Starting /dee2/code/volunteer_pipeline.sh SRR5578509 current disk space = 1522028191744 free memory = 1564617768 SRR5578509 SRAfilesize d24528d20bf1e5db6abb7b533b3e75ac SRR5578509.sra SRR5578509.sra file validated SRR5578509 is paired end SRR5578509 is conventional basespace SRR5578509 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58225 34.0 34.0 34.0 33.0 34.0 2 33.38075 34.0 34.0 34.0 33.0 34.0 3 33.4465 34.0 34.0 34.0 33.0 34.0 4 33.5535 34.0 34.0 34.0 33.0 34.0 5 33.5925 34.0 34.0 34.0 33.0 34.0 6 37.32675 38.0 38.0 38.0 36.0 38.0 7 37.54325 38.0 38.0 38.0 37.0 38.0 8 37.6225 38.0 38.0 38.0 38.0 38.0 9 37.673 38.0 38.0 38.0 38.0 38.0 10-14 37.63065 38.0 38.0 38.0 38.0 38.0 15-19 37.655049999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.646 38.0 38.0 38.0 38.0 38.0 25-29 37.6149 38.0 38.0 38.0 38.0 38.0 30-34 37.57565 38.0 38.0 38.0 38.0 38.0 35-39 37.5346 38.0 38.0 38.0 38.0 38.0 40-44 37.4244 38.0 38.0 38.0 37.4 38.0 45-49 37.428399999999996 38.0 38.0 38.0 37.4 38.0 50-54 37.3872 38.0 38.0 38.0 37.0 38.0 55-59 37.33805 38.0 38.0 38.0 37.0 38.0 60-64 37.303700000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.2583 38.0 38.0 38.0 37.0 38.0 70-74 37.18535 38.0 38.0 38.0 36.4 38.0 75-79 37.13265 38.0 38.0 38.0 36.6 38.0 80-84 37.09165 38.0 38.0 38.0 36.0 38.0 85-89 37.0303 38.0 38.0 38.0 36.0 38.0 90-94 36.87645 38.0 38.0 38.0 36.0 38.0 95-99 36.76525 38.0 38.0 38.0 35.0 38.0 100-104 36.7714 38.0 38.0 38.0 35.0 38.0 105-109 36.5484 38.0 38.0 38.0 34.4 38.0 110-114 36.4052 38.0 38.0 38.0 34.0 38.0 115-119 36.27139999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.0426 38.0 37.6 38.0 33.4 38.0 125-129 35.8524 38.0 37.2 38.0 33.0 38.0 130-134 35.6539 38.0 36.4 38.0 32.4 38.0 135-139 35.4415 38.0 36.0 38.0 32.0 38.0 140-144 34.96625 38.0 35.6 38.0 29.6 38.0 145-149 34.33115 38.0 35.0 38.0 27.0 38.0 150-151 30.413874999999997 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 2.0 16 1.0 17 4.0 18 4.0 19 4.0 20 2.0 21 4.0 22 5.0 23 8.0 24 8.0 25 14.0 26 14.0 27 19.0 28 13.0 29 22.0 30 28.0 31 30.0 32 50.0 33 62.0 34 101.0 35 195.0 36 523.0 37 2879.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.73752262735971 10.964572019653477 9.361261960175847 34.936643392810964 2 24.75 13.850000000000001 29.675 31.724999999999998 3 21.825 17.875 24.4 35.9 4 27.375 24.3 20.674999999999997 27.650000000000002 5 27.952952952952952 28.703703703703702 22.597597597597595 20.745745745745744 6 21.075 32.574999999999996 24.325 22.025 7 19.2 23.275000000000002 37.95 19.575 8 20.200000000000003 24.95 28.7 26.150000000000002 9 19.3 22.6 32.9 25.2 10-14 22.49 27.46 25.045 25.005 15-19 22.884999999999998 26.46 25.035 25.619999999999997 20-24 22.919999999999998 26.435 24.610000000000003 26.035000000000004 25-29 23.175 25.895000000000003 25.724999999999998 25.205 30-34 22.645 26.290000000000003 25.35 25.715 35-39 23.135 25.735000000000003 25.105 26.025 40-44 23.669999999999998 25.52 25.06 