Starting /dee2/code/volunteer_pipeline.sh SRR5578503 current disk space = 1521841950720 free memory = 1563699660 SRR5578503 SRAfilesize 625ee36b9f5475974721df05953002a2 SRR5578503.sra SRR5578503.sra file validated SRR5578503 is paired end SRR5578503 is conventional basespace SRR5578503 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56625 34.0 34.0 34.0 33.0 34.0 2 33.3235 34.0 34.0 34.0 33.0 34.0 3 33.46725 34.0 34.0 34.0 33.0 34.0 4 33.53625 34.0 34.0 34.0 33.0 34.0 5 33.43025 34.0 34.0 34.0 33.0 34.0 6 37.09775 38.0 38.0 38.0 36.0 38.0 7 37.44325 38.0 38.0 38.0 37.0 38.0 8 37.5235 38.0 38.0 38.0 38.0 38.0 9 37.6 38.0 38.0 38.0 38.0 38.0 10-14 37.5516 38.0 38.0 38.0 38.0 38.0 15-19 37.5745 38.0 38.0 38.0 38.0 38.0 20-24 37.561 38.0 38.0 38.0 38.0 38.0 25-29 37.56165 38.0 38.0 38.0 38.0 38.0 30-34 37.53685 38.0 38.0 38.0 38.0 38.0 35-39 37.4816 38.0 38.0 38.0 37.6 38.0 40-44 37.4188 38.0 38.0 38.0 37.2 38.0 45-49 37.37595 38.0 38.0 38.0 37.0 38.0 50-54 37.32875 38.0 38.0 38.0 37.0 38.0 55-59 37.299099999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.29065 38.0 38.0 38.0 36.8 38.0 65-69 37.1446 38.0 38.0 38.0 36.0 38.0 70-74 37.0856 38.0 38.0 38.0 36.0 38.0 75-79 37.0885 38.0 38.0 38.0 35.8 38.0 80-84 37.023250000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.882999999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.840700000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.6724 38.0 38.0 38.0 34.8 38.0 100-104 36.556850000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.42470000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.32000000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.094350000000006 38.0 37.2 38.0 33.2 38.0 120-124 35.886100000000006 38.0 37.0 38.0 32.6 38.0 125-129 35.587599999999995 38.0 36.2 38.0 31.6 38.0 130-134 35.369350000000004 38.0 36.0 38.0 31.0 38.0 135-139 35.072649999999996 38.0 35.4 38.0 29.0 38.0 140-144 34.664 38.0 35.0 38.0 27.8 38.0 145-149 33.807100000000005 38.0 34.8 38.0 23.2 38.0 150-151 30.033125 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 3.0 17 0.0 18 2.0 19 2.0 20 3.0 21 11.0 22 5.0 23 9.0 24 11.0 25 15.0 26 12.0 27 13.0 28 18.0 29 27.0 30 36.0 31 40.0 32 65.0 33 78.0 34 123.0 35 243.0 36 652.0 37 2629.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.21290322580645 9.316129032258065 9.98709677419355 35.483870967741936 2 26.1 13.05 30.55 30.3 3 23.95598899724931 18.754688672168044 22.85571392848212 34.433608402100525 4 28.999999999999996 24.6 20.8 25.6 5 27.726247179744295 29.330659313111056 20.907495612935573 22.035597894209076 6 22.575 32.45 23.1 21.875 7 19.55 22.025 38.625 19.8 8 22.025 21.875 28.625 27.474999999999998 9 21.525 21.475 30.85 26.150000000000002 10-14 24.779999999999998 25.645 24.58 24.995 15-19 24.14 25.005 24.89 25.965 20-24 24.255 25.31 24.515 25.919999999999998 25-29 24.29 24.55 25.56 25.6 30-34 24.415 24.490000000000002 25.085 26.009999999999998 35-39 24.695 24.310000000000002 24.48 26.515 40-44 24.611230561528078 24.486224311215558 24.616230811540575 26.286314315715785 45-49 24.044999999999998 24.185000000000002 25.245 26.525 50-54 23.655 24.515 25.474999999999998 26.355 55-59 24.15 24.12 25.324999999999996 26.405 60-64 24.825 24.145 25.155 25.874999999999996 65-69 24.545 24.62 24.965 25.869999999999997 70-74 24.91 24.59 24.005000000000003 26.495 75-79 24.57 24.665 25.095 25.669999999999998 80-84 24.265 24.705 24.81 26.22 85-89 24.705 24.45 24.165 26.68 90-94 25.64 24.36 24.7 25.3 95-99 24.7 24.26 