Starting /dee2/code/volunteer_pipeline.sh SRR5578511 current disk space = 1522284208128 free memory = 1592663700 SRR5578511 SRAfilesize 042a39ee3d60dc0b712e1a17c9cd0bde SRR5578511.sra SRR5578511.sra file validated SRR5578511 is paired end SRR5578511 is conventional basespace SRR5578511 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74675 34.0 33.0 34.0 32.0 34.0 2 33.07275 34.0 33.0 34.0 32.0 34.0 3 33.1825 34.0 33.0 34.0 32.0 34.0 4 33.17175 34.0 33.0 34.0 32.0 34.0 5 33.293 34.0 33.0 34.0 33.0 34.0 6 36.93625 38.0 37.0 38.0 35.0 38.0 7 37.19075 38.0 38.0 38.0 36.0 38.0 8 37.424 38.0 38.0 38.0 37.0 38.0 9 37.4245 38.0 38.0 38.0 37.0 38.0 10-14 37.44665 38.0 38.0 38.0 37.0 38.0 15-19 37.4514 38.0 38.0 38.0 37.0 38.0 20-24 37.4481 38.0 38.0 38.0 37.0 38.0 25-29 37.445100000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.401 38.0 38.0 38.0 37.0 38.0 35-39 37.3548 38.0 38.0 38.0 37.2 38.0 40-44 37.231899999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.22085 38.0 38.0 38.0 36.6 38.0 50-54 37.19065 38.0 38.0 38.0 36.0 38.0 55-59 37.1222 38.0 38.0 38.0 36.0 38.0 60-64 37.01595 38.0 38.0 38.0 36.0 38.0 65-69 36.98694999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.9193 38.0 38.0 38.0 35.4 38.0 75-79 36.82795 38.0 38.0 38.0 34.8 38.0 80-84 36.73115 38.0 38.0 38.0 35.0 38.0 85-89 36.5007 38.0 38.0 38.0 34.0 38.0 90-94 36.527550000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.46695 38.0 38.0 38.0 34.0 38.0 100-104 36.331599999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.124249999999996 38.0 37.2 38.0 33.2 38.0 110-114 35.975649999999995 38.0 37.0 38.0 32.8 38.0 115-119 35.82685 38.0 36.4 38.0 32.6 38.0 120-124 35.4398 38.0 36.0 38.0 30.6 38.0 125-129 35.29085 38.0 35.8 38.0 29.8 38.0 130-134 34.95755 38.0 35.0 38.0 28.4 38.0 135-139 34.66045 38.0 35.0 38.0 27.2 38.0 140-144 34.14585 38.0 34.8 38.0 24.4 38.0 145-149 33.37185 38.0 34.0 38.0 20.0 38.0 150-151 29.114250000000002 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 3.0 10 0.0 11 1.0 12 1.0 13 4.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 2.0 20 5.0 21 3.0 22 6.0 23 8.0 24 9.0 25 16.0 26 16.0 27 19.0 28 37.0 29 29.0 30 38.0 31 59.0 32 90.0 33 89.0 34 155.0 35 311.0 36 764.0 37 2330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.02945817990531 10.047343503419253 7.680168332456602 38.243029984218836 2 25.074999999999996 13.5 34.375 27.05 3 22.7 17.299999999999997 23.974999999999998 36.025 4 28.825 25.55 20.175 25.45 5 26.525 30.925000000000004 22.900000000000002 19.650000000000002 6 24.275 31.674999999999997 21.4 22.650000000000002 7 19.225 22.15 39.2 19.425 8 20.825 22.75 28.199999999999996 28.225 9 20.525 21.95 32.15 25.374999999999996 10-14 24.08 26.029999999999998 24.205 25.685000000000002 15-19 23.82 25.085 25.195 25.900000000000002 20-24 23.244999999999997 24.759999999999998 25.715 26.279999999999998 25-29 23.97 24.740000000000002 24.97 26.32 30-34 23.965 24.39 25.385 26.26 35-39 23.794999999999998 24.82 25.16 26.224999999999998 40-44 24.37 24.959999999999997 25.040000000000003 25.629999999999995 45-49 24.315 24.465 25.16 26.06 50-54 24.055 24.575 25.385 25.985000000000003 55-59 24.665 24.32 24.85 26.165 60-64 24.91 25.014999999999997 