25.75 45-49 24.154999999999998 25.61 24.37 25.865 50-54 23.435 25.355 25.185000000000002 26.025 55-59 23.73 25.505 24.745 26.02 60-64 23.494999999999997 25.740000000000002 24.455 26.31 65-69 23.25 25.91 24.154999999999998 26.685 70-74 23.724999999999998 25.81 24.4 26.064999999999998 75-79 23.865 25.715 24.490000000000002 25.929999999999996 80-84 24.0 24.92 24.310000000000002 26.77 85-89 23.915 25.465 24.335 26.284999999999997 90-94 24.415 24.69 24.404999999999998 26.490000000000002 95-99 23.935000000000002 25.11 24.6 26.355 100-104 24.035 25.369999999999997 24.295 26.3 105-109 24.855 25.39 23.91 25.845000000000002 110-114 24.12 25.979999999999997 23.5 26.400000000000002 115-119 24.279999999999998 25.324999999999996 24.03 26.365 120-124 24.065 25.35 23.674999999999997 26.91 125-129 24.39 25.52 23.51 26.58 130-134 24.41 25.290000000000003 23.89 26.41 135-139 24.705 24.985 24.310000000000002 26.0 140-144 24.34 25.11 24.16 26.39 145-149 24.099999999999998 26.005 23.830000000000002 26.064999999999998 150-151 24.227642276422763 24.815509693558475 24.390243902439025 26.566604127579733 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 5.0 30 7.0 31 11.0 32 15.5 33 26.5 34 37.5 35 40.0 36 51.5 37 68.5 38 84.5 39 109.0 40 126.5 41 140.0 42 152.5 43 160.0 44 170.5 45 177.0 46 180.0 47 176.5 48 183.0 49 177.0 50 157.0 51 152.0 52 147.5 53 132.5 54 127.5 55 122.5 56 102.5 57 77.5 58 71.5 59 84.0 60 78.0 61 63.5 62 59.0 63 64.0 64 61.0 65 53.0 66 46.0 67 41.0 68 39.0 69 39.0 70 35.0 71 26.0 72 24.5 73 25.0 74 18.5 75 12.5 76 10.5 77 8.5 78 6.5 79 4.0 80 1.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1154915339904 98.05 2 0.7581501137225171 1.5 3 0.10108668182966893 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0125 82-83 0.6 0.0 0.0 0.0 0.025 84-85 0.8125 0.0 0.0 0.0 0.025 86-87 1.05 0.0 0.0 0.0 0.025 88-89 1.3375 0.0 0.0 0.0 0.025 90-91 1.55 0.0 0.0 0.0 0.025 92-93 1.7625 0.0 0.0 0.0 0.025 94-95 1.9625 0.0 0.0 0.0 0.025 96-97 2.3 0.0 0.0 0.0 0.025 98-99 2.7875 0.0 0.0 0.0 0.025 100-101 3.4000000000000004 0.0 0.0 0.0 0.025 102-103 3.8625 0.0 0.0 0.0 0.025 104-105 4.4 0.0 0.0 0.0 0.025 106-107 5.1 0.0 0.0 0.0 0.025 108-109 5.675 0.0 0.0 0.0 0.025 110-111 6.2625 0.0 0.0 0.0 0.025 112-113 6.9125 0.0 0.0 0.0 0.025 114-115 7.575 0.0 0.0 0.0 0.025 116-117 8.350000000000001 0.0 0.0 0.0 0.025 118-119 9.037500000000001 0.0 0.0 0.0 0.025 120-121 9.6625 0.0 0.0 0.0 0.025 122-123 10.4125 0.0 0.0 0.0 0.025 124-125 11.125 0.0 0.0 0.0 0.025 126-127 11.8625 0.0 0.0 0.0 0.025 128-129 12.8125 0.0 0.0 0.0 0.025 130-131 13.65 0.0 0.0 0.0 0.025 132-133 14.775 0.0 0.0 0.0 0.025 134-135 15.7875 0.0 0.0 0.0 0.025 136-137 16.625 0.0 0.0 0.0 0.025 138-139 17.575 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATTT 10 0.006577216 146.82278 1 AAAAAAA 65 2.034742E-5 33.458652 145 >>END_MODULE SRR5578509 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578509_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9785 