Starting /dee2/code/volunteer_pipeline.sh SRR5578502 current disk space = 1521725153280 free memory = 1573452972 SRR5578502 SRAfilesize 57534c534a13274633de40707453267a SRR5578502.sra SRR5578502.sra file validated SRR5578502 is paired end SRR5578502 is conventional basespace SRR5578502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.646 34.0 33.0 34.0 32.0 34.0 2 33.0285 34.0 33.0 34.0 31.0 34.0 3 33.15925 34.0 33.0 34.0 32.0 34.0 4 33.11025 34.0 33.0 34.0 32.0 34.0 5 33.28875 34.0 33.0 34.0 33.0 34.0 6 36.79425 38.0 37.0 38.0 35.0 38.0 7 37.2105 38.0 38.0 38.0 36.0 38.0 8 37.406 38.0 38.0 38.0 37.0 38.0 9 37.38225 38.0 38.0 38.0 37.0 38.0 10-14 37.3914 38.0 38.0 38.0 37.0 38.0 15-19 37.398649999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.393 38.0 38.0 38.0 37.0 38.0 25-29 37.35065 38.0 38.0 38.0 37.0 38.0 30-34 37.33985 38.0 38.0 38.0 37.0 38.0 35-39 37.27635 38.0 38.0 38.0 36.8 38.0 40-44 37.174249999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.082649999999994 38.0 38.0 38.0 36.0 38.0 50-54 37.04805 38.0 38.0 38.0 36.0 38.0 55-59 36.985200000000006 38.0 38.0 38.0 35.6 38.0 60-64 36.925999999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.8165 38.0 38.0 38.0 35.0 38.0 70-74 36.735499999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.66515 38.0 38.0 38.0 34.2 38.0 80-84 36.566700000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.36295 38.0 37.8 38.0 33.6 38.0 90-94 36.352 38.0 37.6 38.0 34.0 38.0 95-99 36.24135 38.0 37.4 38.0 33.4 38.0 100-104 36.0955 38.0 37.0 38.0 33.0 38.0 105-109 35.773450000000004 38.0 36.0 38.0 31.4 38.0 110-114 35.62915 38.0 36.0 38.0 31.2 38.0 115-119 35.47055 38.0 35.8 38.0 30.6 38.0 120-124 35.156349999999996 38.0 35.0 38.0 28.8 38.0 125-129 34.99465 38.0 35.0 38.0 28.4 38.0 130-134 34.4577 38.0 34.8 38.0 26.6 38.0 135-139 34.157 38.0 34.6 38.0 24.4 38.0 140-144 33.5002 38.0 34.0 38.0 21.4 38.0 145-149 32.673899999999996 38.0 33.6 38.0 14.0 38.0 150-151 28.034750000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 4.0 19 8.0 20 5.0 21 3.0 22 9.0 23 9.0 24 13.0 25 19.0 26 22.0 27 33.0 28 27.0 29 35.0 30 45.0 31 58.0 32 70.0 33 125.0 34 218.0 35 355.0 36 860.0 37 2072.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.92185850052798 9.899683210137274 8.896515311510033 39.281942977824706 2 24.6 13.725000000000001 33.050000000000004 28.625 3 23.55588897224306 17.97949487371843 22.630657664416105 35.83395848962241 4 28.7 24.9 19.875 26.525 5 28.375 28.725 21.55 21.349999999999998 6 23.974999999999998 30.55 23.225 22.25 7 19.625 21.55 37.824999999999996 21.0 8 22.55 22.0 27.450000000000003 28.000000000000004 9 21.6 21.175 32.2 25.025 10-14 24.785 25.835 23.635 25.745 15-19 24.474999999999998 24.09 25.055 26.38 20-24 24.845 24.515 25.05 25.590000000000003 25-29 24.565 24.43 24.585 26.419999999999998 30-34 24.635 23.815 25.045 26.505000000000003 35-39 24.765 23.919999999999998 24.42 26.895000000000003 40-44 24.97 24.11 24.775 26.145000000000003 45-49 25.525 23.385 24.39 26.700000000000003 50-54 25.455 23.76 24.224999999999998 26.56 55-59 25.91 23.825 23.75 26.515 60-64 25.885 23.78 24.15 26.185000000000002 65-69 25.705 23.695 24.345 26.255 70-74 25.46 23.474999999999998 24.035 27.029999999999998 75-79 24.945 23.87 