24.985 26.055 100-104 25.06 24.585 24.665 25.69 105-109 25.05 24.535 24.485 25.929999999999996 110-114 25.535000000000004 24.45 23.84 26.174999999999997 115-119 25.22 24.765 23.580000000000002 26.435 120-124 25.27642967929154 25.01626056937009 23.890528843748438 25.81678090758993 125-129 24.893648966518192 24.56333516840999 24.303087933536858 26.239927931534957 130-134 24.488161385593433 25.619462381738998 23.922510887520648 25.96986534514692 135-139 24.634634634634633 24.65965965965966 24.16916916916917 26.536536536536538 140-144 24.498674801220183 24.753713056958542 24.243636545481824 26.50397559633945 145-149 24.647464746474647 25.072507250725074 23.682368236823685 26.5976597659766 150-151 24.65890599574415 24.233320816122166 24.208286393791465 26.89948679434222 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 2.5 28 4.5 29 5.5 30 7.5 31 11.0 32 12.5 33 15.5 34 22.0 35 32.0 36 47.0 37 58.5 38 84.0 39 105.5 40 110.0 41 129.5 42 160.5 43 168.0 44 166.5 45 186.0 46 182.0 47 184.0 48 173.5 49 146.5 50 150.0 51 142.0 52 126.5 53 116.0 54 104.0 55 97.5 56 103.0 57 95.0 58 75.0 59 68.0 60 69.0 61 66.5 62 72.0 63 80.5 64 73.0 65 64.5 66 65.0 67 63.5 68 54.0 69 51.5 70 44.0 71 33.0 72 37.5 73 36.5 74 28.5 75 22.5 76 17.0 77 10.5 78 6.0 79 4.5 80 3.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.025 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.065 125-129 0.095 130-134 0.11499999999999999 135-139 0.1 140-144 0.015 145-149 0.01 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.1124999999999998 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.5125 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.675 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.275 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.637499999999999 0.0 0.0 0.0 0.0 112-113 6.2 0.0 0.0 0.0 0.0 114-115 6.9125 0.0 0.0 0.0 0.0 116-117 7.65 0.0 0.0 0.0 0.0 118-119 8.5 0.0 0.0 0.0 0.0 120-121 9.1 0.0 0.0 0.0 0.0 122-123 9.725 0.0 0.0 0.0 0.0 124-125 10.600000000000001 0.0 0.0 0.0 0.0 126-127 11.2875 0.0 0.0 0.0 0.0 128-129 12.0375 0.0 0.0 0.0 0.0 130-131 12.95 0.0 0.0 0.0 0.0 132-133 13.925 0.0 0.0 0.0 0.0 134-135 14.8875 0.0 0.0 0.0 0.0 136-137 15.850000000000001 0.0 0.0 0.0 0.0 138-139 16.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACT 10 0.0060966536 150.54546 1 AAAGATC 10 0.0068449317 144.90001 9 >>END_MODULE SRR5578503 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578503_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96175 33.0 33.0 34.0 32.0 34.0 2 33.0525 34.0 33.0 34.0 32.0 34.0 3 33.12575 34.0 33.0 34.0 33.0 34.0 4 33.0285 34.0 33.0 34.0 32.0 34.0 5 33.026 34.0 33.0 34.0 33.0 34.0 6 37.15175 38.0 38.0 38.0 37.0 38.0 7 37.22475 38.0 38.0 38.0 37.0 38.0 8 37.1105 38.0 38.0 38.0 37.0 38.0 9 37.0615 38.0 38.0 38.0 37.0 38.0 10-14 37.15 38.0 38.0 38.0 37.0 38.0 15-19 37.08685 38.0 38.0 38.0 37.0 38.0 20-24 37.082100000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0179 38.0 38.0 38.0 36.6 38.0 30-34 37.048550000000006 38.0 38.0 38.0 36.8 38.0 35-39 37.0677 38.0 38.0 38.0 36.8 38.0 40-44 37.048700000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.04065 38.0 38.0 38.0 36.8 38.0 50-54 37.00505 38.0 38.0 38.0 36.4 38.0 55-59 36.92315 38.0 38.0 38.0 36.0 38.0 60-64 36.8063 38.0 38.0 38.0 35.8 38.0 65-69 36.75365000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.61465 38.0 38.0 38.0 35.0 38.0 75-79 36.5678 38.0 38.0 38.0 35.0 38.0 80-84 36.4548 38.0 38.0 38.0 34.2 38.0 85-89 