Starting /dee2/code/volunteer_pipeline.sh SRR5578510 current disk space = 1522241105920 free memory = 1563146776 SRR5578510 SRAfilesize 89c08e72b8a4da3d00aef79dc1990f49 SRR5578510.sra SRR5578510.sra file validated SRR5578510 is paired end SRR5578510 is conventional basespace SRR5578510 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6495 34.0 34.0 34.0 33.0 34.0 2 33.41375 34.0 34.0 34.0 33.0 34.0 3 33.4765 34.0 34.0 34.0 33.0 34.0 4 33.527 34.0 34.0 34.0 33.0 34.0 5 33.558 34.0 34.0 34.0 33.0 34.0 6 37.27 38.0 38.0 38.0 36.0 38.0 7 37.46025 38.0 38.0 38.0 37.0 38.0 8 37.6495 38.0 38.0 38.0 38.0 38.0 9 37.71275 38.0 38.0 38.0 38.0 38.0 10-14 37.6662 38.0 38.0 38.0 38.0 38.0 15-19 37.675349999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.6719 38.0 38.0 38.0 38.0 38.0 25-29 37.65105 38.0 38.0 38.0 38.0 38.0 30-34 37.6516 38.0 38.0 38.0 38.0 38.0 35-39 37.6251 38.0 38.0 38.0 38.0 38.0 40-44 37.51705 38.0 38.0 38.0 38.0 38.0 45-49 37.491749999999996 38.0 38.0 38.0 37.8 38.0 50-54 37.50275 38.0 38.0 38.0 37.8 38.0 55-59 37.432249999999996 38.0 38.0 38.0 37.2 38.0 60-64 37.3995 38.0 38.0 38.0 37.0 38.0 65-69 37.333800000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.3457 38.0 38.0 38.0 37.0 38.0 75-79 37.236900000000006 38.0 38.0 38.0 36.6 38.0 80-84 37.2096 38.0 38.0 38.0 36.2 38.0 85-89 37.10315 38.0 38.0 38.0 36.0 38.0 90-94 37.028650000000006 38.0 38.0 38.0 35.8 38.0 95-99 36.9311 38.0 38.0 38.0 35.2 38.0 100-104 36.82765 38.0 38.0 38.0 35.0 38.0 105-109 36.7008 38.0 38.0 38.0 34.6 38.0 110-114 36.5334 38.0 38.0 38.0 34.0 38.0 115-119 36.344550000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.311400000000006 38.0 38.0 38.0 33.8 38.0 125-129 36.0059 38.0 37.0 38.0 33.0 38.0 130-134 35.75659999999999 38.0 36.0 38.0 32.2 38.0 135-139 35.3983 38.0 36.0 38.0 31.2 38.0 140-144 34.98525 38.0 35.4 38.0 28.4 38.0 145-149 34.4116 38.0 35.0 38.0 26.8 38.0 150-151 30.72375 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 1.0 14 0.0 15 2.0 16 2.0 17 0.0 18 3.0 19 1.0 20 0.0 21 3.0 22 3.0 23 5.0 24 4.0 25 9.0 26 10.0 27 10.0 28 15.0 29 15.0 30 35.0 31 45.0 32 56.0 33 69.0 34 109.0 35 195.0 36 582.0 37 2823.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.504499871432245 9.77114939573155 8.922602211365389 38.80174852147081 2 24.8 13.575000000000001 34.225 27.400000000000002 3 22.85571392848212 19.379844961240313 22.80570142535634 34.958739684921234 4 29.25 26.575 19.675 24.5 5 27.700000000000003 30.075000000000003 21.075 21.15 6 22.625 31.95 22.6 22.825 7 17.05 22.975 39.75 20.225 8 22.3 22.225 28.525 26.950000000000003 9 20.375 21.5 32.95 25.174999999999997 10-14 24.11 25.814999999999998 24.715 25.36 15-19 24.305 24.709999999999997 24.875 26.11 20-24 24.47 24.67 25.424999999999997 25.435000000000002 25-29 24.12 25.430000000000003 24.715 25.735000000000003 30-34 24.21242124212421 24.992499249924993 25.127512751275127 25.66756675667567 35-39 24.482448244824482 24.64246424642464 24.367436743674368 26.507650765076505 40-44 24.56491298259652 25.090018003600722 24.399879975995198 25.94518903780756 45-49 24.09620481024051 24.756237811890593 25.136256812840642 26.01130056502825 50-54 24.245 24.25 24.975 26.529999999999998 55-59 24.925 24.685000000000002 24.33 26.06 60-64 24.915000000000003 24.81 24.455 25.82 65-69 25.16 24.335 24.060000000000002 26.445 70-74 24.529999999999998 