24.46 26.724999999999998 80-84 25.715 24.165 24.265 25.855 85-89 25.495 23.79 23.835 26.88 90-94 26.255 23.380000000000003 23.91 26.455000000000002 95-99 25.535000000000004 24.035 24.490000000000002 25.94 100-104 25.945 24.23 23.56 26.265 105-109 26.19 23.849999999999998 23.7 26.26 110-114 25.85 24.85 23.185 26.115 115-119 26.695 23.65 23.735 25.919999999999998 120-124 25.88 23.64 23.86 26.619999999999997 125-129 25.89 24.0 23.32 26.790000000000003 130-134 26.41 24.145 23.380000000000003 26.064999999999998 135-139 25.759999999999998 24.125 23.195 26.919999999999998 140-144 25.7 24.09 23.64 26.57 145-149 25.869999999999997 24.59 23.13 26.41 150-151 25.825 23.6125 23.7 26.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 2.0 27 2.0 28 4.5 29 8.5 30 9.5 31 12.0 32 11.5 33 18.0 34 26.0 35 32.0 36 41.0 37 58.0 38 71.0 39 79.5 40 99.5 41 124.0 42 143.5 43 157.5 44 160.0 45 158.5 46 162.5 47 169.5 48 160.5 49 132.0 50 126.5 51 117.5 52 109.5 53 102.0 54 85.5 55 88.5 56 104.0 57 119.0 58 114.5 59 99.5 60 96.5 61 102.0 62 93.5 63 85.0 64 85.5 65 81.0 66 79.0 67 73.5 68 68.5 69 68.0 70 59.5 71 45.5 72 36.5 73 31.5 74 24.5 75 21.0 76 13.0 77 7.5 78 6.5 79 4.5 80 3.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7652196249679 95.15 2 1.875160544567172 3.65 3 0.23118417672745953 0.675 4 0.10274852298998202 0.4 5 0.025687130747495505 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAAAGGAAAAACGCAAAGCAAAATGCCATGGTTGACGAAACCGGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.1375000000000002 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.775 0.0 0.0 0.0 0.0 114-115 4.300000000000001 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.7375 0.0 0.0 0.0 0.0 122-123 6.2375 0.0 0.0 0.0 0.0 124-125 6.675000000000001 0.0 0.0 0.0 0.0 126-127 7.275 0.0 0.0 0.0 0.0 128-129 7.875 0.0 0.0 0.0 0.0 130-131 8.4625 0.0 0.0 0.0 0.0 132-133 8.9875 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.175 0.0 0.0 0.0 0.0 138-139 10.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGTC 10 0.0068378756 144.95 4 >>END_MODULE SRR5578502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76025 33.0 33.0 34.0 32.0 34.0 2 32.8495 33.0 33.0 34.0 32.0 34.0 3 32.783 33.0 33.0 34.0 32.0 34.0 4 32.78775 33.0 33.0 34.0 32.0 34.0 5 32.79425 33.0 33.0 34.0 32.0 34.0 6 36.84525 38.0 38.0 38.0 36.0 38.0 7 36.934 38.0 38.0 38.0 36.0 38.0 8 36.9875 38.0 38.0 38.0 36.0 38.0 9 36.904 38.0 38.0 38.0 36.0 38.0 10-14 36.942 38.0 38.0 38.0 36.0 38.0 15-19 36.92379999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.886900000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.83735 38.0 38.0 38.0 36.0 38.0 30-34 36.8762 38.0 38.0 38.0 36.0 38.0 35-39 36.862700000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.85435 38.0 38.0 38.0 36.0 38.0 45-49 36.8106 38.0 38.0 38.0 36.0 38.0 50-54 36.69425 38.0 38.0 38.0 35.2 38.0 55-59 36.60985 38.0 38.0 38.0 35.0 38.0 60-64 36.539550000000006 38.0 38.0 38.0 34.8 38.0 65-69 36.565549999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.3378 38.0 38.0 38.0 34.2 38.0 75-79 36.3301 38.0 38.0 38.0 34.0 38.0 80-84 36.32115 38.0 38.0 38.0 34.0 38.0 85-89 36.105599999999995 38.0 38.0 38.0 33.4 38.0 90-94 36.0105 38.0 38.0 38.0 33.0 38.0 95-99 35.84815 38.0 38.0 38.0 