36.378750000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.207300000000004 38.0 38.0 38.0 33.8 38.0 95-99 35.92144999999999 38.0 38.0 38.0 33.0 38.0 100-104 35.76925 38.0 37.6 38.0 32.8 38.0 105-109 35.51985 38.0 37.0 38.0 31.2 38.0 110-114 35.326800000000006 38.0 36.6 38.0 30.6 38.0 115-119 34.99405 38.0 36.0 38.0 28.4 38.0 120-124 34.7609 38.0 35.2 38.0 27.6 38.0 125-129 34.20425 38.0 34.8 38.0 24.4 38.0 130-134 33.662150000000004 38.0 34.2 38.0 21.8 38.0 135-139 32.6872 38.0 32.4 38.0 16.2 38.0 140-144 31.7014 38.0 31.4 38.0 13.2 38.0 145-149 30.1222 36.6 30.2 38.0 4.2 38.0 150-151 24.451625 31.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 0.0 6 3.0 7 1.0 8 1.0 9 3.0 10 2.0 11 2.0 12 3.0 13 4.0 14 5.0 15 5.0 16 7.0 17 7.0 18 4.0 19 9.0 20 6.0 21 7.0 22 11.0 23 12.0 24 20.0 25 20.0 26 28.0 27 29.0 28 33.0 29 54.0 30 54.0 31 68.0 32 78.0 33 127.0 34 216.0 35 373.0 36 815.0 37 1982.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 16.1 12.8 30.2 2 30.607651912978245 22.80570142535634 24.781195298824706 21.80545136284071 3 24.2 26.150000000000002 24.474999999999998 25.174999999999997 4 28.00700175043761 31.13278319579895 17.75443860965241 23.10577644411103 5 26.319739804853644 32.34926194645985 20.165123842882164 21.165874405804352 6 23.474999999999998 32.824999999999996 20.325 23.375 7 22.275 18.224999999999998 34.35 25.15 8 25.1 22.525000000000002 22.650000000000002 29.725 9 24.2 21.675 25.95 28.175 10-14 26.369999999999997 25.380000000000003 22.57 25.679999999999996 15-19 25.650000000000002 25.515 23.285 25.55 20-24 26.790000000000003 24.865000000000002 23.225 25.119999999999997 25-29 26.484999999999996 24.48 23.79 25.245 30-34 25.515 25.264999999999997 23.79 25.430000000000003 35-39 25.729999999999997 24.52 23.419999999999998 26.33 40-44 26.35 24.58 23.49 25.580000000000002 45-49 26.685 24.515 23.84 24.959999999999997 50-54 26.479999999999997 24.84 23.16 25.52 55-59 27.155 24.72 22.884999999999998 25.240000000000002 60-64 26.025 24.315 23.425 26.235000000000003 65-69 26.51 24.115000000000002 24.175 25.2 70-74 26.545 24.490000000000002 23.11 25.855 75-79 26.150000000000002 24.55 23.645 25.655 80-84 26.825 24.45 23.325000000000003 25.4 85-89 26.14 24.54 23.945 25.374999999999996 90-94 26.174999999999997 24.92 23.400000000000002 25.505 95-99 26.845000000000002 24.95 23.035 25.169999999999998 100-104 27.355 25.345000000000002 22.405 24.895 105-109 26.490000000000002 25.605 23.35 24.555 110-114 27.26 25.805 22.895 24.04 115-119 27.665 24.755 23.505000000000003 24.075 120-124 27.605 24.945 23.22 24.23 125-129 28.075 25.72 22.775000000000002 23.43 130-134 28.465 24.935 23.39 23.21 135-139 28.465 25.679999999999996 22.845 23.01 140-144 28.71 25.83 22.830000000000002 22.63 145-149 28.615000000000002 25.419999999999998 23.165 22.8 150-151 29.32932932932933 25.93843843843844 22.347347347347345 22.384884884884883 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 2.0 27 4.0 28 5.5 29 4.5 30 5.5 31 10.5 32 13.5 33 16.0 34 18.5 35 22.5 36 36.5 37 56.5 38 67.5 39 79.0 40 88.0 41 98.5 42 129.0 43 153.0 44 164.0 45 167.5 46 157.5 47 159.5 48 177.0 49 181.5 50 164.5 51 135.5 52 116.0 53 115.0 54 108.5 55 97.5 56 96.0 57 101.0 58 93.0 59 84.5 60 87.0 61 89.5 62 95.0 63 91.5 64 81.0 65 77.5 66 74.5 67 65.0 68 65.0 69 72.5 70 64.5 71 44.0 72 34.5 73 36.5 74 28.0 75 18.0 76 16.0 77 11.0 78 5.5 79 3.0 80 3.0 81 2.