Starting /dee2/code/volunteer_pipeline.sh SRR5578501 current disk space = 1521723113472 free memory = 1573450716 SRR5578501 SRAfilesize ad05aa61d122b77eeb4955b5b6f3c7f9 SRR5578501.sra SRR5578501.sra file validated SRR5578501 is paired end SRR5578501 is conventional basespace SRR5578501 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.227 34.0 33.0 34.0 33.0 34.0 2 33.36775 34.0 33.0 34.0 33.0 34.0 3 33.41375 34.0 33.0 34.0 33.0 34.0 4 33.36275 34.0 33.0 34.0 33.0 34.0 5 33.365 34.0 33.0 34.0 33.0 34.0 6 36.992 38.0 37.0 38.0 36.0 38.0 7 37.2985 38.0 38.0 38.0 37.0 38.0 8 37.40025 38.0 38.0 38.0 37.0 38.0 9 37.39575 38.0 38.0 38.0 37.0 38.0 10-14 37.381099999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.40665 38.0 38.0 38.0 37.0 38.0 20-24 37.41495 38.0 38.0 38.0 37.0 38.0 25-29 37.4137 38.0 38.0 38.0 37.0 38.0 30-34 37.45174999999999 38.0 38.0 38.0 37.2 38.0 35-39 37.370850000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.254549999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.3095 38.0 38.0 38.0 37.0 38.0 50-54 37.23345 38.0 38.0 38.0 37.0 38.0 55-59 37.2011 38.0 38.0 38.0 36.2 38.0 60-64 37.1499 38.0 38.0 38.0 36.0 38.0 65-69 37.15295 38.0 38.0 38.0 36.0 38.0 70-74 37.03349999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.024300000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.96515 38.0 38.0 38.0 35.8 38.0 85-89 36.9283 38.0 38.0 38.0 35.6 38.0 90-94 36.83865 38.0 38.0 38.0 35.2 38.0 95-99 36.75035 38.0 38.0 38.0 35.0 38.0 100-104 36.66905 38.0 38.0 38.0 34.8 38.0 105-109 36.472750000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.38530000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.180099999999996 38.0 38.0 38.0 33.6 38.0 120-124 36.1323 38.0 38.0 38.0 33.6 38.0 125-129 35.93655 38.0 37.6 38.0 33.0 38.0 130-134 35.75019999999999 38.0 37.0 38.0 32.8 38.0 135-139 35.46835 38.0 36.2 38.0 31.4 38.0 140-144 35.11855 38.0 36.0 38.0 29.8 38.0 145-149 34.7441 38.0 36.0 38.0 28.4 38.0 150-151 31.29125 35.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 5.0 18 3.0 19 2.0 20 7.0 21 3.0 22 4.0 23 6.0 24 13.0 25 11.0 26 10.0 27 22.0 28 30.0 29 25.0 30 32.0 31 54.0 32 56.0 33 86.0 34 111.0 35 217.0 36 468.0 37 2830.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.47717009533367 10.286001003512293 8.60511791269443 37.63171098845961 2 24.925 14.374999999999998 32.275 28.425 3 22.6 20.25 24.825 32.324999999999996 4 28.449999999999996 26.424999999999997 19.7 25.424999999999997 5 25.3 31.8 22.175 20.724999999999998 6 22.35 32.875 24.425 20.349999999999998 7 17.849999999999998 21.825 40.125 20.200000000000003 8 21.85 21.5 27.750000000000004 28.9 9 20.925 22.575 31.15 25.35 10-14 23.575 26.455000000000002 24.815 25.155 15-19 23.72 25.94 24.88 25.46 20-24 22.68 25.715 25.385 26.22 25-29 22.91 25.540000000000003 26.33 25.22 30-34 23.515 24.705 25.665 26.115 35-39 23.44 25.845000000000002 25.025 25.69 40-44 23.57 25.119999999999997 25.39 25.919999999999998 45-49 22.939999999999998 25.09 25.46 26.51 50-54 23.665 25.165 25.224999999999998 25.945 55-59 23.53 25.509999999999998 25.185000000000002 25.775 60-64 23.474999999999998 25.009999999999998 25.435000000000002 26.08 65-69 24.23 24.59 25.215 25.965 70-74 24.044999999999998 25.195 24.69 26.07 75-79 23.849999999999998 24.94 24.985 26.224999999999998 80-84 23.7 24.845 25.035 26.419999999999998 85-89 24.005000000000003 24.905 25.224999999999998 25.865 90-94 24.515 24.705 24.9 25.88 95-99 24.175 24.555 25.814999999999998 25.455 100-104 24.365000000000002 