32.8 38.0 100-104 35.61445 38.0 37.0 38.0 32.0 38.0 105-109 35.4305 38.0 36.6 38.0 31.0 38.0 110-114 35.37585 38.0 36.0 38.0 31.0 38.0 115-119 35.14465 38.0 36.0 38.0 28.8 38.0 120-124 34.715250000000005 38.0 35.2 38.0 27.0 38.0 125-129 34.467699999999994 38.0 35.0 38.0 26.2 38.0 130-134 33.895599999999995 38.0 34.2 38.0 22.8 38.0 135-139 33.258300000000006 38.0 33.2 38.0 18.6 38.0 140-144 32.41955 38.0 32.6 38.0 12.8 38.0 145-149 31.0499 38.0 30.6 38.0 6.0 38.0 150-151 25.941125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 5.0 5 4.0 6 3.0 7 2.0 8 3.0 9 2.0 10 2.0 11 1.0 12 2.0 13 2.0 14 5.0 15 5.0 16 7.0 17 6.0 18 8.0 19 4.0 20 12.0 21 8.0 22 21.0 23 12.0 24 11.0 25 23.0 26 21.0 27 36.0 28 44.0 29 37.0 30 50.0 31 61.0 32 78.0 33 122.0 34 203.0 35 335.0 36 798.0 37 2056.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9 16.475 10.8 33.825 2 28.175 23.400000000000002 27.150000000000002 21.275 3 22.85 24.45 25.25 27.450000000000003 4 27.575 29.299999999999997 18.675 24.45 5 27.900000000000002 32.775 18.875 20.45 6 22.625 33.125 19.900000000000002 24.349999999999998 7 23.025000000000002 17.175 33.975 25.825 8 25.1 22.0 22.075 30.825000000000003 9 24.325 20.525 27.474999999999998 27.675 10-14 26.555 24.505 21.945 26.995 15-19 26.25 24.34 22.884999999999998 26.525 20-24 26.674999999999997 24.455 23.135 25.735000000000003 25-29 26.290000000000003 24.795 22.84 26.075 30-34 25.86 24.6 23.425 26.115 35-39 26.155 24.305 23.145 26.395000000000003 40-44 26.46 24.474999999999998 22.8 26.265 45-49 26.615 23.76 23.465 26.16 50-54 26.334999999999997 23.82 23.365 26.479999999999997 55-59 26.57 24.14 23.169999999999998 26.119999999999997 60-64 25.97 23.925 23.07 27.034999999999997 65-69 26.040000000000003 23.810000000000002 22.900000000000002 27.250000000000004 70-74 26.290000000000003 23.07 23.965 26.674999999999997 75-79 25.665 23.9 23.185 27.250000000000004 80-84 26.674999999999997 23.880000000000003 22.985 26.46 85-89 26.724999999999998 23.674999999999997 23.13 26.47 90-94 27.474999999999998 23.16 23.05 26.314999999999998 95-99 25.785000000000004 24.59 23.375 26.25 100-104 27.08 23.76 23.275000000000002 25.885 105-109 25.869999999999997 24.62 22.895 26.615 110-114 26.529999999999998 24.83 23.064999999999998 25.575 115-119 27.73 24.725 22.465 25.080000000000002 120-124 26.955000000000002 24.529999999999998 22.785 25.729999999999997 125-129 27.900000000000002 25.215 22.29 24.595 130-134 28.605000000000004 24.77 22.63 23.995 135-139 28.13 24.575 23.32 23.974999999999998 140-144 28.095 25.405 22.634999999999998 23.865 145-149 28.735 24.715 22.695 23.855 150-151 28.812500000000004 24.8125 22.0125 24.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 1.0 27 0.0 28 3.5 29 5.5 30 4.5 31 6.5 32 9.5 33 12.5 34 17.5 35 24.5 36 34.5 37 49.0 38 57.5 39 68.5 40 84.0 41 104.5 42 124.5 43 134.5 44 148.0 45 146.5 46 157.5 47 168.5 48 145.0 49 133.5 50 131.5 51 121.0 52 118.0 53 108.0 54 104.5 55 102.0 56 89.5 57 100.0 58 122.0 59 127.0 60 115.0 61 126.5 62 118.5 63 92.0 64 98.5 65 96.0 66 90.0 67 87.0 68 76.5 69 68.5 70 60.0 71 55.5 72 47.5 73 28.5 74 18.0 75 13.5 76 10.0 77 12.0 78 9.0 79 5.0 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7914740626605 95.19999999999999 2 1.874678993323061 3.65 