33.0 33.0 34.0 32.0 34.0 2 33.086 34.0 33.0 34.0 33.0 34.0 3 33.124 34.0 33.0 34.0 33.0 34.0 4 33.028 34.0 33.0 34.0 33.0 34.0 5 33.0845 34.0 33.0 34.0 33.0 34.0 6 37.313 38.0 38.0 38.0 37.0 38.0 7 37.2775 38.0 38.0 38.0 37.0 38.0 8 37.3065 38.0 38.0 38.0 37.0 38.0 9 37.29975 38.0 38.0 38.0 38.0 38.0 10-14 37.257 38.0 38.0 38.0 37.2 38.0 15-19 37.1954 38.0 38.0 38.0 37.0 38.0 20-24 37.187599999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.17335 38.0 38.0 38.0 37.0 38.0 30-34 37.20994999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.172399999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.14295 38.0 38.0 38.0 37.0 38.0 45-49 37.144850000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.092349999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.0114 38.0 38.0 38.0 37.0 38.0 60-64 37.016450000000006 38.0 38.0 38.0 36.8 38.0 65-69 36.933749999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.838350000000005 38.0 38.0 38.0 36.2 38.0 75-79 36.7473 38.0 38.0 38.0 36.0 38.0 80-84 36.742149999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.567449999999994 38.0 38.0 38.0 35.4 38.0 90-94 36.46805 38.0 38.0 38.0 35.0 38.0 95-99 36.47095 38.0 38.0 38.0 35.0 38.0 100-104 36.317600000000006 38.0 38.0 38.0 34.6 38.0 105-109 36.128699999999995 38.0 38.0 38.0 34.0 38.0 110-114 35.9911 38.0 38.0 38.0 33.8 38.0 115-119 35.76345 38.0 38.0 38.0 33.2 38.0 120-124 35.4083 38.0 37.4 38.0 31.4 38.0 125-129 35.21465 38.0 36.6 38.0 30.4 38.0 130-134 34.772450000000006 38.0 36.0 38.0 28.4 38.0 135-139 34.05544999999999 38.0 35.0 38.0 23.8 38.0 140-144 33.40725 38.0 33.2 38.0 19.8 38.0 145-149 31.89835 38.0 32.6 38.0 8.2 38.0 150-151 26.604125 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 0.0 5 1.0 6 2.0 7 2.0 8 3.0 9 2.0 10 3.0 11 4.0 12 4.0 13 3.0 14 4.0 15 5.0 16 3.0 17 8.0 18 4.0 19 9.0 20 5.0 21 4.0 22 8.0 23 18.0 24 15.0 25 14.0 26 20.0 27 16.0 28 28.0 29 32.0 30 39.0 31 49.0 32 59.0 33 74.0 34 125.0 35 223.0 36 577.0 37 2623.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1850462615654 18.65466366591648 12.603150787696924 28.557139284821204 2 30.325000000000003 23.025000000000002 24.45 22.2 3 25.30632658164541 24.381095273818453 25.95648912228057 24.356089022255563 4 27.375 30.0 19.625 23.0 5 27.3 32.05 18.95 21.7 6 23.674999999999997 33.525 20.325 22.475 7 23.275000000000002 18.15 34.65 23.925 8 23.7 23.3 22.95 30.049999999999997 9 25.474999999999998 22.75 25.1 26.674999999999997 10-14 26.43 25.435000000000002 22.52 25.615 15-19 26.334999999999997 24.37 23.86 25.435000000000002 20-24 26.369999999999997 24.955 23.150000000000002 25.525 25-29 26.8 24.695 23.46 25.045 30-34 27.060000000000002 24.385 23.805 24.75 35-39 26.155 24.57 24.0 25.275 40-44 26.755000000000003 24.43 24.025 24.79 45-49 26.805 24.905 23.294999999999998 24.995 50-54 26.845000000000002 24.8 23.544999999999998 24.81 55-59 26.935 24.2 24.485 24.38 60-64 27.165 24.43 23.78 24.625 65-69 