRR5578499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25575 34.0 33.0 34.0 33.0 34.0 2 33.44425 34.0 33.0 34.0 33.0 34.0 3 33.45975 34.0 34.0 34.0 33.0 34.0 4 33.452 34.0 34.0 34.0 33.0 34.0 5 33.4365 34.0 34.0 34.0 33.0 34.0 6 37.21525 38.0 38.0 38.0 36.0 38.0 7 37.467 38.0 38.0 38.0 37.0 38.0 8 37.514 38.0 38.0 38.0 37.0 38.0 9 37.465 38.0 38.0 38.0 37.0 38.0 10-14 37.470349999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.498599999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.496750000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.4609 38.0 38.0 38.0 37.6 38.0 30-34 37.4769 38.0 38.0 38.0 38.0 38.0 35-39 37.4148 38.0 38.0 38.0 37.2 38.0 40-44 37.3677 38.0 38.0 38.0 37.0 38.0 45-49 37.29765 38.0 38.0 38.0 37.0 38.0 50-54 37.30705 38.0 38.0 38.0 37.0 38.0 55-59 37.25965 38.0 38.0 38.0 36.8 38.0 60-64 37.2109 38.0 38.0 38.0 36.4 38.0 65-69 37.18755 38.0 38.0 38.0 36.0 38.0 70-74 37.098699999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.142 38.0 38.0 38.0 36.2 38.0 80-84 37.06565 38.0 38.0 38.0 36.0 38.0 85-89 36.99405 38.0 38.0 38.0 35.8 38.0 90-94 36.9139 38.0 38.0 38.0 35.0 38.0 95-99 36.875099999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.7127 38.0 38.0 38.0 34.8 38.0 105-109 36.6225 38.0 38.0 38.0 34.4 38.0 110-114 36.449799999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.3291 38.0 38.0 38.0 34.0 38.0 120-124 36.24415 38.0 38.0 38.0 33.8 38.0 125-129 36.109300000000005 38.0 37.8 38.0 33.0 38.0 130-134 35.89735 38.0 37.2 38.0 33.0 38.0 135-139 35.58239999999999 38.0 36.0 38.0 31.4 38.0 140-144 35.459199999999996 38.0 36.0 38.0 31.4 38.0 145-149 34.838350000000005 38.0 36.0 38.0 29.4 38.0 150-151 31.551125 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 0.0 18 3.0 19 2.0 20 4.0 21 4.0 22 2.0 23 6.0 24 6.0 25 9.0 26 17.0 27 14.0 28 18.0 29 23.0 30 34.0 31 46.0 32 67.0 33 90.0 34 123.0 35 180.0 36 487.0 37 2859.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.771514846502264 9.511826874685456 6.567689984901862 42.148968293910414 2 22.7 14.000000000000002 37.2 26.1 3 21.349999999999998 18.775 24.025 35.85 4 28.175 26.424999999999997 20.225 25.174999999999997 5 25.324999999999996 30.85 22.375 21.45 6 20.925 32.025 25.3 21.75 7 15.478869717429358 21.930482620655166 42.085521380345085 20.505126281570394 8 19.975 18.9 31.775 29.349999999999998 9 19.925 19.975 33.75 26.35 10-14 23.435 25.705 24.845 26.015 15-19 23.165 24.645 25.885 26.305 20-24 23.21 24.240000000000002 26.14 26.41 25-29 23.35 23.875 26.605 26.169999999999998 30-34 22.98 24.465 26.075 26.479999999999997 35-39 23.085 24.39 26.08 26.445 40-44 23.175 24.875 25.88 26.07 45-49 23.16 24.099999999999998 26.71 26.029999999999998 50-54 23.11 24.37 25.96 26.56 55-59 23.5 24.36 25.415 26.724999999999998 60-64 23.325000000000003 24.365000000000002 25.724999999999998 26.584999999999997 65-69 23.505000000000003 24.37 25.759999999999998 26.365 70-74 24.495 24.490000000000002 24.29 26.724999999999998 75-79 23.385 24.555 25.509999999999998 26.55 80-84 23.21 24.404999999999998 25.345000000000002 27.04 85-89 23.669999999999998 23.965 26.009999999999998 26.355 90-94 24.154999999999998 24.705 24.625 26.515 95-99 23.255 24.535 25.685000000000002 26.525 100-104 23.669999999999998 24.175 26.025 26.13 105-109 23.79 24.05 25.52 26.640000000000004 110-114 24.05 24.474999999999998 25.105 26.369999999999997 115-119 24.196049012253063 24.756189047261813 24.781195298824706 26.266566641660415 120-124 24.04 24.779999999999998 24.195 26.985 125-129 24.555 25.224999999999998 23.9 26.32 130-134 23.39 24.535 24.875 27.200000000000003 135-139 24.075 24.959999999999997 24.435000000000002 26.529999999999998 140-144 23.73 24.759999999999998 