Starting /dee2/code/volunteer_pipeline.sh SRR5578513 current disk space = 1522422624256 free memory = 1429727484 SRR5578513 SRAfilesize 5774529e79cd3e008197334cb32d6c2e SRR5578513.sra SRR5578513.sra file validated SRR5578513 is paired end SRR5578513 is conventional basespace SRR5578513 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12825 34.0 33.0 34.0 33.0 34.0 2 33.32625 34.0 34.0 34.0 33.0 34.0 3 33.39375 34.0 34.0 34.0 33.0 34.0 4 33.51375 34.0 34.0 34.0 33.0 34.0 5 33.52675 34.0 34.0 34.0 33.0 34.0 6 37.131 38.0 37.0 38.0 36.0 38.0 7 37.4005 38.0 38.0 38.0 37.0 38.0 8 37.5235 38.0 38.0 38.0 37.0 38.0 9 37.62975 38.0 38.0 38.0 38.0 38.0 10-14 37.617200000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.59565 38.0 38.0 38.0 38.0 38.0 20-24 37.56225 38.0 38.0 38.0 38.0 38.0 25-29 37.54905 38.0 38.0 38.0 38.0 38.0 30-34 37.509899999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.4172 38.0 38.0 38.0 37.4 38.0 40-44 37.11535 38.0 38.0 38.0 36.6 38.0 45-49 37.258 38.0 38.0 38.0 37.0 38.0 50-54 37.1731 38.0 38.0 38.0 36.4 38.0 55-59 37.14515 38.0 38.0 38.0 36.0 38.0 60-64 37.1227 38.0 38.0 38.0 36.0 38.0 65-69 37.04705 38.0 38.0 38.0 36.0 38.0 70-74 36.48004999999999 38.0 38.0 38.0 34.4 38.0 75-79 34.8556 38.0 38.0 38.0 29.8 38.0 80-84 34.69875 38.0 38.0 38.0 28.4 38.0 85-89 34.573299999999996 38.0 38.0 38.0 28.2 38.0 90-94 34.56394999999999 38.0 37.8 38.0 28.4 38.0 95-99 34.34695000000001 38.0 37.0 38.0 26.8 38.0 100-104 34.20005 38.0 36.4 38.0 24.8 38.0 105-109 34.02525000000001 38.0 36.4 38.0 22.8 38.0 110-114 33.864850000000004 38.0 36.0 38.0 22.2 38.0 115-119 33.7097 38.0 35.8 38.0 17.8 38.0 120-124 33.5017 38.0 35.0 38.0 15.0 38.0 125-129 33.19595 38.0 35.0 38.0 14.4 38.0 130-134 32.94265 38.0 34.8 38.0 14.0 38.0 135-139 32.5876 38.0 34.0 38.0 13.4 38.0 140-144 32.174549999999996 38.0 33.6 38.0 13.0 38.0 145-149 31.274549999999998 38.0 33.0 38.0 2.0 38.0 150-151 27.134625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 3.0 16 6.0 17 15.0 18 84.0 19 142.0 20 15.0 21 10.0 22 6.0 23 5.0 24 11.0 25 15.0 26 18.0 27 21.0 28 24.0 29 24.0 30 27.0 31 43.0 32 58.0 33 77.0 34 126.0 35 268.0 36 717.0 37 2276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.03090623363017 10.450497642744892 8.800419067574646 31.71817705605029 2 23.35 19.45 30.3 26.900000000000002 3 20.880220055013755 17.5293823455864 28.40710177544386 33.18329582395599 4 24.875 23.075000000000003 19.925 32.125 5 31.35 27.725 20.625 20.3 6 28.425 29.625 21.725 20.225 7 17.175 27.650000000000002 35.35 19.825 8 20.150000000000002 27.85 26.6 25.4 9 25.4 20.674999999999997 29.049999999999997 24.875 10-14 22.825 27.35 23.294999999999998 26.529999999999998 15-19 23.39 24.5 24.95 27.16 20-24 23.09 26.295 24.69 25.924999999999997 25-29 23.66 24.865000000000002 24.6 26.875 30-34 22.59 26.045 24.44 26.924999999999997 35-39 24.245 24.63 25.575 25.55 40-44 22.925 24.495 25.445 27.134999999999998 45-49 25.505 24.529999999999998 25.525 24.44 50-54 24.125 