24.745 24.75 25.974999999999998 75-79 25.124999999999996 24.39 24.275 26.21 80-84 25.05 24.165 24.605 26.179999999999996 85-89 25.2 23.98 24.08 26.740000000000002 90-94 25.09125456272814 24.34621731086554 24.991249562478124 25.571278563928196 95-99 25.415 24.01 24.535 26.040000000000003 100-104 25.485000000000003 24.03 24.610000000000003 25.874999999999996 105-109 24.759999999999998 24.42 24.255 26.565 110-114 25.05 24.595 24.169999999999998 26.185000000000002 115-119 25.745 24.635 23.72 25.900000000000002 120-124 25.170034006801362 24.374874974995 24.20484096819364 26.250250050010003 125-129 24.696174043510876 24.66616654163541 23.585896474118528 27.051762940735184 130-134 25.866466616654165 24.82120530132533 23.645911477869465 25.66641660415104 135-139 25.240048009601924 25.045009001800363 23.63472694538908 26.080216043208644 140-144 25.231261563078156 24.586229311465573 23.60618030901545 26.57632881644082 145-149 24.781239061953098 25.346267313365665 23.391169558477923 26.48132406620331 150-151 24.40275171982489 25.916197623514698 22.976860537836146 26.70419011882427 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 0.5 27 1.0 28 2.5 29 4.5 30 9.5 31 18.5 32 23.0 33 25.0 34 28.0 35 38.0 36 54.5 37 69.5 38 76.5 39 88.0 40 116.0 41 131.5 42 149.5 43 161.5 44 164.0 45 173.0 46 175.5 47 180.5 48 167.5 49 151.0 50 142.0 51 125.0 52 113.5 53 98.5 54 89.5 55 95.0 56 88.0 57 87.5 58 93.0 59 91.5 60 87.5 61 80.5 62 77.5 63 78.5 64 80.5 65 80.0 66 72.5 67 67.0 68 60.0 69 53.0 70 48.5 71 41.0 72 33.5 73 26.5 74 23.0 75 18.0 76 13.0 77 11.0 78 8.5 79 2.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.02 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.025 130-134 0.025 135-139 0.02 140-144 0.005 145-149 0.005 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42319430315362 96.75 2 1.449643947100712 2.85 3 0.10172939979654119 0.3 4 0.025432349949135298 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.4875 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 2.05 0.0 0.0 0.0 0.0 102-103 2.3499999999999996 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 2.95 0.0 0.0 0.0 0.0 108-109 3.45 0.0 0.0 0.0 0.0 110-111 3.8375000000000004 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.2375 0.0 0.0 0.0 0.0 118-119 5.8125 0.0 0.0 0.0 0.0 120-121 6.4125 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.699999999999999 0.0 0.0 0.0 0.0 126-127 8.5125 0.0 0.0 0.0 0.0 128-129 9.275 0.0 0.0 0.0 0.0 130-131 10.1375 0.0 0.0 0.0 0.0 132-133 10.8625 0.0 0.0 0.0 0.0 134-135 11.625 0.0 0.0 0.0 0.0 136-137 12.3625 0.0 0.0 0.0 0.0 138-139 13.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578510 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578510_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0285 33.0 33.0 34.0 32.0 34.0 2 33.1265 34.0 33.0 34.0 32.0 34.0 3 33.163 34.0 33.0 34.0 33.0 34.0 4 33.1435 34.0 33.0 34.0 33.0 34.0 5 33.17125 34.0 33.0 34.0 33.0 34.0 6 37.37075 38.0 38.0 38.0 37.0 38.0 7 37.3825 38.0 38.0 38.0 37.0 38.0 8 37.39525 38.0 38.0 38.0 37.0 38.0 9 37.431 38.0 38.0 38.0 37.0 38.0 10-14 37.381899999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.346450000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.33265 38.0 38.0 38.0 37.0 38.0 25-29 37.27625 38.0 38.0 38.0 37.0 38.0 30-34 37.29925 38.0 38.0 38.0 37.0 38.0 35-39 