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65448083269865 97.15 2 1.1424219345011426 2.25 3 0.20309723280020311 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.95 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.6875 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.8875 0.0 0.0 0.0 0.0 106-107 4.275 0.0 0.0 0.0 0.0 108-109 4.875 0.0 0.0 0.0 0.0 110-111 5.6 0.0 0.0 0.0 0.0 112-113 6.137499999999999 0.0 0.0 0.0 0.0 114-115 6.8125 0.0 0.0 0.0 0.0 116-117 7.525 0.0 0.0 0.0 0.0 118-119 8.4375 0.0 0.0 0.0 0.0 120-121 9.05 0.0 0.0 0.0 0.0 122-123 9.6375 0.0 0.0 0.0 0.0 124-125 10.5125 0.0 0.0 0.0 0.0 126-127 11.1875 0.0 0.0 0.0 0.0 128-129 11.8875 0.0 0.0 0.0 0.0 130-131 12.787500000000001 0.0 0.0 0.0 0.0 132-133 13.825 0.0 0.0 0.0 0.0 134-135 14.825 0.0 0.0 0.0 0.0 136-137 15.899999999999999 0.0 0.0 0.0 0.0 138-139 16.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTTA 10 0.006832588 144.9875 2 ATTAAGC 10 0.006832588 144.9875 6 GTCTTTC 10 0.006832588 144.9875 3 TTAAGCA 10 0.006832588 144.9875 7 AAAAACG 10 0.006832588 144.9875 8 >>END_MODULE Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175526 spots for SRR5578503.sra Written 1175526 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra Read 1175512 spots for SRR5578503.sra Written 1175512 spots for SRR5578503.sra SRR ids: ['SRR5578503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f22jdb08 SRR5578503.sra spots: 23510254 blocks: [[1, 1175512], [1175513, 2351024], [2351025, 3526536], [3526537, 4702048], [4702049, 5877560], [5877561, 7053072], [7053073, 8228584], [8228585, 9404096], [9404097, 10579608], [10579609, 11755120], [11755121, 12930632], [12930633, 14106144], [14106145, 15281656], [15281657, 16457168], [16457169, 17632680], [17632681, 18808192], [18808193, 19983704], [19983705, 21159216], [21159217, 22334728], [22334729, 23510254]] SRR5578503 file size 7945153 SRR5578503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578503 SRR5578503_1.fastq SRR5578503_2.fastq Input file: SRR5578503_1.fastq Paired file: SRR5578503_2.fastq trimmed: SRR5578503-trimmed-pair1.fastq, SRR5578503-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:15:25 2024 >> started Mon Dec 9 21:15:52 2024 >> done (27.498s) 23510254 read pairs processed; of these: 27051 ( 0.12%) short read pairs filtered out after trimming by size control 27862 ( 0.12%) empty read pairs filtered out after trimming by size control 23455341 (99.77%) read pairs available; of these: 13284980 (56.64%) trimmed read pairs available after processing 10170361 (43.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 19 0.00% 20 20 0.00% 21 19 0.00% 22 18 0.00% 23 21 0.00% 24 21 0.00% 25 32 0.00% 26 21 0.00% 27 33 0.00% 28 28 0.00% 29 21 0.00% 30 37 0.00% 31 35 0.00% 32 46 0.00% 33 38 0.00% 34 42 0.00% 35 32 0.00% 36 57 0.00% 37 66 0.00% 38 68 0.00% 39 82 0.00% 40 78 0.00% 41 121 0.00% 42 109 0.00% 43 135 0.00% 44 181 0.00% 45 179 0.00% 46 186 0.00% 47 212 0.00% 48 244 0.00% 49 281 0.00% 50 360 0.00% 51 407 0.00% 52 459 0.00% 53 477 0.00% 54 532 0.00% 55 693 0.00% 56 677 0.00% 57 807 0.00% 58 985 0.00% 59 1118 0.00% 60 1263 0.01% 61 1437 0.01% 62 1611 0.01% 63 1858 0.01% 64 2060 0.01% 65 2341 0.01% 66 2739 0.01% 67 3242 0.01% 68 4002 0.02% 69 6501 0.03% 70 6717 0.03% 71 5727 0.02% 72 6162 0.03% 73 6733 0.03% 74 7480 0.03% 75 8178 0.03% 76 9105 0.04% 77 10130 0.04% 78 11398 0.05% 79 12876 0.05% 80 14250 0.06% 81 15864 0.07% 82 17521 0.07% 83 19462 0.08% 84 22442 0.10% 85 24420 0.10% 86 25787 0.11% 87 27711 0.12% 88 29982 0.13% 89 31700 0.14% 90 33698 0.14% 91 36395 0.16% 92 38474 0.16% 93 41404 0.18% 94 43811 