24.305 25.77 65-69 24.099999999999998 24.735 25.509999999999998 25.655 70-74 24.595 24.455 24.64 26.31 75-79 24.26 24.55 24.91 26.279999999999998 80-84 24.13 24.21 24.995 26.665 85-89 24.66 24.195 24.81 26.334999999999997 90-94 24.66 24.97 24.255 26.115 95-99 24.91 24.465 24.48 26.145000000000003 100-104 25.169999999999998 24.27 24.73 25.83 105-109 25.205 24.215 24.7 25.88 110-114 24.57 25.040000000000003 24.26 26.13 115-119 25.130000000000003 24.575 24.43 25.865 120-124 25.215 24.21 24.185000000000002 26.39 125-129 24.959999999999997 24.68 24.235 26.125 130-134 25.64 25.095 23.27 25.995 135-139 24.57 25.035 24.065 26.33 140-144 25.485000000000003 24.855 23.44 26.22 145-149 24.805 25.180000000000003 23.78 26.235000000000003 150-151 24.7375 24.175 24.762500000000003 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 1.5 28 1.0 29 4.0 30 7.0 31 8.5 32 14.5 33 23.0 34 27.5 35 35.5 36 51.0 37 67.0 38 76.5 39 87.0 40 104.0 41 130.0 42 153.0 43 164.5 44 171.0 45 180.0 46 182.5 47 176.0 48 164.0 49 153.5 50 149.5 51 139.0 52 139.0 53 131.0 54 113.0 55 98.5 56 94.0 57 107.5 58 100.0 59 94.0 60 95.5 61 77.0 62 72.5 63 74.5 64 73.5 65 73.0 66 62.5 67 54.0 68 50.0 69 45.5 70 39.0 71 31.5 72 27.0 73 21.0 74 15.5 75 11.0 76 9.0 77 6.0 78 2.0 79 2.5 80 2.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06565656565657 98.075 2 0.8585858585858586 1.7000000000000002 3 0.07575757575757576 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8250000000000002 0.0 0.0 0.0 0.0 106-107 2.2125000000000004 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.2750000000000004 0.0 0.0 0.0 0.0 114-115 3.6500000000000004 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 7.0 0.0 0.0 0.0 0.0 128-129 7.6125 0.0 0.0 0.0 0.0 130-131 8.350000000000001 0.0 0.0 0.0 0.0 132-133 9.075 0.0 0.0 0.0 0.0 134-135 9.8875 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138-139 11.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTACT 10 0.006841402 144.925 145 CGTACCC 10 0.006841402 144.925 7 >>END_MODULE SRR5578511 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71875 33.0 33.0 34.0 32.0 34.0 2 32.86575 33.0 33.0 34.0 32.0 34.0 3 32.80925 33.0 33.0 34.0 32.0 34.0 4 32.7815 33.0 33.0 34.0 32.0 34.0 5 32.80425 33.0 33.0 34.0 32.0 34.0 6 36.86175 38.0 38.0 38.0 36.0 38.0 7 36.907 38.0 38.0 38.0 36.0 38.0 8 36.91525 38.0 38.0 38.0 36.0 38.0 9 36.8025 38.0 38.0 38.0 35.0 38.0 10-14 36.87015 38.0 38.0 38.0 36.0 38.0 15-19 36.863099999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.8435 38.0 38.0 38.0 36.0 38.0 25-29 36.835899999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.8602 38.0 38.0 38.0 36.0 38.0 35-39 36.79515 38.0 38.0 38.0 36.0 38.0 40-44 36.826049999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.822599999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.65455000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.53830000000001 38.0 38.0 38.0 34.8 38.0 60-64 36.48145 38.0 38.0 38.0 34.4 38.0 65-69 36.51055 38.0 38.0 38.0 34.6 38.0 70-74 36.402550000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.294650000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.345549999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.16295 38.0 