24.775 26.735 145-149 24.421221061053053 24.546227311365566 24.31621581079054 26.71633581679084 150-151 23.10577644411103 24.5311327831958 24.93123280820205 27.431857964491122 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 3.0 27 3.0 28 2.0 29 5.0 30 5.5 31 6.5 32 18.5 33 20.5 34 19.0 35 35.0 36 51.0 37 60.0 38 70.5 39 89.0 40 116.5 41 150.0 42 164.5 43 166.5 44 170.5 45 172.0 46 182.0 47 180.5 48 179.5 49 184.0 50 170.0 51 164.0 52 163.5 53 142.0 54 128.0 55 127.5 56 113.5 57 99.5 58 100.0 59 82.5 60 63.0 61 59.5 62 51.0 63 43.0 64 44.5 65 42.5 66 31.0 67 35.5 68 42.5 69 30.5 70 26.0 71 37.0 72 36.5 73 24.0 74 20.0 75 19.0 76 13.5 77 10.0 78 7.5 79 5.5 80 4.5 81 4.0 82 1.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.4746119442252 91.675 2 2.6308866087871614 5.0 3 0.4998684556695606 1.425 4 0.1841620626151013 0.7000000000000001 5 0.15785319652722968 0.75 6 0.0 0.0 7 0.0 0.0 8 0.026308866087871613 0.2 9 0.0 0.0 >10 0.026308866087871613 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 10 0.25 No Hit GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 8 0.2 No Hit GTCGTCTGCAAAGGATTCAGCCCGCCGCCCGTGGGGAAGGGAGCTTCGAG 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 5 0.125 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTC 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCAGCGCTCGGGGAAAGCCCC 5 0.125 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.1375000000000002 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.7875 0.0 0.0 0.0 0.0 116-117 4.1125 0.0 0.0 0.0 0.0 118-119 4.6125 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.3375 0.0 0.0 0.0 0.0 130-131 8.025 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.4 0.0 0.0 0.0 0.0 136-137 9.962499999999999 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.601 33.0 32.0 33.0 27.0 34.0 2 31.82875 33.0 32.0 34.0 28.0 34.0 3 31.7715 33.0 33.0 34.0 28.0 34.0 4 31.841 33.0 33.0 34.0 30.0 34.0 5 31.852 33.0 33.0 34.0 30.0 34.0 6 35.81875 38.0 37.0 38.0 31.0 38.0 7 35.6135 38.0 37.0 38.0 29.0 38.0 8 35.58225 38.0 37.0 38.0 29.0 38.0 9 35.439 38.0 37.0 38.0 29.0 38.0 10-14 35.5793 38.0 37.0 38.0 29.0 38.0 15-19 35.4139 38.0 37.0 38.0 28.8 38.0 20-24 35.3099 38.0 37.0 38.0 28.8 38.0 25-29 35.1737 38.0 36.2 38.0 28.2 38.0 30-34 35.04085 38.0 36.0 38.0 27.6 38.0 35-39 34.8774 38.0 36.0 38.0 27.2 38.0 40-44 34.7762 38.0 36.0 38.0 27.0 38.0 45-49 34.5524 38.0 35.8 38.0 26.0 38.0 50-54 34.192949999999996 38.0 34.8 38.0 24.6 38.0 55-59 33.9852 38.0 34.2 38.0 20.8 38.0 60-64 33.7407 38.0 34.0 38.0 17.6 38.0 65-69 33.4202 38.0 33.8 38.0 16.0 38.0 70-74 33.0064 37.8 33.0 38.0 16.0 38.0 75-79 32.54195 37.2 31.4 38.0 15.2 38.0 80-84 32.17175 37.0 31.0 38.0 15.0 38.0 85-89 31.426199999999994 37.0 29.0 38.0 15.0 38.0 90-94 30.805349999999997 36.2 27.8 38.0 14.2 38.0 95-99 30.068450000000002 35.6 25.6 38.0 13.2 38.0 100-104 29.4581 35.0 23.6 38.0 13.0 38.0 105-109 28.51905 34.4 22.2 38.0 6.4 38.0 110-114 27.5365 34.0 16.2 38.0 2.0 38.0 115-119 26.540300000000002 33.8 15.0 38.0 2.0 38.0 120-124 25.396549999999998 32.4 14.2 37.4 2.0 38.0 125-129 24.2871 31.0 13.0 37.0 2.0 38.0 130-134 22.621100000000002 27.4 6.4 36.0 2.0 38.0 135-139 20.9291 23.2 2.0 35.2 2.0 38.0 140-144 19.2489 20.6 2.0 34.4 2.0 38.0 145-149 16.747949999999996 8.8 2.0 33.4 2.0 38.0 150-151 12.368875 2.0 2.0 28.0 2.0 35.