24.675 24.915000000000003 26.045 105-109 24.005000000000003 25.14 24.97 25.885 110-114 24.385 25.005 24.585 26.025 115-119 24.349999999999998 25.055 24.365000000000002 26.229999999999997 120-124 24.6 25.22 24.015 26.165 125-129 24.560000000000002 25.09 24.38 25.97 130-134 24.535 25.185000000000002 24.205 26.075 135-139 24.275 25.369999999999997 24.22 26.135 140-144 24.43 25.665 24.285 25.619999999999997 145-149 23.955000000000002 25.840000000000003 24.075 26.13 150-151 24.9 24.7375 24.4 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.0 28 2.5 29 4.0 30 7.0 31 11.0 32 12.5 33 18.0 34 33.5 35 39.5 36 47.0 37 66.0 38 89.0 39 110.0 40 123.0 41 132.0 42 161.0 43 180.5 44 191.5 45 200.0 46 182.0 47 172.5 48 171.5 49 165.0 50 163.0 51 160.5 52 143.0 53 110.0 54 99.5 55 95.5 56 83.5 57 91.0 58 82.0 59 77.5 60 81.0 61 76.0 62 66.0 63 63.5 64 77.0 65 77.0 66 63.0 67 50.0 68 45.5 69 40.0 70 33.0 71 27.0 72 20.5 73 16.5 74 10.0 75 7.0 76 7.5 77 6.0 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.8625 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0125 0.0 0.0 126-127 6.65 0.0 0.025 0.0 0.0 128-129 7.15 0.0 0.025 0.0 0.0 130-131 7.8500000000000005 0.0 0.025 0.0 0.0 132-133 8.350000000000001 0.0 0.025 0.0 0.0 134-135 9.0125 0.0 0.025 0.0 0.0 136-137 9.7625 0.0 0.025 0.0 0.0 138-139 10.45 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578501 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578501_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51925 33.0 32.0 33.0 27.0 34.0 2 31.629 33.0 32.0 34.0 27.0 34.0 3 31.80525 33.0 32.0 34.0 28.0 34.0 4 31.4745 33.0 31.0 34.0 28.0 34.0 5 31.54925 33.0 31.0 34.0 29.0 34.0 6 35.4415 38.0 37.0 38.0 29.0 38.0 7 35.4065 38.0 37.0 38.0 29.0 38.0 8 35.481 38.0 37.0 38.0 29.0 38.0 9 35.48625 38.0 37.0 38.0 29.0 38.0 10-14 35.349599999999995 38.0 37.0 38.0 29.0 38.0 15-19 35.130399999999995 38.0 36.6 38.0 28.0 38.0 20-24 34.994150000000005 38.0 36.2 38.0 27.6 38.0 25-29 34.847300000000004 38.0 36.0 38.0 27.2 38.0 30-34 34.6914 38.0 36.0 38.0 27.0 38.0 35-39 34.534000000000006 38.0 36.0 38.0 25.8 38.0 40-44 34.1769 38.0 35.0 38.0 24.6 38.0 45-49 33.997 38.0 34.6 38.0 19.4 38.0 50-54 33.827549999999995 38.0 34.2 38.0 17.8 38.0 55-59 33.5199 38.0 34.0 38.0 16.0 38.0 60-64 33.29110000000001 38.0 33.8 38.0 16.0 38.0 65-69 32.90395 38.0 33.0 38.0 16.0 38.0 70-74 32.5526 37.6 32.6 38.0 15.8 38.0 75-79 31.986700000000003 37.0 29.8 38.0 15.0 38.0 80-84 31.4443 37.0 29.0 38.0 15.0 38.0 85-89 30.86655 36.2 27.8 38.0 14.6 38.0 90-94 30.254399999999997 36.0 26.0 38.0 13.4 38.0 95-99 29.5165 35.4 24.0 38.0 13.0 38.0 100-104 28.6712 34.8 21.8 38.0 8.6 38.0 105-109 27.740499999999997 34.0 16.2 38.0 2.0 38.0 110-114 26.75725 34.0 15.0 38.0 2.0 38.0 115-119 26.01265 33.6 14.8 38.0 2.0 38.0 120-124 24.970049999999997 32.2 14.0 37.4 2.0 38.0 125-129 23.561100000000003 29.0 13.0 36.4 2.0 38.0 130-134 21.9761 25.4 2.0 35.4 2.0 38.0 135-139 20.365949999999998 22.8 2.0 35.0 2.0 38.0 140-144 18.2519 15.4 2.0 34.2 2.0 38.0 145-149 16.134800000000002 6.6 2.0 34.0 2.0 38.0 150-151 12.315999999999999 2.0 2.0 29.0 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 13.0 4 10.0 5 13.0 6 14.0 7 9.0 8 8.0 9 5.0 10 9.0 11 13.0 12 19.0 13 18.0 14 32.0 15 21.0 16 36.0 17 47.0 18 57.0 19 49.0 20 70.0 21 55.0 22 80.0 23 85.0 24 97.0 25 117.0 26 131.0 27 131.0 28 149.0 29 180.0 30 234.0 31 244.0 32 298.0 33 323.0 34 377.0 35 435.0 36 409.