38.0 38.0 33.4 38.0 90-94 36.04085 38.0 38.0 38.0 33.0 38.0 95-99 35.86755 38.0 37.6 38.0 32.4 38.0 100-104 35.638000000000005 38.0 37.0 38.0 31.6 38.0 105-109 35.4702 38.0 36.8 38.0 31.4 38.0 110-114 35.31945 38.0 36.2 38.0 29.8 38.0 115-119 35.15645 38.0 36.0 38.0 28.8 38.0 120-124 34.76495 38.0 35.2 38.0 26.6 38.0 125-129 34.44894999999999 38.0 35.0 38.0 25.2 38.0 130-134 33.9812 38.0 34.2 38.0 22.8 38.0 135-139 33.41995 38.0 33.2 38.0 20.2 38.0 140-144 32.82045 38.0 33.0 38.0 16.2 38.0 145-149 31.3825 38.0 31.2 38.0 8.0 38.0 150-151 26.144625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 0.0 5 1.0 6 3.0 7 3.0 8 1.0 9 1.0 10 2.0 11 4.0 12 1.0 13 1.0 14 4.0 15 5.0 16 4.0 17 8.0 18 4.0 19 9.0 20 8.0 21 13.0 22 13.0 23 9.0 24 30.0 25 25.0 26 27.0 27 34.0 28 29.0 29 44.0 30 69.0 31 68.0 32 81.0 33 127.0 34 215.0 35 283.0 36 717.0 37 2144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.525 16.25 10.5 33.725 2 28.975 23.599999999999998 27.250000000000004 20.175 3 23.9 24.4 26.3 25.4 4 28.225 29.299999999999997 19.75 22.725 5 28.549999999999997 32.475 18.625 20.349999999999998 6 22.775000000000002 34.150000000000006 20.175 22.900000000000002 7 22.675 17.849999999999998 34.65 24.825 8 24.224999999999998 21.7 23.400000000000002 30.675 9 24.025 21.85 27.175 26.950000000000003 10-14 26.224999999999998 25.465 22.0 26.31 15-19 26.445 24.104999999999997 23.24 26.21 20-24 26.445 25.44 23.315 24.8 25-29 25.53 24.455 23.985 26.029999999999998 30-34 26.07 24.51 23.705000000000002 25.715 35-39 26.009999999999998 25.124999999999996 23.68 25.185000000000002 40-44 26.340000000000003 24.55 23.365 25.745 45-49 26.040000000000003 24.57 23.445 25.945 50-54 26.095000000000002 24.42 24.240000000000002 25.245 55-59 27.115000000000002 24.195 23.765 24.925 60-64 26.165 24.22 23.91 25.705 65-69 25.990000000000002 24.805 23.674999999999997 25.53 70-74 26.445 23.82 23.76 25.974999999999998 75-79 26.505000000000003 24.385 23.580000000000002 25.53 80-84 25.650000000000002 24.87 23.645 25.835 85-89 26.31 24.86 23.425 25.405 90-94 26.415 24.77 23.695 25.119999999999997 95-99 26.284999999999997 24.825 23.810000000000002 25.080000000000002 100-104 27.045 24.215 23.825 24.915000000000003 105-109 26.655 25.080000000000002 23.68 24.585 110-114 26.52 24.685000000000002 24.224999999999998 24.57 115-119 26.865 25.259999999999998 23.25 24.625 120-124 26.915 25.025 23.665 24.395 125-129 27.48 24.765 23.595 24.16 130-134 27.73 25.145 23.145 23.98 135-139 28.075 24.87 23.425 23.630000000000003 140-144 28.084999999999997 26.06 23.22 22.634999999999998 145-149 28.03 25.685000000000002 23.305 22.98 150-151 28.325 25.650000000000002 22.9625 23.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 0.0 29 1.0 30 4.0 31 6.0 32 8.5 33 15.0 34 20.0 35 30.0 36 41.0 37 50.0 38 63.5 39 77.0 40 110.5 41 133.5 42 126.5 43 133.0 44 154.0 45 157.5 46 150.5 47 151.5 48 149.0 49 151.5 50 153.0 51 135.5 52 132.5 53 138.5 54 128.0 55 117.0 56 102.0 57 102.0 58 110.0 59 109.5 60 106.5 61 101.0 62 97.0 63 97.0 64 84.5 65 80.5 66 73.0 67 53.5 68 66.5 69 67.5 70 49.5 71 45.0 72 38.0 73 30.5 74 22.0 75 10.5 76 5.0 77 2.0 78 2.