Starting /dee2/code/volunteer_pipeline.sh SRR5578512 current disk space = 1522322980864 free memory = 1414623644 SRR5578512 SRAfilesize 89b6e575b74abc8b314f887fd79d2161 SRR5578512.sra SRR5578512.sra file validated SRR5578512 is paired end SRR5578512 is conventional basespace SRR5578512 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.902 34.0 34.0 34.0 33.0 34.0 2 33.4515 34.0 34.0 34.0 33.0 34.0 3 33.517 34.0 34.0 34.0 33.0 34.0 4 33.52075 34.0 34.0 34.0 33.0 34.0 5 33.57225 34.0 34.0 34.0 33.0 34.0 6 37.25475 38.0 38.0 38.0 36.0 38.0 7 37.36875 38.0 38.0 38.0 37.0 38.0 8 37.55275 38.0 38.0 38.0 37.0 38.0 9 37.63075 38.0 38.0 38.0 38.0 38.0 10-14 37.5809 38.0 38.0 38.0 38.0 38.0 15-19 37.62050000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.6114 38.0 38.0 38.0 38.0 38.0 25-29 37.5937 38.0 38.0 38.0 38.0 38.0 30-34 37.57620000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5312 38.0 38.0 38.0 38.0 38.0 40-44 37.429700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.41165 38.0 38.0 38.0 37.0 38.0 50-54 37.36265 38.0 38.0 38.0 37.0 38.0 55-59 37.3546 38.0 38.0 38.0 37.0 38.0 60-64 37.31995 38.0 38.0 38.0 37.0 38.0 65-69 37.25425 38.0 38.0 38.0 36.4 38.0 70-74 37.1803 38.0 38.0 38.0 36.4 38.0 75-79 37.19245 38.0 38.0 38.0 36.2 38.0 80-84 37.0901 38.0 38.0 38.0 36.0 38.0 85-89 36.99365 38.0 38.0 38.0 35.8 38.0 90-94 36.9413 38.0 38.0 38.0 35.2 38.0 95-99 36.80525 38.0 38.0 38.0 35.0 38.0 100-104 36.718849999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.5587 38.0 38.0 38.0 34.0 38.0 110-114 36.43425 38.0 38.0 38.0 34.0 38.0 115-119 36.24285 38.0 37.8 38.0 33.2 38.0 120-124 36.13680000000001 38.0 37.6 38.0 33.4 38.0 125-129 35.91885 38.0 36.8 38.0 33.0 38.0 130-134 35.5699 38.0 36.0 38.0 31.0 38.0 135-139 35.2783 38.0 36.0 38.0 30.6 38.0 140-144 34.689350000000005 38.0 35.0 38.0 27.6 38.0 145-149 34.05195 38.0 35.0 38.0 24.8 38.0 150-151 30.03775 36.0 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 3.0 20 2.0 21 5.0 22 8.0 23 8.0 24 4.0 25 8.0 26 20.0 27 16.0 28 12.0 29 22.0 30 39.0 31 28.0 32 51.0 33 86.0 34 139.0 35 211.0 36 658.0 37 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4516211386265 11.539443451621139 10.084248149093694 34.924687260658665 2 24.575 14.75 32.824999999999996 27.85 3 23.375 19.05 24.65 32.925 4 27.025 26.825 20.45 25.7 5 26.05 31.225 22.85 19.875 6 22.25 32.95 23.974999999999998 20.825 7 17.549999999999997 23.425 38.925 20.1 8 19.900000000000002 24.2 29.475 26.424999999999997 9 20.175 22.625 31.674999999999997 25.525 10-14 22.900000000000002 26.529999999999998 25.27 25.3 15-19 23.669999999999998 26.0 25.045 25.285000000000004 20-24 23.580000000000002 25.3 25.47 25.650000000000002 25-29 23.369999999999997 25.735000000000003 25.624999999999996 25.27 30-34 23.57 25.36 25.035 26.035000000000004 35-39 23.64 25.564999999999998 25.619999999999997 25.174999999999997 40-44 23.275000000000002 25.495 25.064999999999998 26.165 45-49 23.115 25.435000000000002 25.395 26.055 50-54 23.86 25.4 24.98 25.759999999999998 55-59 23.855 25.755 24.965 25.424999999999997 60-64 23.77 25.629999999999995 24.73 25.869999999999997 65-69 23.665 25.555 24.65 26.13 70-74 24.275 24.755 25.205 25.765 75-79 24.175 24.545 25.305 25.974999999999998 80-84 23.630000000000003 25.835 24.685000000000002 25.85 85-89 23.98 25.064999999999998 24.73 26.224999999999998 