23.305 24.645 27.925 55-59 24.125 23.03 27.015 25.83 60-64 23.875 24.775 25.430000000000003 25.919999999999998 65-69 22.335 29.53 23.169999999999998 24.965 70-74 22.955000000000002 29.12 23.189999999999998 24.735 75-79 22.985 28.575 23.44 25.0 80-84 23.585 26.584999999999997 23.990000000000002 25.840000000000003 85-89 24.615000000000002 25.28 24.08 26.025 90-94 24.154999999999998 24.884999999999998 24.555 26.405 95-99 23.835 25.1 25.09 25.974999999999998 100-104 23.84 27.765 23.22 25.174999999999997 105-109 23.54 28.78 22.755 24.925 110-114 23.325000000000003 28.050000000000004 23.345 25.28 115-119 24.02 27.605 22.805 25.569999999999997 120-124 24.285 26.965 22.264999999999997 26.484999999999996 125-129 23.919999999999998 27.115000000000002 22.765 26.200000000000003 130-134 23.715 26.765 23.244999999999997 26.275 135-139 23.635 26.56 23.7 26.105 140-144 23.73 26.900000000000002 22.400000000000002 26.97 145-149 23.425 27.0 23.46 26.115 150-151 23.5625 27.1125 23.4375 25.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 2.5 29 4.5 30 5.0 31 7.0 32 11.5 33 22.5 34 29.0 35 42.0 36 61.0 37 73.5 38 110.0 39 134.0 40 149.0 41 169.5 42 164.5 43 158.5 44 167.0 45 161.5 46 151.5 47 161.5 48 162.0 49 156.5 50 144.0 51 126.0 52 111.0 53 100.0 54 100.5 55 100.0 56 108.5 57 101.5 58 85.5 59 95.5 60 86.0 61 71.5 62 73.5 63 67.0 64 63.0 65 68.0 66 62.5 67 56.5 68 54.0 69 44.5 70 36.5 71 31.0 72 29.0 73 23.0 74 16.0 75 12.0 76 7.0 77 6.5 78 5.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.40108401084011 90.77499999999999 2 1.3550135501355014 2.5 3 0.1897018970189702 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02710027100271003 0.3 >50 0.0 0.0 >100 0.02710027100271003 5.8999999999999995 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATCTCGTATGC 236 5.8999999999999995 TruSeq Adapter, Index 25 (100% over 50bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATCTCGTATGC 12 0.3 TruSeq Adapter, Index 25 (98% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 2.0625 0.0 0.0 0.0 0.0 98-99 2.2875 0.0 0.0 0.0 0.0 100-101 2.5999999999999996 0.0 0.0 0.0 0.0 102-103 3.05 0.0 0.0 0.0 0.0 104-105 3.4875 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.725 0.0 0.0 0.0 0.0 110-111 5.4625 0.0 0.0 0.0 0.0 112-113 6.012499999999999 0.0 0.0 0.0 0.0 114-115 6.75 0.0 0.0 0.0 0.0 116-117 7.475 0.0 0.0 0.0 0.0 118-119 8.0 0.0 0.0 0.0 0.0 120-121 8.5375 0.0 0.0 0.0 0.0 122-123 9.15 0.0 0.0 0.0 0.0 124-125 9.912500000000001 0.0 0.0 0.0 0.0 126-127 10.65 0.0 0.0 0.0 0.0 128-129 11.425 0.0 0.0 0.0 0.0 130-131 12.125 0.0 0.0 0.0 0.0 132-133 13.075 0.0 0.0 0.0 0.0 134-135 13.837499999999999 0.0 0.0 0.0 0.0 136-137 14.5125 0.0 0.0 0.0 0.0 138-139 15.