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93643960496328 97.675 2 0.9369460622942517 1.8499999999999999 3 0.07596859964547988 0.22499999999999998 4 0.0 0.0 5 0.05064573309698658 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.7 0.0 0.0 0.0 0.0 116-117 4.1125 0.0 0.0 0.0 0.0 118-119 4.6125 0.0 0.0 0.0 0.0 120-121 5.1375 0.0 0.0 0.0 0.0 122-123 5.6375 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.95 0.0 0.0 0.0 0.0 128-129 7.575 0.0 0.0 0.0 0.0 130-131 8.325 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.825 0.0 0.0 0.0 0.0 136-137 10.475000000000001 0.0 0.0 0.0 0.0 138-139 11.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357916 spots for SRR5578511.sra Written 1357916 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra Read 1357897 spots for SRR5578511.sra Written 1357897 spots for SRR5578511.sra SRR ids: ['SRR5578511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w6uzu9na SRR5578511.sra spots: 27157959 blocks: [[1, 1357897], [1357898, 2715794], [2715795, 4073691], [4073692, 5431588], [5431589, 6789485], [6789486, 8147382], [8147383, 9505279], [9505280, 10863176], [10863177, 12221073], [12221074, 13578970], [13578971, 14936867], [14936868, 16294764], [16294765, 17652661], [17652662, 19010558], [19010559, 20368455], [20368456, 21726352], [21726353, 23084249], [23084250, 24442146], [24442147, 25800043], [25800044, 27157959]] SRR5578511 file size 9181240 SRR5578511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578511 SRR5578511_1.fastq SRR5578511_2.fastq Input file: SRR5578511_1.fastq Paired file: SRR5578511_2.fastq trimmed: SRR5578511-trimmed-pair1.fastq, SRR5578511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:44:21 2024 >> started Mon Dec 9 21:44:54 2024 >> done (32.415s) 27157959 read pairs processed; of these: 27624 ( 0.10%) short read pairs filtered out after trimming by size control 23551 ( 0.09%) empty read pairs filtered out after trimming by size control 27106784 (99.81%) read pairs available; of these: 14327061 (52.85%) trimmed read pairs available after processing 12779723 (47.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 9 0.00% 21 15 0.00% 22 13 0.00% 23 14 0.00% 24 17 0.00% 25 14 0.00% 26 32 0.00% 27 18 0.00% 28 28 0.00% 29 13 0.00% 30 33 0.00% 31 29 0.00% 32 28 0.00% 33 30 0.00% 34 28 0.00% 35 37 0.00% 36 40 0.00% 37 47 0.00% 38 36 0.00% 39 56 0.00% 40 64 0.00% 41 71 0.00% 42 81 0.00% 43 79 0.00% 44 85 0.00% 45 103 0.00% 46 106 0.00% 47 153 0.00% 48 153 0.00% 49 179 0.00% 50 197 0.00% 51 234 0.00% 52 269 0.00% 53 295 0.00% 54 276 0.00% 55 378 0.00% 56 428 0.00% 57 447 0.00% 58 516 0.00% 59 618 0.00% 60 700 0.00% 61 761 0.00% 62 895 0.00% 63 981 0.00% 64 1126 0.00% 65 1248 0.00% 66 1371 0.01% 67 1583 0.01% 68 1765 0.01% 69 2229 0.01% 70 2507 0.01% 71 2680 0.01% 72 3180 0.01% 73 3548 0.01% 74 3936 0.01% 75 4430 0.02% 76 4906 0.02% 77 5390 0.02% 78 5974 0.02% 79 6947 0.03% 80 7748 0.03% 81 8782 0.03% 82 9956 0.04% 83 10947 0.04% 84 13023 0.05% 85 14903 0.05% 86 15902 0.06% 87 16965 0.06% 88 18027 0.07% 89 19253 0.07% 90 20643 0.08% 91 22471 0.08% 92 24157 0.09% 93 25729 0.09% 94 27643 0.10% 95 29422 0.11% 96 31192 0.12% 97 32856 0.12% 98 34664 0.13% 99 36593 0.13% 100 38792 0.14% 101 40987 0.15% 102 43229 0.16% 103 45479 0.17% 104 48112 0.18% 105 49840 