37.263999999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.24605 38.0 38.0 38.0 37.0 38.0 45-49 37.196299999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.152049999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.10055 38.0 38.0 38.0 37.0 38.0 60-64 36.981849999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.92585 38.0 38.0 38.0 36.0 38.0 70-74 36.77815 38.0 38.0 38.0 35.0 38.0 75-79 36.740700000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.72195 38.0 38.0 38.0 35.0 38.0 85-89 36.583000000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.498200000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.167950000000005 38.0 38.0 38.0 33.6 38.0 100-104 35.868 38.0 38.0 38.0 32.6 38.0 105-109 35.64665 38.0 37.8 38.0 31.6 38.0 110-114 35.44855 38.0 36.8 38.0 31.0 38.0 115-119 35.215450000000004 38.0 36.2 38.0 29.8 38.0 120-124 34.926700000000004 38.0 36.0 38.0 28.0 38.0 125-129 34.61935 38.0 35.2 38.0 26.0 38.0 130-134 34.113 38.0 34.2 38.0 23.8 38.0 135-139 33.4995 38.0 33.0 38.0 21.8 38.0 140-144 32.713 38.0 32.8 38.0 13.4 38.0 145-149 31.092750000000002 38.0 30.6 38.0 6.0 38.0 150-151 25.821875 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 4.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 0.0 14 4.0 15 1.0 16 5.0 17 4.0 18 10.0 19 8.0 20 8.0 21 16.0 22 20.0 23 12.0 24 16.0 25 10.0 26 21.0 27 27.0 28 26.0 29 44.0 30 53.0 31 65.0 32 84.0 33 95.0 34 171.0 35 309.0 36 692.0 37 2284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 17.549999999999997 11.0 33.45 2 29.349999999999998 22.0 27.650000000000002 21.0 3 21.675 24.175 27.400000000000002 26.75 4 27.025 29.799999999999997 19.2 23.974999999999998 5 27.650000000000002 32.775 20.150000000000002 19.425 6 23.225 34.125 18.224999999999998 24.425 7 22.5 17.9 34.975 24.625 8 23.075000000000003 21.9 23.875 31.15 9 23.799999999999997 21.275 26.150000000000002 28.775000000000002 10-14 26.484999999999996 25.009999999999998 22.535 25.97 15-19 26.009999999999998 24.955 23.16 25.874999999999996 20-24 25.615 25.495 23.46 25.430000000000003 25-29 26.565 24.45 23.36 25.624999999999996 30-34 26.435 24.525 23.265 25.775 35-39 25.915 23.955000000000002 23.86 26.27 40-44 26.465 24.325 23.605 25.605 45-49 26.400000000000002 24.18 23.535 25.885 50-54 26.32 24.279999999999998 23.665 25.735000000000003 55-59 26.229999999999997 24.51 23.215 26.045 60-64 26.155 23.78 23.755000000000003 26.31 65-69 26.200000000000003 24.59 23.555 25.655 70-74 26.784999999999997 24.23 23.419999999999998 25.564999999999998 75-79 26.200000000000003 24.44 23.835 25.525 80-84 26.195 23.77 24.33 25.705 85-89 26.340000000000003 24.3 23.69 25.669999999999998 90-94 26.32 24.145 23.62 25.915 95-99 26.66 24.82 23.335 25.185000000000002 100-104 26.669999999999998 24.22 23.72 25.39 105-109 26.87 23.9 23.735 25.495 110-114 26.555 24.77 23.82 24.855 115-119 27.02 24.72 23.44 24.82 120-124 27.435 24.515 23.5 24.55 125-129 27.11 24.755 23.77 24.365000000000002 130-134 27.725 25.814999999999998 22.74 23.72 135-139 28.065 25.395 22.85 23.69 140-144 28.935 25.255 22.97 22.84 145-149 28.494999999999997 25.929999999999996 22.46 23.115 150-151 28.975 25.2 23.2875 22.