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 17.424999999999997 11.875 29.675 2 29.025000000000002 23.325000000000003 26.55 21.099999999999998 3 23.85596399099775 25.98149537384346 24.256064016004 25.906476619154787 4 28.157039259814955 31.332833208302073 18.02950737684421 22.48062015503876 5 27.00675168792198 32.65816454113528 19.079769942485623 21.255313828457115 6 22.641981486114584 34.22566925193895 19.93995496622467 23.19239429572179 7 22.942206654991242 18.388791593695274 36.0270202651989 22.641981486114584 8 24.117205108940645 21.93839218632607 25.29426496368645 28.650137741046834 9 23.760640961442164 22.458688032048073 26.514772158237353 27.265898848272407 10-14 25.985277179628426 25.624718313385745 22.780309479693525 25.6096950272923 15-19 25.85378067100651 25.828743114672008 23.234852278417627 25.082623935903857 20-24 25.36932244979719 25.704842505884116 24.262607040913416 24.663228003405276 25-29 26.201682355297418 26.11155617865011 23.18245543761266 24.504306028439814 30-34 25.96543951915853 25.584773353368394 23.496118206862008 24.95366892061107 35-39 26.250939143501128 25.033809166040573 23.786626596543954 24.92862509391435 40-44 26.387219551282055 25.060096153846157 23.657852564102562 24.894831730769234 45-49 26.02012717168177 25.254093025584538 23.897261302758725 24.828518499974965 50-54 25.890129701036606 25.0287946316791 24.442886474034754 24.638189193249538 55-59 26.07781282860147 25.597115817936007 24.064894096439836 24.260177257022683 60-64 26.1352826315526 25.38426876282982 24.077504631252193 24.402943974365392 65-69 25.58838257386079 25.863795693540307 24.01602403605408 24.531797696544817 70-74 25.815176558978216 25.41948409717005 24.152266466316053 24.61307287753569 75-79 25.732458556618422 25.792557720238396 24.139830720689137 24.33515300245405 80-84 25.846523742736927 25.646163093568425 23.647565618112605 24.85974754558205 85-89 25.76250813842841 25.95282215655832 24.029648920719186 24.255020784294086 90-94 26.170798898071624 25.649887302779867 23.556223390934132 24.623090408214377 95-99 26.029249724531706 25.999198637684064 23.42482219773615 24.546729440048082 100-104 26.419629444166247 25.698547821732596 23.25488232348523 24.626940410615923 105-109 25.699974956173303 26.34610568494866 24.42273979464062 23.531179564237416 110-114 26.230904082143752 26.140746306035563 23.476083145504635 24.152266466316053 115-119 25.936686034862756 26.492686836305353 23.31697054698457 24.253656581847324 120-124 26.310781711653064 25.890129701036606 23.741799789673994 24.057288797636335 125-129 26.48767782007614 26.337407333199756 23.086555800440795 24.08835904628331 130-134 26.878381085954718 27.188940092165897 22.129833700661187 23.802845121218194 135-139 26.552173042259163 26.401962747846987 23.452833967554575 23.593030242339275 140-144 27.778334000800964 26.672006407689224 22.61714056868242 22.932519022827393 145-149 26.772836538461537 27.844551282051285 22.020232371794872 23.362379807692307 150-151 26.81522283425138 29.944917376064094 21.507260891337005 21.732598898347522 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 2.0 27 3.5 28 9.0 29 9.5 30 6.5 31 11.5 32 14.0 33 14.5 34 21.5 35 32.5 36 49.0 37 65.5 38 71.5 39 78.5 40 103.5 41 131.5 42 143.5 43 163.5 44 173.5 45 168.0 46 167.0 47 178.0 48 162.0 49 146.5 50 146.5 51 138.5 52 138.0 53 123.5 54 108.5 55 105.0 56 103.0 57 90.0 58 90.0 59 95.0 60 91.0 61 88.5 62 92.0 63 95.5 64 89.0 65 72.0 66 60.5 67 55.0 68 53.0 69 50.5 70 41.5 71 39.5 72 35.0 73 24.0 74 15.0 75 8.0 76 3.5 77 2.0 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.075 7 