3 0.25680534155110424 0.75 4 0.0 0.0 5 0.05136106831022085 0.25 6 0.025680534155110426 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 5 0.125 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.4 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.4 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.4125 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.4625 0.0 0.0 0.0 0.0 128-129 8.1375 0.0 0.0 0.0 0.0 130-131 8.7375 0.0 0.0 0.0 0.0 132-133 9.2875 0.0 0.0 0.0 0.0 134-135 9.825 0.0 0.0 0.0 0.0 136-137 10.524999999999999 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCGC 10 0.006830828 145.0 6 CGCGTCG 10 0.006830828 145.0 7 >>END_MODULE Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367826 spots for SRR5578502.sra Written 1367826 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra Read 1367824 spots for SRR5578502.sra Written 1367824 spots for SRR5578502.sra SRR ids: ['SRR5578502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_upag8dsg SRR5578502.sra spots: 27356482 blocks: [[1, 1367824], [1367825, 2735648], [2735649, 4103472], [4103473, 5471296], [5471297, 6839120], [6839121, 8206944], [8206945, 9574768], [9574769, 10942592], [10942593, 12310416], [12310417, 13678240], [13678241, 15046064], [15046065, 16413888], [16413889, 17781712], [17781713, 19149536], [19149537, 20517360], [20517361, 21885184], [21885185, 23253008], [23253009, 24620832], [24620833, 25988656], [25988657, 27356482]] SRR5578502 file size 9248513 SRR5578502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578502 SRR5578502_1.fastq SRR5578502_2.fastq Input file: SRR5578502_1.fastq Paired file: SRR5578502_2.fastq trimmed: SRR5578502-trimmed-pair1.fastq, SRR5578502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:06:39 2024 >> started Mon Dec 9 21:07:13 2024 >> done (33.271s) 27356482 read pairs processed; of these: 37884 ( 0.14%) short read pairs filtered out after trimming by size control 38637 ( 0.14%) empty read pairs filtered out after trimming by size control 27279961 (99.72%) read pairs available; of these: 15300265 (56.09%) trimmed read pairs available after processing 11979696 (43.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 20 0.00% 21 18 0.00% 22 15 0.00% 23 11 0.00% 24 19 0.00% 25 25 0.00% 26 21 0.00% 27 25 0.00% 28 14 0.00% 29 29 0.00% 30 37 0.00% 31 40 0.00% 32 44 0.00% 33 36 0.00% 34 32 0.00% 35 44 0.00% 36 36 0.00% 37 65 0.00% 38 65 0.00% 39 63 0.00% 40 67 0.00% 41 74 0.00% 42 85 0.00% 43 104 0.00% 44 103 0.00% 45 123 0.00% 46 135 0.00% 47 154 0.00% 48 212 0.00% 49 211 0.00% 50 250 0.00% 51 326 0.00% 52 319 0.00% 53 332 0.00% 54 371 0.00% 55 444 0.00% 56 453 0.00% 57 495 0.00% 58 639 0.00% 59 681 0.00% 60 807 0.00% 61 943 0.00% 62 1028 0.00% 63 1216 0.00% 64 1330 0.00% 65 1480 0.01% 66 1748 0.01% 67 1937 0.01% 68 2227 0.01% 69 2588 0.01% 70 2849 0.01% 71 3217 0.01% 72 3714 0.01% 73 4230 0.02% 74 4742 0.02% 75 5145 0.02% 76 5813 0.02% 77 6427 0.02% 78 7286 0.03% 79 8122 0.03% 80 9199 0.03% 81 10355 0.04% 82 11577 0.04% 83 12673 0.05% 84 15335 0.06% 85 17090 0.06% 86 18401 0.07% 87 19842 0.07% 88 21173 0.08% 89 22333 0.08% 90 24019 0.09% 91 25897 0.09% 92 27186 0.10% 93 29325 0.11% 94 31433 0.12% 95 33530 0.12% 96 35041 0.13% 97 37512 0.14% 98 38950 