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.0 27 2.5 28 4.0 29 5.0 30 7.5 31 7.0 32 12.0 33 19.0 34 21.0 35 26.5 36 42.0 37 52.0 38 72.5 39 83.0 40 97.0 41 122.5 42 134.0 43 151.0 44 158.5 45 176.0 46 171.0 47 156.0 48 144.5 49 132.5 50 136.0 51 126.0 52 119.5 53 108.5 54 94.0 55 89.5 56 88.0 57 92.5 58 96.5 59 100.0 60 102.5 61 97.5 62 107.5 63 112.0 64 96.5 65 82.0 66 73.0 67 73.0 68 69.0 69 70.0 70 57.5 71 41.5 72 38.0 73 31.0 74 30.5 75 24.5 76 14.0 77 9.0 78 4.0 79 4.0 80 5.5 81 2.5 82 2.0 83 2.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47367082167388 96.775 2 1.3482574408547443 2.65 3 0.1271940981938438 0.375 4 0.05087763927753752 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 2.05 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.2625 0.0 0.0 0.0 0.0 114-115 4.725 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.7875 0.0 0.0 0.0 0.0 120-121 6.3875 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.6875 0.0 0.0 0.0 0.0 126-127 8.4625 0.0 0.0 0.0 0.0 128-129 9.225 0.0 0.0 0.0 0.0 130-131 10.0625 0.0 0.0 0.0 0.0 132-133 10.7875 0.0 0.0 0.0 0.0 134-135 11.5625 0.0 0.0 0.0 0.0 136-137 12.2375 0.0 0.0 0.0 0.0 138-139 13.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867383 spots for SRR5578510.sra Written 867383 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra Read 867380 spots for SRR5578510.sra Written 867380 spots for SRR5578510.sra SRR ids: ['SRR5578510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyavh0g_ SRR5578510.sra spots: 17347603 blocks: [[1, 867380], [867381, 1734760], [1734761, 2602140], [2602141, 3469520], [3469521, 4336900], [4336901, 5204280], [5204281, 6071660], [6071661, 6939040], [6939041, 7806420], [7806421, 8673800], [8673801, 9541180], [9541181, 10408560], [10408561, 11275940], [11275941, 12143320], [12143321, 13010700], [13010701, 13878080], [13878081, 14745460], [14745461, 15612840], [15612841, 16480220], [16480221, 17347603]] SRR5578510 file size 5856833 SRR5578510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578510 SRR5578510_1.fastq SRR5578510_2.fastq Input file: SRR5578510_1.fastq Paired file: SRR5578510_2.fastq trimmed: SRR5578510-trimmed-pair1.fastq, SRR5578510-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:33:28 2024 >> started Mon Dec 9 21:33:52 2024 >> done (23.783s) 17347603 read pairs processed; of these: 13105 ( 0.08%) short read pairs filtered out after trimming by size control 13616 ( 0.08%) empty read pairs filtered out after trimming by size control 17320882 (99.85%) read pairs available; of these: 9314432 (53.78%) trimmed read pairs available after processing 8006450 (46.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 15 0.00% 21 14 0.00% 22 18 0.00% 23 13 0.00% 24 21 0.00% 25 9 0.00% 26 19 0.00% 27 20 0.00% 28 14 0.00% 29 15 0.00% 30 26 0.00% 31 26 0.00% 32 37 0.00% 33 24 0.00% 34 29 0.00% 35 40 0.00% 36 44 0.00% 37 63 0.00% 38 47 0.00% 39 55 0.00% 40 48 0.00% 41 72 0.00% 42 68 0.00% 43 70 0.00% 44 75 0.00% 45 87 0.00% 46 96 0.00% 47 114 0.00% 48 167 0.00% 49 153 0.00% 50 158 0.00% 51 182 0.00% 52 229 0.00% 53 240 0.00% 54 260 0.00% 55 294 0.00% 56 287 0.00% 57 359 0.00% 58 400 0.00% 59 467 0.00% 60 568 0.00% 61 618 0.00% 62 703 0.00% 63 860 0.00% 64 890 0.01% 65 1018 0.01% 66 1117 0.01% 67 1370 0.01% 68 1615 0.01% 69 2011 0.01% 70 2174 0.01% 71 2251 0.01% 72 2546 0.01% 73 3015 0.02% 74 3157 0.02% 75 3701 0.02% 76 4079 0.02% 77 4502 0.03% 78 5099 0.03% 79 5660 0.03% 80 6300 0.04% 81 7189 0.04% 82 8232 0.05% 83 8936 0.05% 84 10618 0.06% 85 11423 0.07% 86 12294 0.07% 87 13288 0.08% 88 14176 0.08% 89 