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 13.0 4 5.0 5 10.0 6 5.0 7 8.0 8 6.0 9 5.0 10 11.0 11 11.0 12 19.0 13 22.0 14 21.0 15 27.0 16 32.0 17 37.0 18 40.0 19 55.0 20 53.0 21 64.0 22 63.0 23 100.0 24 99.0 25 100.0 26 129.0 27 133.0 28 155.0 29 164.0 30 211.0 31 244.0 32 267.0 33 354.0 34 446.0 35 421.0 36 470.0 37 169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 16.475 8.55 32.800000000000004 2 28.07412972702229 23.716503881793138 29.72702228900576 18.482344102178814 3 24.93734335839599 24.81203007518797 25.238095238095237 25.012531328320804 4 29.022556390977446 31.879699248120303 17.042606516290725 22.05513784461153 5 28.32080200501253 34.636591478696744 17.969924812030076 19.072681704260653 6 23.109664496745115 34.727090635953935 20.105157736604905 22.058087130696045 7 22.414224893563738 17.580766341096922 36.38868019033308 23.61632857500626 8 22.940145254194842 22.489356373653894 24.442774855997996 30.12772351615327 9 24.94365138993238 21.91334835962935 26.897069872276486 26.245930378161788 10-14 26.302866305872918 25.937061535377833 23.055722589697332 24.704349569051914 15-19 26.61654135338346 25.493734335839598 23.694235588972433 24.195488721804512 20-24 26.515265453451647 25.22685115556224 23.928410287261244 24.329473103724872 25-29 26.692068585179985 26.090444199338215 23.398175072696283 23.81931214278552 30-34 26.519253910950663 26.238467709586843 23.75150421179302 23.490774167669475 35-39 26.40866252255865 26.493884098656505 22.93463003809906 24.162823340685783 40-44 26.57878909382518 25.496190858059343 23.9775461106656 23.947473937449878 45-49 26.325814536340854 26.25062656641604 23.418546365914786 24.005012531328322 50-54 26.809705233607378 25.60156406657309 23.912171646280328 23.6765590535392 55-59 27.146939389381863 25.236877725973834 23.878277435203287 23.73790544944102 60-64 26.889913775817124 25.03509123721676 24.177862442350108 23.897132544616 65-69 27.08813797252582 25.463752130753033 23.46836458437782 23.979745312343326 70-74 26.882205513784463 24.87719298245614 23.719298245614034 24.521303258145362 75-79 26.356161636418328 24.65657274641532 24.02486714128146 24.96239847588489 80-84 27.06442717473051 25.575332163449488 23.40436199548759 23.955878666332413 85-89 26.989220355978944 25.77588368012033 23.30408623715217 23.93080972674856 90-94 26.889913775817124 25.937437337076396 23.836976137958693 23.335672749147783 95-99 26.848463582134443 25.249385934132036 23.835781242167528 24.066369241565994 100-104 26.536340852130323 25.894736842105264 23.694235588972433 23.874686716791977 105-109 26.728503384306844 25.55026322386563 24.15141639508649 23.56981699674104 110-114 27.295061418901977 26.317372775131613 22.64226623213838 23.745299573828028 115-119 27.975533941642432 26.18068785721448 22.60102276145593 23.242755439687155 120-124 27.45963293551299 25.644368669140505 22.846254136997292 24.04974425834921 125-129 28.095858818810786 25.89491627393964 22.545873859420436 23.46335104782914 130-134 27.722077401243233 26.36354521756567 22.553639462602767 23.360737918588327 135-139 28.289209787404733 26.38888888888889 22.197152025671883 23.124749298034498 140-144 27.99558808783716 26.707109194826028 21.743708011631405 23.553594705705404 145-149 28.656641604010026 26.982456140350873 21.48872180451128 22.872180451127818 150-151 28.873856946010275 27.395715896279594 20.856820744081173 22.87360641362896 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 3.0 2 3.0 3 1.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 1.0 27 3.5 28 5.0 29 5.5 30 8.0 31 9.0 32 9.0 33 18.5 34 27.0 35 27.5 36 40.5 37 55.0 38 64.0 39 82.5 40 106.5 41 126.0 42 135.5 43 144.5 44 175.0 45 182.5 46 169.0 47 176.5 48 171.5 49 170.5 50 163.5 51 142.5 52 136.5 53 134.0 54 135.5 55 138.5 56 122.0 57 109.5 58 102.0 59 86.5 60 83.0 61 70.5 62 62.0 63 63.5 64 52.0 65 45.5 66 54.0 67 54.5 68 46.0 69 41.5 70 39.5 71 39.0 72 32.0 73 27.5 74 24.5 75 18.0 76 14.5 77 14.0 78 10.0 79 4.5 80 3.