0.18% 106 52870 0.20% 107 54390 0.20% 108 56691 0.21% 109 59062 0.22% 110 61315 0.23% 111 63271 0.23% 112 66914 0.25% 113 69065 0.25% 114 72114 0.27% 115 75433 0.28% 116 77759 0.29% 117 80042 0.30% 118 81392 0.30% 119 83705 0.31% 120 87277 0.32% 121 90312 0.33% 122 92742 0.34% 123 96452 0.36% 124 99910 0.37% 125 103200 0.38% 126 106883 0.39% 127 109794 0.41% 128 111476 0.41% 129 115567 0.43% 130 118008 0.44% 131 122100 0.45% 132 126235 0.47% 133 131095 0.48% 134 134317 0.50% 135 139552 0.51% 136 144697 0.53% 137 150603 0.56% 138 155363 0.57% 139 165279 0.61% 140 174590 0.64% 141 185934 0.69% 142 203830 0.75% 143 220722 0.81% 144 248100 0.92% 145 286647 1.06% 146 344822 1.27% 147 450848 1.66% 148 662318 2.44% 149 1289909 4.76% 150 6155694 22.71% 151 12779723 47.15% 27106784 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=17 prefix-density=0.96 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=12.05 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=2.9 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=12 prefix-density=0.69 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=46.62 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.5 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578511 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:45:45 Started mapping on | Dec 09 21:45:45 Finished on | Dec 09 21:51:35 Mapping speed, Million of reads per hour | 278.81 Number of input reads | 27106784 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 25358590 Uniquely mapped reads % | 93.55% Average mapped length | 290.59 Number of splices: Total | 26087821 Number of splices: Annotated (sjdb) | 24663310 Number of splices: GT/AG | 25755375 Number of splices: GC/AG | 301441 Number of splices: AT/AC | 13186 Number of splices: Non-canonical | 17819 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355833 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 48671 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1411605 1411605 1411605 N_multimapping 355833 355833 355833 N_noFeature 899225 24653693 1123196 N_ambiguous 561496 2887 82184 UnstrandedReadsAssigned:23897869 PositiveStrandReadsAssigned:702010 NegativeStrandReadsAssigned:24153210 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578511-trimmed-pair1.fastq SRR5578511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,106,784 reads, 24,280,810 reads pseudoaligned [quant] estimated average fragment length: 242.476 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR5578511.ke.tsv 35125 SRR5578511.se.tsv 88098 total ==> SRR5578511.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.985 6.48644e-05 5.54396e-06 PNS24247 1044 802.524 55.9673 4.14253 PNS24249 1928 1686.52 80.0587 2.81971 PNS24246 1044 802.524 55.9673 4.14253 PNS24248 1044 802.524 55.9673 4.14253 PNS24244 1471 1229.52 74.0394 3.57697 PNS24243 293 104.516 1 0.568335 KQK14069 1603 1361.52 138.729 6.05245 KQK14071 474 249.918 5.08574 1.20878 ==> SRR5578511.se.tsv <== BRADI_1g14170v3 168 BRADI_1g53295v3 203 BRADI_1g59795v3 468 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2534 BRADI_1g74790v3 133 BRADI_1g09890v3 5 BRADI_1g77505v3 281 BRADI_1g48960v3 0 SRR5578511 completed mapping pipeline successfully