26.174999999999997 24.69 24.610000000000003 24.525 70-74 26.584999999999997 23.765 24.959999999999997 24.69 75-79 26.834999999999997 24.665 24.215 24.285 80-84 26.790000000000003 24.985 23.76 24.465 85-89 26.645000000000003 24.45 25.124999999999996 23.78 90-94 26.825 24.605 24.535 24.035 95-99 27.375 24.685000000000002 24.169999999999998 23.77 100-104 27.46 24.315 24.15 24.075 105-109 27.005000000000003 25.545 24.025 23.425 110-114 27.29 25.724999999999998 23.64 23.345 115-119 28.144999999999996 25.34 23.9 22.615 120-124 28.165000000000003 25.540000000000003 23.515 22.78 125-129 28.29 25.52 24.01 22.18 130-134 28.605000000000004 25.790000000000003 23.53 22.075 135-139 28.360000000000003 26.38 23.630000000000003 21.63 140-144 28.82 26.745 23.35 21.085 145-149 28.98 26.31 23.135 21.575 150-151 30.5375 25.687500000000004 23.674999999999997 20.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.5 27 2.0 28 1.5 29 2.0 30 3.5 31 7.0 32 9.5 33 8.5 34 13.5 35 24.5 36 30.0 37 45.0 38 69.5 39 78.5 40 104.5 41 121.0 42 117.5 43 132.5 44 154.0 45 180.0 46 190.0 47 184.5 48 173.5 49 160.0 50 159.0 51 165.5 52 151.5 53 137.0 54 136.0 55 131.0 56 115.5 57 104.0 58 98.5 59 88.5 60 81.0 61 79.0 62 77.0 63 70.0 64 67.0 65 71.5 66 70.0 67 54.0 68 46.5 69 45.0 70 45.5 71 40.5 72 34.5 73 33.0 74 23.5 75 17.0 76 12.0 77 7.0 78 6.5 79 6.5 80 3.5 81 2.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82832399388691 97.0 2 0.8405501782985226 1.6500000000000001 3 0.1273560876209883 0.375 4 0.07641365257259297 0.3 5 0.07641365257259297 0.375 6 0.05094243504839531 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.2 0.0 0.0 0.0 0.0 88-89 1.4625 0.0 0.0 0.0 0.0 90-91 1.6375 0.0 0.0 0.0 0.0 92-93 1.85 0.0 0.0 0.0 0.0 94-95 2.0375 0.0 0.0 0.0 0.0 96-97 2.325 0.0 0.0 0.0 0.0 98-99 2.8 0.0 0.0 0.0 0.0 100-101 3.425 0.0 0.0 0.0 0.0 102-103 3.8875 0.0 0.0 0.0 0.0 104-105 4.3875 0.0 0.0 0.0 0.0 106-107 5.074999999999999 0.0 0.0 0.0 0.0 108-109 5.625 0.0 0.0 0.0 0.0 110-111 6.25 0.0 0.0 0.0 0.0 112-113 6.85 0.0 0.0 0.0 0.0 114-115 7.5 0.0 0.0 0.0 0.0 116-117 8.3 0.0 0.0 0.0 0.0 118-119 8.975 0.0 0.0 0.0 0.0 120-121 9.6375 0.0 0.0 0.0 0.0 122-123 10.425 0.0 0.0 0.0 0.0 124-125 11.1875 0.0 0.0 0.0 0.0 126-127 11.9625 0.0 0.0 0.0 0.0 128-129 12.875 0.0 0.0 0.0 0.0 130-131 13.7 0.0 0.0 0.0 0.0 132-133 14.8375 0.0 0.0 0.0 0.0 134-135 15.8625 0.0 0.0 0.0 0.0 136-137 16.700000000000003 0.0 0.0 0.0 0.0 138-139 17.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGGG 10 0.006830828 145.0 3 AAAAAAA 130 3.5034773E-6 12.269231 135-139 >>END_MODULE Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865124 spots for SRR5578509.sra Written 865124 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra Read 865120 spots for SRR5578509.sra Written 865120 spots for SRR5578509.sra SRR ids: ['SRR5578509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p_o8h29e SRR5578509.sra spots: 17302404 blocks: [[1, 865120], [865121, 