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.25 4 0.25 5 0.25 6 0.15 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.22 15-19 0.25 20-24 0.265 25-29 0.27 30-34 0.27999999999999997 35-39 0.26 40-44 0.24 45-49 0.25 50-54 0.26 55-59 0.265 60-64 0.26 65-69 0.27 70-74 0.25 75-79 0.27 80-84 0.27499999999999997 85-89 0.27499999999999997 90-94 0.26 95-99 0.255 100-104 0.25 105-109 0.27499999999999997 110-114 0.27499999999999997 115-119 0.27 120-124 0.29 125-129 0.27 130-134 0.26 135-139 0.27999999999999997 140-144 0.27 145-149 0.25 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 96.9918911849333 92.7 2 2.2233847763536487 4.25 3 0.47083442322783153 1.35 4 0.104629871828407 0.4 5 0.13078733978550877 0.625 6 0.02615746795710175 0.15 7 0.02615746795710175 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02615746795710175 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 14 0.35000000000000003 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 7 0.17500000000000002 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 5 0.125 No Hit GTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGA 5 0.125 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.300000000000001 0.0 0.0 0.0 0.0 132-133 5.737500000000001 0.0 0.0 0.0 0.0 134-135 6.0875 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCGGC 10 0.006830828 145.0 6 CGTGTAG 25 8.7132835E-4 87.0 145 >>END_MODULE Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199758 spots for SRR5578499.sra Written 1199758 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra Read 1199746 spots for SRR5578499.sra Written 1199746 spots for SRR5578499.sra SRR ids: ['SRR5578499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1o05023 SRR5578499.sra spots: 23994932 blocks: [[1, 1199746], [1199747, 2399492], [2399493, 3599238], [3599239, 4798984], [4798985, 5998730], [5998731, 7198476], [7198477, 8398222], [8398223, 9597968], [9597969, 10797714], [10797715, 11997460], [11997461, 13197206], [13197207, 14396952], [14396953, 15596698], [15596699, 16796444], [16796445, 17996190], [17996191, 19195936], [19195937, 20395682], [20395683, 21595428], [21595429, 22795174], [22795175, 23994932]] SRR5578499 file size 8109394 SRR5578499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578499 SRR5578499_1.fastq SRR5578499_2.fastq Input file: SRR5578499_1.fastq Paired file: SRR5578499_2.fastq trimmed: SRR5578499-trimmed-pair1.fastq, SRR5578499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:04:05 2024 >> started Mon Dec 9 21:05:38 2024 >> done (92.369s) 23994932 read pairs processed; of these: 60220 ( 0.25%) short read pairs filtered out after trimming by size control 72309 ( 0.30%) empty read pairs filtered out after trimming by size control 23862403 (99.45%) read pairs available; of these: 12988719 (54.43%) trimmed read pairs available after processing 10873684 (45.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 16 0.00% 20 23 0.00% 21 14 0.00% 22 24 0.00% 23 19 0.00% 24 15 0.00% 25 28 0.00% 26 24 0.00% 27 29 0.00% 28 26 0.00% 29 31 0.00% 30 51 0.00% 31 43 0.00% 32 49 0.00% 33 48 0.00% 34 50 0.00% 35 63 0.00% 36 72 0.00% 37 78 0.00% 38 86 0.00% 39 124 0.00% 40 97 0.00% 41 112 0.00% 42 120 0.00% 43 117 0.00% 44 125 0.00% 45 163 0.00% 46 177 0.00% 47 201 0.00% 48 219 0.00% 49 239 0.00% 50 264 0.00% 51 320 0.00% 52 359 0.00% 53 346 0.00% 54 410 0.00% 55 446 0.00% 56 492 0.00% 57 559 0.00% 58 635 0.00% 59 738 0.00% 60 763 0.00% 61 918 0.00% 62 1066 0.00% 63 1144 0.00% 64 1275 0.01% 65 1441 0.01% 66 1527 0.01% 67 1807 0.01% 68 2085 0.01% 69 2269 0.01% 70 2591 0.01% 71 2706 0.01% 72 3142 0.01% 73 3526 0.01% 74 3871 0.02% 75 4356 0.02% 76 4928 0.02% 77 5514 0.02% 78 6160 0.03% 79 6948 0.03% 80 7833 0.03% 81 8633 0.04% 82 9774 0.04% 83 11129 0.05% 84 13869 0.06% 85 16212 0.07% 86 