90-94 24.585 25.205 24.135 26.075 95-99 23.96 25.130000000000003 25.095 25.814999999999998 100-104 23.91 25.785000000000004 24.404999999999998 25.900000000000002 105-109 23.974999999999998 25.259999999999998 25.0 25.765 110-114 24.14 25.255 24.529999999999998 26.075 115-119 24.29 25.264999999999997 24.005000000000003 26.44 120-124 24.545 25.435000000000002 23.794999999999998 26.224999999999998 125-129 24.861243062153108 25.331266563328164 23.68618430921546 26.121306065303262 130-134 24.88248824882488 25.02250225022502 24.21242124212421 25.882588258825884 135-139 24.685000000000002 25.05 23.875 26.39 140-144 25.03 24.845 23.355 26.77 145-149 24.79 25.755 23.27 26.185000000000002 150-151 24.408857750531716 24.82171900412861 23.207806830977106 27.561616414362568 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 1.5 28 2.5 29 6.0 30 9.0 31 11.5 32 14.0 33 26.5 34 36.0 35 51.5 36 72.0 37 81.0 38 94.0 39 105.5 40 128.0 41 158.0 42 162.5 43 168.0 44 184.0 45 187.0 46 188.5 47 178.0 48 167.0 49 151.0 50 140.5 51 140.0 52 125.5 53 109.0 54 91.5 55 91.0 56 94.0 57 87.5 58 84.0 59 73.5 60 75.5 61 75.0 62 69.5 63 65.5 64 58.0 65 55.5 66 48.5 67 50.0 68 52.0 69 48.0 70 41.0 71 33.5 72 28.0 73 20.0 74 15.0 75 14.0 76 10.0 77 5.5 78 4.0 79 3.5 80 2.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.01 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83514813876931 97.575 2 1.063560395036718 2.1 3 0.07596859964547988 0.22499999999999998 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.15000000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.9 0.0 0.0 0.0 0.0 108-109 3.25 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.2625 0.0 0.0 0.0 0.0 114-115 4.762499999999999 0.0 0.0 0.0 0.0 116-117 5.1875 0.0 0.0 0.0 0.0 118-119 5.5875 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.6125 0.0 0.0 0.0 0.0 124-125 7.324999999999999 0.0 0.0 0.0 0.0 126-127 7.8625 0.0 0.0 0.0 0.0 128-129 8.5625 0.0 0.0 0.0 0.0 130-131 9.0375 0.0 0.0 0.0 0.0 132-133 9.8875 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.7625 0.0 0.0 0.0 0.0 138-139 12.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578512 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578512_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0655 33.0 33.0 34.0 32.0 34.0 2 33.18225 34.0 33.0 34.0 33.0 34.0 3 33.1875 34.0 33.0 34.0 33.0 34.0 4 33.14 34.0 33.0 34.0 33.0 34.0 5 33.15775 34.0 33.0 34.0 33.0 34.0 6 37.321 38.0 38.0 38.0 37.0 38.0 7 37.31825 38.0 38.0 38.0 37.0 38.0 8 37.28975 38.0 38.0 38.0 37.0 38.0 9 37.35825 38.0 38.0 38.0 38.0 38.0 10-14 37.329750000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.3449 38.0 38.0 38.0 37.2 38.0 20-24 37.30285 38.0 38.0 38.0 37.0 38.0 25-29 37.28444999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.288149999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.25750000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.200900000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.1969 38.0 38.0 38.0 37.0 38.0 50-54 37.1228 38.0 38.0 38.0 37.0 38.0 55-59 37.0558 38.0 38.0 38.0 36.8 38.0 60-64 36.952200000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.9189 38.0 38.0 38.0 36.0 38.0 70-74 36.817750000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.7872 38.0 38.0 38.0 35.6 38.0 80-84 36.650999999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.5744 