1730240], [1730241, 2595360], [2595361, 3460480], [3460481, 4325600], [4325601, 5190720], [5190721, 6055840], [6055841, 6920960], [6920961, 7786080], [7786081, 8651200], [8651201, 9516320], [9516321, 10381440], [10381441, 11246560], [11246561, 12111680], [12111681, 12976800], [12976801, 13841920], [13841921, 14707040], [14707041, 15572160], [15572161, 16437280], [16437281, 17302404]] SRR5578509 file size 5841516 SRR5578509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578509 SRR5578509_1.fastq SRR5578509_2.fastq Input file: SRR5578509_1.fastq Paired file: SRR5578509_2.fastq trimmed: SRR5578509-trimmed-pair1.fastq, SRR5578509-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:23:56 2024 >> started Mon Dec 9 21:24:17 2024 >> done (21.326s) 17302404 read pairs processed; of these: 26029 ( 0.15%) short read pairs filtered out after trimming by size control 53364 ( 0.31%) empty read pairs filtered out after trimming by size control 17223011 (99.54%) read pairs available; of these: 9465223 (54.96%) trimmed read pairs available after processing 7757788 (45.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 13 0.00% 20 13 0.00% 21 14 0.00% 22 16 0.00% 23 15 0.00% 24 15 0.00% 25 19 0.00% 26 25 0.00% 27 23 0.00% 28 24 0.00% 29 29 0.00% 30 25 0.00% 31 24 0.00% 32 25 0.00% 33 35 0.00% 34 26 0.00% 35 42 0.00% 36 35 0.00% 37 34 0.00% 38 44 0.00% 39 44 0.00% 40 66 0.00% 41 70 0.00% 42 79 0.00% 43 97 0.00% 44 100 0.00% 45 109 0.00% 46 153 0.00% 47 152 0.00% 48 198 0.00% 49 191 0.00% 50 249 0.00% 51 290 0.00% 52 312 0.00% 53 396 0.00% 54 373 0.00% 55 472 0.00% 56 483 0.00% 57 561 0.00% 58 668 0.00% 59 716 0.00% 60 830 0.00% 61 970 0.01% 62 1072 0.01% 63 1287 0.01% 64 1431 0.01% 65 1700 0.01% 66 2056 0.01% 67 2630 0.02% 68 3228 0.02% 69 5130 0.03% 70 5609 0.03% 71 4518 0.03% 72 4375 0.03% 73 4706 0.03% 74 5282 0.03% 75 5748 0.03% 76 6339 0.04% 77 7089 0.04% 78 8086 0.05% 79 9048 0.05% 80 9902 0.06% 81 11076 0.06% 82 12447 0.07% 83 13961 0.08% 84 16712 0.10% 85 18431 0.11% 86 19735 0.11% 87 21419 0.12% 88 22849 0.13% 89 24109 0.14% 90 25512 0.15% 91 27202 0.16% 92 28873 0.17% 93 31050 0.18% 94 33621 0.20% 95 35183 0.20% 96 37501 0.22% 97 39452 0.23% 98 40220 0.23% 99 42459 0.25% 100 44319 0.26% 101 45990 0.27% 102 48338 0.28% 103 50888 0.30% 104 53097 0.31% 105 54970 0.32% 106 57281 0.33% 107 58359 0.34% 108 60194 0.35% 109 61884 0.36% 110 63612 0.37% 111 65397 0.38% 112 67552 0.39% 113 69649 0.40% 114 72035 0.42% 115 74292 0.43% 116 75736 0.44% 117 76816 0.45% 118 77703 0.45% 119 78332 0.45% 120 80812 0.47% 121 82030 0.48% 122 83834 0.49% 123 85723 0.50% 124 88639 0.51% 125 90098 0.52% 126 91905 0.53% 127 92658 0.54% 128 93655 0.54% 129 95101 0.55% 130 96538 0.56% 131 97819 0.57% 132 100191 0.58% 133 101449 0.59% 134 103090 0.60% 135 105966 0.62% 136 107302 0.62% 137 109082 0.63% 138 112124 0.65% 139 114996 0.67% 140 118848 0.69% 141 122908 0.71% 142 131132 0.76% 143 136312 0.79% 144 148289 0.86% 145 164110 