17188 0.07% 87 17786 0.07% 88 18945 0.08% 89 19940 0.08% 90 21607 0.09% 91 23170 0.10% 92 24654 0.10% 93 26687 0.11% 94 27960 0.12% 95 30196 0.13% 96 32110 0.13% 97 34081 0.14% 98 35475 0.15% 99 37788 0.16% 100 40426 0.17% 101 42350 0.18% 102 44663 0.19% 103 47289 0.20% 104 49381 0.21% 105 51054 0.21% 106 54456 0.23% 107 57068 0.24% 108 59271 0.25% 109 62791 0.26% 110 64888 0.27% 111 68807 0.29% 112 72282 0.30% 113 73365 0.31% 114 76977 0.32% 115 81499 0.34% 116 84347 0.35% 117 86799 0.36% 118 88328 0.37% 119 91174 0.38% 120 96270 0.40% 121 98678 0.41% 122 102709 0.43% 123 107878 0.45% 124 109764 0.46% 125 113921 0.48% 126 118007 0.49% 127 120481 0.50% 128 123176 0.52% 129 128496 0.54% 130 131588 0.55% 131 136025 0.57% 132 140694 0.59% 133 145991 0.61% 134 150453 0.63% 135 156708 0.66% 136 164302 0.69% 137 170214 0.71% 138 177116 0.74% 139 187968 0.79% 140 197342 0.83% 141 211352 0.89% 142 229248 0.96% 143 247744 1.04% 144 277707 1.16% 145 315787 1.32% 146 371734 1.56% 147 473180 1.98% 148 649445 2.72% 149 1119859 4.69% 150 4417522 18.51% 151 10873684 45.57% 23862403 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=21 prefix-density=1.02 prefix-fanout=2.3 sequence=TTTCCTCTGGCT criterion=fanout-score sequence-density=0.16 sequence-density-rank=30 fanout-score=10.36 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=2.0 sequence=CCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGAC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.2 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=74.01 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578499 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:07:42 Started mapping on | Dec 09 21:07:43 Finished on | Dec 09 21:12:11 Mapping speed, Million of reads per hour | 320.54 Number of input reads | 23862403 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18119972 Uniquely mapped reads % | 75.94% Average mapped length | 288.30 Number of splices: Total | 18544875 Number of splices: Annotated (sjdb) | 17498292 Number of splices: GT/AG | 18288787 Number of splices: GC/AG | 225878 Number of splices: AT/AC | 10459 Number of splices: Non-canonical | 19751 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1408447 % of reads mapped to multiple loci | 5.90% Number of reads mapped to too many loci | 484873 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 12.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4368136 4368136 4368136 N_multimapping 1408447 1408447 1408447 N_noFeature 1557369 17636296 1730996 N_ambiguous 394527 3096 85653 UnstrandedReadsAssigned:16168076 PositiveStrandReadsAssigned:480580 NegativeStrandReadsAssigned:16303323 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5578499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578499-trimmed-pair1.fastq SRR5578499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,862,403 reads, 17,013,957 reads pseudoaligned [quant] estimated average fragment length: 244.824 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR5578499.ke.tsv 35125 SRR5578499.se.tsv 88098 total ==> SRR5578499.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.773 0 0 PNS24247 1044 800.176 39.1706 3.96232 PNS24249 1928 1684.18 109.12 5.24437 PNS24246 1044 800.176 39.1706 3.96232 PNS24248 1044 800.176 39.1706 3.96232 PNS24244 1471 1227.18 56.3678 3.71791 PNS24243 293 106.302 0 0 KQK14069 1603 1359.18 4369.29 260.201 KQK14071 474 251.131 168.998 54.4696 ==> SRR5578499.se.tsv <== BRADI_1g14170v3 5080 BRADI_1g53295v3 104 BRADI_1g59795v3 395 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2278 BRADI_1g74790v3 162 BRADI_1g09890v3 4 BRADI_1g77505v3 305 BRADI_1g48960v3 0 SRR5578499 completed mapping pipeline successfully