38.0 38.0 38.0 35.0 38.0 90-94 36.505100000000006 38.0 38.0 38.0 34.6 38.0 95-99 36.287549999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.12265000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.839600000000004 38.0 38.0 38.0 32.6 38.0 110-114 35.58705 38.0 37.2 38.0 31.2 38.0 115-119 35.26505 38.0 36.4 38.0 29.8 38.0 120-124 35.101 38.0 36.0 38.0 28.8 38.0 125-129 34.65435 38.0 35.4 38.0 27.0 38.0 130-134 34.159 38.0 34.4 38.0 24.2 38.0 135-139 33.60525 38.0 33.0 38.0 22.2 38.0 140-144 32.7368 38.0 32.8 38.0 14.6 38.0 145-149 31.1259 38.0 31.2 38.0 6.0 38.0 150-151 25.724249999999998 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 4.0 4 1.0 5 1.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 3.0 12 3.0 13 4.0 14 1.0 15 7.0 16 3.0 17 8.0 18 5.0 19 8.0 20 5.0 21 11.0 22 17.0 23 15.0 24 13.0 25 18.0 26 18.0 27 28.0 28 21.0 29 33.0 30 45.0 31 61.0 32 86.0 33 103.0 34 182.0 35 291.0 36 692.0 37 2308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.35 17.075000000000003 10.75 27.825 2 29.475 23.45 25.95 21.125 3 24.6 25.074999999999996 27.35 22.975 4 27.224999999999998 31.05 18.925 22.8 5 27.35 32.45 20.474999999999998 19.725 6 24.349999999999998 32.375 20.775 22.5 7 23.025000000000002 17.849999999999998 34.0 25.124999999999996 8 24.099999999999998 23.1 23.525 29.275000000000002 9 24.349999999999998 22.225 27.0 26.424999999999997 10-14 26.155 25.575 22.605 25.665 15-19 25.869999999999997 24.595 24.085 25.45 20-24 26.009999999999998 24.805 24.22 24.965 25-29 26.950000000000003 24.26 23.485 25.305 30-34 26.474999999999998 24.92 23.815 24.79 35-39 25.785000000000004 24.935 23.830000000000002 25.45 40-44 26.38 24.585 23.465 25.569999999999997 45-49 26.1 24.545 24.65 24.705 50-54 26.105 24.84 24.41 24.645 55-59 26.44 24.485 24.625 24.45 60-64 26.205000000000002 24.44 24.485 24.87 65-69 26.52 24.325 24.455 24.7 70-74 26.6 24.44 24.175 24.785 75-79 26.009999999999998 24.51 24.5 24.98 80-84 26.334999999999997 24.67 24.39 24.605 85-89 26.095000000000002 24.560000000000002 24.465 24.88 90-94 25.985000000000003 25.215 24.335 24.465 95-99 26.240000000000002 25.335 24.349999999999998 24.075 100-104 27.125 25.025 23.995 23.855 105-109 26.575 25.005 24.37 24.05 110-114 26.674999999999997 25.385 23.785 24.154999999999998 115-119 26.945000000000004 25.590000000000003 23.915 23.549999999999997 120-124 26.31 25.319999999999997 24.51 23.86 125-129 26.985 25.275 24.13 23.61 130-134 27.785 25.374999999999996 23.72 23.119999999999997 135-139 27.49 25.55 23.94 23.02 140-144 28.205000000000002 25.825 23.865 22.105 145-149 28.345 25.86 23.66 22.134999999999998 150-151 29.212500000000002 26.025 22.8875 21.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 2.0 29 3.5 30 5.5 31 10.0 32 13.0 33 16.0 34 24.0 35 32.0 36 43.0 37 69.0 38 89.0 39 98.0 40 119.0 41 129.0 42 130.0 43 147.5 44 168.5 45 162.5 46 172.0 47 179.5 48 156.5 49 150.0 50 138.0 51 128.0 52 133.5 53 118.0 54 102.5 55 103.0 56 95.5 57 97.0 58 106.0 59 99.5 60 83.0 61 74.0 62 77.5 63 80.5 64 76.5 65 66.5 66 67.5 67 67.0 68 61.5 69 68.5 70 57.5 71 40.5 72 33.5 73 29.0 74 21.5 75 17.5 76 15.5 77 8.5 78 5.0 79 2.