15362 0.09% 90 16780 0.10% 91 18209 0.11% 92 19393 0.11% 93 20896 0.12% 94 22491 0.13% 95 23828 0.14% 96 25122 0.15% 97 27002 0.16% 98 27942 0.16% 99 29605 0.17% 100 30953 0.18% 101 32814 0.19% 102 34671 0.20% 103 36304 0.21% 104 38089 0.22% 105 39324 0.23% 106 41650 0.24% 107 42920 0.25% 108 44510 0.26% 109 46045 0.27% 110 47654 0.28% 111 49204 0.28% 112 51493 0.30% 113 53380 0.31% 114 55980 0.32% 115 58276 0.34% 116 59438 0.34% 117 61045 0.35% 118 62114 0.36% 119 63479 0.37% 120 64753 0.37% 121 66475 0.38% 122 68090 0.39% 123 70030 0.40% 124 72562 0.42% 125 74351 0.43% 126 77077 0.44% 127 78485 0.45% 128 79211 0.46% 129 81311 0.47% 130 84020 0.49% 131 84756 0.49% 132 87145 0.50% 133 90067 0.52% 134 92209 0.53% 135 94806 0.55% 136 97247 0.56% 137 99800 0.58% 138 103408 0.60% 139 108702 0.63% 140 112571 0.65% 141 119437 0.69% 142 128245 0.74% 143 136680 0.79% 144 151130 0.87% 145 174110 1.01% 146 206301 1.19% 147 267478 1.54% 148 386642 2.23% 149 771362 4.45% 150 3846192 22.21% 151 8006450 46.22% 17320882 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=17 prefix-density=0.89 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.04 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=25 prefix-density=0.67 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=47.44 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578510 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:34:34 Started mapping on | Dec 09 21:34:34 Finished on | Dec 09 21:36:57 Mapping speed, Million of reads per hour | 436.05 Number of input reads | 17320882 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16542363 Uniquely mapped reads % | 95.51% Average mapped length | 288.87 Number of splices: Total | 16720188 Number of splices: Annotated (sjdb) | 15792286 Number of splices: GT/AG | 16502160 Number of splices: GC/AG | 200100 Number of splices: AT/AC | 5475 Number of splices: Non-canonical | 12453 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145404 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 15166 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641710 641710 641710 N_multimapping 145404 145404 145404 N_noFeature 538683 16032951 694778 N_ambiguous 429821 2062 77820 UnstrandedReadsAssigned:15573859 PositiveStrandReadsAssigned:507350 NegativeStrandReadsAssigned:15769765 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5578510 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578510-trimmed-pair1.fastq SRR5578510-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,320,882 reads, 15,763,037 reads pseudoaligned [quant] estimated average fragment length: 234.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR5578510.ke.tsv 35125 SRR5578510.se.tsv 88098 total ==> SRR5578510.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.368 0 0 PNS24247 1044 810.955 31.3527 3.38138 PNS24249 1928 1694.96 62.6553 3.23307 PNS24246 1044 810.955 31.3527 3.38138 PNS24248 1044 810.955 31.3527 3.38138 PNS24244 1471 1237.96 22.2867 1.57455 PNS24243 293 109.213 0 0 KQK14069 1603 1369.96 3518.27 224.615 KQK14071 474 257.32 127.404 43.3036 ==> SRR5578510.se.tsv <== BRADI_1g14170v3 4202 BRADI_1g53295v3 86 BRADI_1g59795v3 409 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 139 BRADI_1g74790v3 54 BRADI_1g09890v3 0 BRADI_1g77505v3 202 BRADI_1g48960v3 0 SRR5578510 completed mapping pipeline successfully