0.075 8 0.17500000000000002 9 0.15 10-14 0.155 15-19 0.15 20-24 0.155 25-29 0.13999999999999999 30-34 0.17500000000000002 35-39 0.17500000000000002 40-44 0.16 45-49 0.135 50-54 0.155 55-59 0.145 60-64 0.135 65-69 0.15 70-74 0.17500000000000002 75-79 0.165 80-84 0.18 85-89 0.165 90-94 0.17500000000000002 95-99 0.16999999999999998 100-104 0.15 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.18 120-124 0.155 125-129 0.18 130-134 0.18 135-139 0.13999999999999999 140-144 0.12 145-149 0.16 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7575757575757576 1.5 3 0.07575757575757576 0.22499999999999998 4 0.0 0.0 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.7874999999999996 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.6 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.362500000000001 0.0 0.0 0.0 0.0 138-139 5.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCTG 10 0.006830828 145.0 4 AGTACCT 10 0.006830828 145.0 3 GAGTACC 10 0.006830828 145.0 2 >>END_MODULE Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121736 spots for SRR5578501.sra Written 1121736 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra Read 1121725 spots for SRR5578501.sra Written 1121725 spots for SRR5578501.sra SRR ids: ['SRR5578501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fw80aj5h SRR5578501.sra spots: 22434511 blocks: [[1, 1121725], [1121726, 2243450], [2243451, 3365175], [3365176, 4486900], [4486901, 5608625], [5608626, 6730350], [6730351, 7852075], [7852076, 8973800], [8973801, 10095525], [10095526, 11217250], [11217251, 12338975], [12338976, 13460700], [13460701, 14582425], [14582426, 15704150], [15704151, 16825875], [16825876, 17947600], [17947601, 19069325], [19069326, 20191050], [20191051, 21312775], [21312776, 22434511]] SRR5578501 file size 7580619 SRR5578501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578501 SRR5578501_1.fastq SRR5578501_2.fastq Input file: SRR5578501_1.fastq Paired file: SRR5578501_2.fastq trimmed: SRR5578501-trimmed-pair1.fastq, SRR5578501-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:08:46 2024 >> started Mon Dec 9 21:09:14 2024 >> done (27.911s) 22434511 read pairs processed; of these: 75824 ( 0.34%) short read pairs filtered out after trimming by size control 66955 ( 0.30%) empty read pairs filtered out after trimming by size control 22291732 (99.36%) read pairs available; of these: 11399234 (51.14%) trimmed read pairs available after processing 10892498 (48.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 15 0.00% 22 14 0.00% 23 12 0.00% 24 14 0.00% 25 17 0.00% 26 18 0.00% 27 20 0.00% 28 22 0.00% 29 17 0.00% 30 27 0.00% 31 25 0.00% 32 15 0.00% 33 25 0.00% 34 17 0.00% 35 27 0.00% 36 46 0.00% 37 38 0.00% 38 34 0.00% 39 44 0.00% 40 47 0.00% 41 42 0.00% 42 71 0.00% 43 65 0.00% 44 84 0.00% 45 71 0.00% 46 110 0.00% 47 95 0.00% 48 131 0.00% 49 135 0.00% 50 167 0.00% 51 168 0.00% 52 195 0.00% 53 234 0.00% 54 267 0.00% 55 300 0.00% 56 315 0.00% 57 393 0.00% 58 434 0.00% 59 442 0.00% 60 548 0.00% 61 697 0.00% 62 759 0.00% 63 780 0.00% 64 893 0.00% 65 998 0.00% 66 1110 0.00% 67 1327 0.01% 68 1446 0.01% 69 1700 0.01% 70 2099 0.01% 71 2415 0.01% 72 2550 0.01% 73 2789 0.01% 74 2978 0.01% 75 3500 0.02% 76 3989 0.02% 77 4234 0.02% 78 4910 0.02% 79 5462 0.02% 80 6014 0.03% 81 6875 0.03% 82 7920 0.04% 83 9028 0.04% 84 11877 0.05% 85 13814 0.06% 86 13992 0.06% 87 15098 0.07% 88 15960 0.07% 89 16964 0.08% 90 18021 0.08% 91 19196 0.09% 92 20528 0.09% 93 21372 0.10% 94 23221 0.10% 95 24397 0.11% 