0.95% 146 190998 1.11% 147 237185 1.38% 148 332670 1.93% 149 635229 3.69% 150 3458953 20.08% 151 7757788 45.04% 17223011 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=25 prefix-density=0.48 prefix-fanout=2.7 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.52 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.1 sequence=TGGATCAACAACATTCAGACACATATATTAAAACGTACAGCCTTGATCGAGCGAGGCATGAGGAAGGACATGGATCGTGTCGGATGAACAATACGGTCGTGATCGAGTTGGTGACTTGACAGAAGATTTTATTTTATTTAGCAGCTAACTGGCTAGTAAGCTAGCTAGCTGGGCGGCGATGGTGGGTGCATGCTTGCAGTGCAGTTGTCCTAGATCCTGGATCGATCCTCATTCCTCATGGTCGCTGGTGTGTGGCTCTAGTTGCAGGTGC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=6.96 fanout-score-rank=11 prefix-density=0.64 prefix-fanout=4.9 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=27.16 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR5578509 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:25:12 Started mapping on | Dec 09 21:25:12 Finished on | Dec 09 21:30:43 Mapping speed, Million of reads per hour | 187.32 Number of input reads | 17223011 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 15442476 Uniquely mapped reads % | 89.66% Average mapped length | 285.15 Number of splices: Total | 13010851 Number of splices: Annotated (sjdb) | 12196528 Number of splices: GT/AG | 12845841 Number of splices: GC/AG | 148783 Number of splices: AT/AC | 7934 Number of splices: Non-canonical | 8293 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 158169 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 30445 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.46% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1638893 1638893 1638893 N_multimapping 158169 158169 158169 N_noFeature 364833 14976345 498426 N_ambiguous 377313 1914 45573 UnstrandedReadsAssigned:14700330 PositiveStrandReadsAssigned:464217 NegativeStrandReadsAssigned:14898477 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR5578509 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578509-trimmed-pair1.fastq SRR5578509-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,223,011 reads, 14,990,259 reads pseudoaligned [quant] estimated average fragment length: 214.063 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR5578509.ke.tsv 35125 SRR5578509.se.tsv 88098 total ==> SRR5578509.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.194 34.2574 4.04287 PNS24247 1044 830.937 29.2929 3.00874 PNS24249 1928 1714.94 82.1892 4.09031 PNS24246 1044 830.937 29.2929 3.00874 PNS24248 1044 830.937 29.2929 3.00874 PNS24244 1471 1257.94 143.675 9.7479 PNS24243 293 116.668 0 0 KQK14069 1603 1389.94 3331.2 204.548 KQK14071 474 270.665 46.6974 14.7248 ==> SRR5578509.se.tsv <== BRADI_1g14170v3 3499 BRADI_1g53295v3 26 BRADI_1g59795v3 355 BRADI_1g07683v3 0 BRADI_1g00485v3 69 BRADI_1g20270v3 1582 BRADI_1g74790v3 70 BRADI_1g09890v3 1 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR5578509 completed mapping pipeline successfully