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57687420584497 96.975 2 1.2198221092757306 2.4 3 0.17789072426937738 0.525 4 0.025412960609911054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1625 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6375 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.9625000000000004 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.35 0.0 0.0 0.0 0.0 114-115 4.8125 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.074999999999999 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.3875 0.0 0.0 0.0 0.0 126-127 7.9125000000000005 0.0 0.0 0.0 0.0 128-129 8.6375 0.0 0.0 0.0 0.0 130-131 9.1375 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 11.075 0.0 0.0 0.0 0.0 136-137 11.85 0.0 0.0 0.0 0.0 138-139 12.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889450 spots for SRR5578512.sra Written 889450 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra Read 889442 spots for SRR5578512.sra Written 889442 spots for SRR5578512.sra SRR ids: ['SRR5578512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6yvnu5_1 SRR5578512.sra spots: 17788848 blocks: [[1, 889442], [889443, 1778884], [1778885, 2668326], [2668327, 3557768], [3557769, 4447210], [4447211, 5336652], [5336653, 6226094], [6226095, 7115536], [7115537, 8004978], [8004979, 8894420], [8894421, 9783862], [9783863, 10673304], [10673305, 11562746], [11562747, 12452188], [12452189, 13341630], [13341631, 14231072], [14231073, 15120514], [15120515, 16009956], [16009957, 16899398], [16899399, 17788848]] SRR5578512 file size 6006356 SRR5578512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578512 SRR5578512_1.fastq SRR5578512_2.fastq Input file: SRR5578512_1.fastq Paired file: SRR5578512_2.fastq trimmed: SRR5578512-trimmed-pair1.fastq, SRR5578512-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:42:34 2024 >> started Mon Dec 9 21:43:02 2024 >> done (27.149s) 17788848 read pairs processed; of these: 23104 ( 0.13%) short read pairs filtered out after trimming by size control 25189 ( 0.14%) empty read pairs filtered out after trimming by size control 17740555 (99.73%) read pairs available; of these: 9449172 (53.26%) trimmed read pairs available after processing 8291383 (46.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 14 0.00% 21 14 0.00% 22 5 0.00% 23 14 0.00% 24 11 0.00% 25 8 0.00% 26 13 0.00% 27 16 0.00% 28 18 0.00% 29 12 0.00% 30 21 0.00% 31 18 0.00% 32 23 0.00% 33 24 0.00% 34 26 0.00% 35 36 0.00% 36 19 0.00% 37 22 0.00% 38 23 0.00% 39 27 0.00% 40 34 0.00% 41 49 0.00% 42 39 0.00% 43 70 0.00% 44 56 0.00% 45 71 0.00% 46 100 0.00% 47 90 0.00% 48 109 0.00% 49 104 0.00% 50 161 0.00% 51 178 0.00% 52 199 0.00% 53 192 0.00% 54 226 0.00% 55 253 0.00% 56 287 0.00% 57 294 0.00% 58 309 0.00% 59 369 0.00% 60 473 0.00% 61 514 0.00% 62 637 0.00% 63 683 0.00% 64 798 0.00% 65 911 0.01% 66 1100 0.01% 67 1368 0.01% 68 1993 0.01% 69 3156 0.02% 70 2822 0.02% 71 2184 0.01% 72 2365 0.01% 73 2551 0.01% 74 2859 0.02% 75 3100 0.02% 76 3544 0.02% 77 4013 0.02% 78 4321 0.02% 79 4941 0.03% 80 5713 0.03% 81 6507 0.04% 82 7282 0.04% 83 8068 0.05% 84 9755 0.05% 85 11165 0.06% 86 12207 0.07% 87 12916 0.07% 88 13734 0.08% 89 14329 0.08% 90 15587 0.09% 91 16835 0.09% 92 18167 0.10% 93 19614 0.11% 94 21354 0.12% 95 22307 0.13% 96 23731 0.13% 97 24851 0.14% 98 25935 0.15% 99 27310 0.15% 100 28449 0.16% 101 30255 0.17% 102 32477 0.18% 103 34424 0.19% 104 35813 0.20% 105 37569 0.21% 106 39603 0.22% 107 40724 0.23% 108 41680 0.23% 109 43277 0.24% 110 44767 0.25% 111 46352 0.26% 112 