0.19% 95 45603 0.19% 96 47839 0.20% 97 50797 0.22% 98 52046 0.22% 99 54265 0.23% 100 57876 0.25% 101 59574 0.25% 102 62196 0.27% 103 64787 0.28% 104 67433 0.29% 105 69700 0.30% 106 71650 0.31% 107 72893 0.31% 108 75832 0.32% 109 77246 0.33% 110 79051 0.34% 111 81926 0.35% 112 84425 0.36% 113 88013 0.38% 114 90290 0.38% 115 93112 0.40% 116 94346 0.40% 117 95906 0.41% 118 96572 0.41% 119 97742 0.42% 120 100418 0.43% 121 101447 0.43% 122 104598 0.45% 123 107855 0.46% 124 110918 0.47% 125 113313 0.48% 126 115370 0.49% 127 116615 0.50% 128 117659 0.50% 129 119640 0.51% 130 121045 0.52% 131 123753 0.53% 132 126228 0.54% 133 129497 0.55% 134 133330 0.57% 135 136370 0.58% 136 139833 0.60% 137 142319 0.61% 138 146699 0.63% 139 153110 0.65% 140 159430 0.68% 141 167567 0.71% 142 179432 0.76% 143 191609 0.82% 144 213398 0.91% 145 243014 1.04% 146 289665 1.23% 147 373298 1.59% 148 538889 2.30% 149 1056265 4.50% 150 5037782 21.48% 151 10170361 43.36% 23455341 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=28 prefix-density=0.52 prefix-fanout=2.4 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.24 sequence-density-rank=7 fanout-score=28.06 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=8.1 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=2.6 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.19 sequence-density-rank=12 fanout-score=52.19 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=11.2 sequence=GCCGCCGCCGCC SRR5578503 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:16:39 Started mapping on | Dec 09 21:16:40 Finished on | Dec 09 21:20:15 Mapping speed, Million of reads per hour | 392.74 Number of input reads | 23455341 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 22230857 Uniquely mapped reads % | 94.78% Average mapped length | 285.97 Number of splices: Total | 22546374 Number of splices: Annotated (sjdb) | 21151049 Number of splices: GT/AG | 22251118 Number of splices: GC/AG | 270965 Number of splices: AT/AC | 8070 Number of splices: Non-canonical | 16221 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 241439 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 21667 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 999346 999346 999346 N_multimapping 241439 241439 241439 N_noFeature 794706 21510326 1047395 N_ambiguous 564266 3167 98200 UnstrandedReadsAssigned:20871885 PositiveStrandReadsAssigned:717364 NegativeStrandReadsAssigned:21085262 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR5578503 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578503-trimmed-pair1.fastq SRR5578503-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,455,341 reads, 21,124,528 reads pseudoaligned [quant] estimated average fragment length: 231.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR5578503.ke.tsv 35125 SRR5578503.se.tsv 88098 total ==> SRR5578503.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.648 0 0 PNS24247 1044 813.084 53.0457 4.39146 PNS24249 1928 1697.08 129.788 5.14783 PNS24246 1044 813.084 53.0457 4.39146 PNS24248 1044 813.084 53.0457 4.39146 PNS24244 1471 1240.08 63.075 3.42374 PNS24243 293 114.056 0 0 KQK14069 1603 1372.08 9107.38 446.793 KQK14071 474 260.602 257.813 66.5921 ==> SRR5578503.se.tsv <== BRADI_1g14170v3 10356 BRADI_1g53295v3 151 BRADI_1g59795v3 451 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 212 BRADI_1g74790v3 108 BRADI_1g09890v3 0 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR5578503 completed mapping pipeline successfully