96 25528 0.11% 97 27050 0.12% 98 27848 0.12% 99 29608 0.13% 100 31139 0.14% 101 32808 0.15% 102 34937 0.16% 103 36873 0.17% 104 38891 0.17% 105 40698 0.18% 106 43006 0.19% 107 44928 0.20% 108 46744 0.21% 109 48543 0.22% 110 50983 0.23% 111 52973 0.24% 112 55879 0.25% 113 58022 0.26% 114 60668 0.27% 115 64427 0.29% 116 65901 0.30% 117 68210 0.31% 118 70233 0.32% 119 72703 0.33% 120 75313 0.34% 121 78159 0.35% 122 81196 0.36% 123 84414 0.38% 124 88924 0.40% 125 91712 0.41% 126 95798 0.43% 127 98178 0.44% 128 100989 0.45% 129 105641 0.47% 130 108534 0.49% 131 111892 0.50% 132 116166 0.52% 133 121280 0.54% 134 127567 0.57% 135 134826 0.60% 136 139458 0.63% 137 145846 0.65% 138 151248 0.68% 139 160012 0.72% 140 169965 0.76% 141 182269 0.82% 142 197413 0.89% 143 215804 0.97% 144 239988 1.08% 145 276791 1.24% 146 327276 1.47% 147 410468 1.84% 148 572811 2.57% 149 984464 4.42% 150 4182537 18.76% 151 10892498 48.86% 22291732 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=12 prefix-density=0.90 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.32 sequence-density-rank=13 fanout-score=7.01 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=2.0 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=9 prefix-density=0.69 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.79 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=3.9 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578501 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:10:05 Started mapping on | Dec 09 21:10:05 Finished on | Dec 09 21:14:02 Mapping speed, Million of reads per hour | 338.61 Number of input reads | 22291732 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20769705 Uniquely mapped reads % | 93.17% Average mapped length | 289.84 Number of splices: Total | 21733501 Number of splices: Annotated (sjdb) | 20579782 Number of splices: GT/AG | 21446589 Number of splices: GC/AG | 259781 Number of splices: AT/AC | 10746 Number of splices: Non-canonical | 16385 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324557 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 37420 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 1.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1235082 1235082 1235082 N_multimapping 324557 324557 324557 N_noFeature 790757 20179484 966600 N_ambiguous 486278 2584 72415 UnstrandedReadsAssigned:19492670 PositiveStrandReadsAssigned:587637 NegativeStrandReadsAssigned:19730690 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR5578501 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578501-trimmed-pair1.fastq SRR5578501-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,291,732 reads, 19,877,371 reads pseudoaligned [quant] estimated average fragment length: 242.263 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR5578501.ke.tsv 35125 SRR5578501.se.tsv 88098 total ==> SRR5578501.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.087 0.00192937 0.000196528 PNS24247 1044 802.737 64.8175 5.71698 PNS24249 1928 1686.74 66.5317 2.79273 PNS24246 1044 802.737 64.8175 5.71698 PNS24248 1044 802.737 64.8175 5.71698 PNS24244 1471 1229.74 78.0139 4.49167 PNS24243 293 100.341 0 0 KQK14069 1603 1361.74 2251.92 117.087 KQK14071 474 246.699 51.3552 14.7389 ==> SRR5578501.se.tsv <== BRADI_1g14170v3 2565 BRADI_1g53295v3 74 BRADI_1g59795v3 642 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 2702 BRADI_1g74790v3 124 BRADI_1g09890v3 3 BRADI_1g77505v3 293 BRADI_1g48960v3 0 SRR5578501 completed mapping pipeline successfully