0.14% 99 41169 0.15% 100 42903 0.16% 101 45220 0.17% 102 47557 0.17% 103 50234 0.18% 104 52811 0.19% 105 54736 0.20% 106 58774 0.22% 107 60427 0.22% 108 62221 0.23% 109 65242 0.24% 110 67060 0.25% 111 68913 0.25% 112 72214 0.26% 113 75069 0.28% 114 78944 0.29% 115 82609 0.30% 116 84070 0.31% 117 87915 0.32% 118 88647 0.32% 119 90638 0.33% 120 94300 0.35% 121 95793 0.35% 122 99823 0.37% 123 102491 0.38% 124 106943 0.39% 125 110165 0.40% 126 114756 0.42% 127 116702 0.43% 128 118819 0.44% 129 122544 0.45% 130 126589 0.46% 131 128732 0.47% 132 133596 0.49% 133 138497 0.51% 134 142754 0.52% 135 147807 0.54% 136 153951 0.56% 137 157439 0.58% 138 165879 0.61% 139 176203 0.65% 140 185271 0.68% 141 199175 0.73% 142 217416 0.80% 143 236945 0.87% 144 266761 0.98% 145 310027 1.14% 146 376122 1.38% 147 497134 1.82% 148 738607 2.71% 149 1436762 5.27% 150 6390905 23.43% 151 11979696 43.91% 27279961 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=1.15 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.37 sequence-density-rank=27 fanout-score=12.35 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=11 prefix-density=1.35 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=30.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578502 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:07:59 Started mapping on | Dec 09 21:07:59 Finished on | Dec 09 21:11:59 Mapping speed, Million of reads per hour | 409.20 Number of input reads | 27279961 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 25819088 Uniquely mapped reads % | 94.64% Average mapped length | 289.58 Number of splices: Total | 24909166 Number of splices: Annotated (sjdb) | 23577388 Number of splices: GT/AG | 24590310 Number of splices: GC/AG | 293370 Number of splices: AT/AC | 7055 Number of splices: Non-canonical | 18431 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217875 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 25357 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1266589 1266589 1266589 N_multimapping 217875 217875 217875 N_noFeature 818007 25023238 1045260 N_ambiguous 671940 2587 105074 UnstrandedReadsAssigned:24329141 PositiveStrandReadsAssigned:793263 NegativeStrandReadsAssigned:24668754 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5578502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578502-trimmed-pair1.fastq SRR5578502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,279,961 reads, 24,658,454 reads pseudoaligned [quant] estimated average fragment length: 234.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52973 SRR5578502.ke.tsv 35125 SRR5578502.se.tsv 88098 total ==> SRR5578502.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.817 0 0 PNS24247 1044 810.378 32.8347 2.21656 PNS24249 1928 1694.38 60.8892 1.96591 PNS24246 1044 810.378 32.8347 2.21656 PNS24248 1044 810.378 32.8347 2.21656 PNS24244 1471 1237.38 67.6066 2.98896 PNS24243 293 106.13 0 0 KQK14069 1603 1369.38 3618.93 144.574 KQK14071 474 254.512 145.005 31.1679 ==> SRR5578502.se.tsv <== BRADI_1g14170v3 4464 BRADI_1g53295v3 90 BRADI_1g59795v3 860 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 501 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR5578502 completed mapping pipeline successfully