49505 0.28% 113 51430 0.29% 114 53593 0.30% 115 56451 0.32% 116 57279 0.32% 117 58804 0.33% 118 59547 0.34% 119 60768 0.34% 120 62313 0.35% 121 63974 0.36% 122 65873 0.37% 123 68507 0.39% 124 71540 0.40% 125 73785 0.42% 126 76400 0.43% 127 77128 0.43% 128 78182 0.44% 129 80254 0.45% 130 81392 0.46% 131 82959 0.47% 132 86652 0.49% 133 89412 0.50% 134 92740 0.52% 135 95145 0.54% 136 98098 0.55% 137 100689 0.57% 138 104451 0.59% 139 108942 0.61% 140 114369 0.64% 141 120440 0.68% 142 129058 0.73% 143 139704 0.79% 144 154027 0.87% 145 178991 1.01% 146 213981 1.21% 147 278192 1.57% 148 404736 2.28% 149 805876 4.54% 150 3983325 22.45% 151 8291383 46.74% 17740555 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=13 prefix-density=0.93 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=16.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.6 sequence=GTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=4.78 fanout-score-rank=11 prefix-density=0.94 prefix-fanout=3.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.23 sequence-density-rank=22 fanout-score=45.77 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=12.8 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAAC SRR5578512 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:44:04 Started mapping on | Dec 09 21:44:04 Finished on | Dec 09 21:48:06 Mapping speed, Million of reads per hour | 263.91 Number of input reads | 17740555 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16223398 Uniquely mapped reads % | 91.45% Average mapped length | 289.53 Number of splices: Total | 15452067 Number of splices: Annotated (sjdb) | 14570122 Number of splices: GT/AG | 15250082 Number of splices: GC/AG | 183785 Number of splices: AT/AC | 7575 Number of splices: Non-canonical | 10625 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230842 % of reads mapped to multiple loci | 1.30% Number of reads mapped to too many loci | 39746 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.84% % of reads unmapped: other | 1.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1301505 1301505 1301505 N_multimapping 230842 230842 230842 N_noFeature 540485 15751855 666029 N_ambiguous 409995 1882 64533 UnstrandedReadsAssigned:15272918 PositiveStrandReadsAssigned:469661 NegativeStrandReadsAssigned:15492836 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5578512 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578512-trimmed-pair1.fastq SRR5578512-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,740,555 reads, 15,569,850 reads pseudoaligned [quant] estimated average fragment length: 229.625 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 SRR5578512.ke.tsv 35125 SRR5578512.se.tsv 88098 total ==> SRR5578512.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.719 0 0 PNS24247 1044 815.375 36.317 3.70772 PNS24249 1928 1699.37 63.6635 3.11857 PNS24246 1044 815.375 36.317 3.70772 PNS24248 1044 815.375 36.317 3.70772 PNS24244 1471 1242.37 95.3856 6.39122 PNS24243 293 107.507 0 0 KQK14069 1603 1374.37 1631.01 98.7883 KQK14071 474 257.933 52.0902 16.8114 ==> SRR5578512.se.tsv <== BRADI_1g14170v3 1808 BRADI_1g53295v3 36 BRADI_1g59795v3 541 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 1998 BRADI_1g74790v3 67 BRADI_1g09890v3 2 BRADI_1g77505v3 306 BRADI_1g48960v3 0 SRR5578512 completed mapping pipeline successfully