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACA 10 0.0068343505 144.975 7 AAGAGCA 100 2.113953E-6 43.4925 7 TCGGAAG 100 2.113953E-6 43.4925 3 GAGCACA 100 2.113953E-6 43.4925 9 ATCGGAA 100 2.113953E-6 43.4925 2 GAAGAGC 105 2.9582116E-6 41.42143 6 AGAGCAC 105 2.9582116E-6 41.42143 8 GGAAGAG 105 2.9582116E-6 41.42143 5 CGGAAGA 110 4.0743816E-6 39.538635 4 GATCGGA 105 1.3261978E-4 35.40293 1 TGAAAAA 30 4.194637E-5 28.994997 60-64 TGCTTGA 35 1.1980605E-4 24.852858 55-59 CACACTG 60 0.0044970433 24.162498 145 GAAAAAA 40 2.9619987E-4 21.74625 60-64 TCTGCTT 40 2.9619987E-4 21.74625 55-59 GCTTGAA 40 2.9619987E-4 21.74625 55-59 CTGCTTG 40 2.9619987E-4 21.74625 55-59 TTGAAAA 40 2.9619987E-4 21.74625 60-64 CTTGAAA 40 2.9619987E-4 21.74625 60-64 CGTCTTC 40 2.9619987E-4 21.74625 50-54 >>END_MODULE SRR5578513 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578513_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02175 33.0 33.0 34.0 32.0 34.0 2 32.9855 34.0 33.0 34.0 33.0 34.0 3 33.0585 34.0 33.0 34.0 33.0 34.0 4 33.0675 34.0 33.0 34.0 33.0 34.0 5 33.079 34.0 33.0 34.0 33.0 34.0 6 37.18175 38.0 38.0 38.0 37.0 38.0 7 37.21575 38.0 38.0 38.0 37.0 38.0 8 37.2735 38.0 38.0 38.0 37.0 38.0 9 37.2645 38.0 38.0 38.0 37.0 38.0 10-14 37.144 38.0 38.0 38.0 37.0 38.0 15-19 37.13275 38.0 38.0 38.0 37.0 38.0 20-24 37.11815 38.0 38.0 38.0 37.0 38.0 25-29 37.059000000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.99575 38.0 38.0 38.0 36.6 38.0 35-39 36.9738 38.0 38.0 38.0 37.0 38.0 40-44 36.995000000000005 38.0 38.0 38.0 37.0 38.0 45-49 36.814350000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.7456 38.0 38.0 38.0 35.6 38.0 55-59 36.816449999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.88105 38.0 38.0 38.0 36.4 38.0 65-69 36.06285 38.0 38.0 38.0 34.0 38.0 70-74 34.69805 38.0 38.0 38.0 27.8 38.0 75-79 34.657650000000004 38.0 38.0 38.0 28.0 38.0 80-84 34.62325 38.0 38.0 38.0 28.4 38.0 85-89 34.55135 38.0 38.0 38.0 27.8 38.0 90-94 34.45795 38.0 38.0 38.0 26.8 38.0 95-99 34.23755 38.0 38.0 38.0 23.8 38.0 100-104 34.09355 38.0 38.0 38.0 19.4 38.0 105-109 33.9688 38.0 37.2 38.0 19.8 38.0 110-114 33.8249 38.0 36.4 38.0 17.4 38.0 115-119 33.567449999999994 38.0 36.0 38.0 14.4 38.0 120-124 33.3859 38.0 35.4 38.0 14.0 38.0 125-129 33.02825 38.0 35.0 38.0 13.2 38.0 130-134 32.6339 38.0 34.6 38.0 13.0 38.0 135-139 32.168400000000005 38.0 33.2 38.0 8.6 38.0 140-144 31.53985 38.0 32.8 38.0 2.0 38.0 145-149 30.3251 38.0 29.8 38.0 2.0 38.0 150-151 25.660125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 5.0 5 2.0 6 2.0 7 1.0 8 2.0 9 1.0 10 4.0 11 3.0 12 4.0 13 3.0 14 11.0 15 21.0 16 39.0 17 171.0 18 14.0 19 10.0 20 7.0 21 10.0 22 7.0 23 9.0 24 11.0 25 15.0 26 16.0 27 24.0 28 20.0 29 29.0 30 29.0 31 37.0 32 55.0 33 76.0 34 143.0 35 234.0 36 639.0 37 2331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.9 16.6 10.125 27.375 2 28.23911955977989 26.788394197098548 25.03751875937969 19.93496748374187 3 22.26113056528264 22.686343171585793 31.540770385192594 23.51175587793897 4 24.81240620310155 26.88844422211106 18.409204602301152 29.889944972486244 5 33.21660830415208 30.340170085042523 17.208604302151077 19.23461730865433 6 27.650000000000002 30.55 20.0 21.8 7 21.425 22.3 31.874999999999996 24.4 8 23.425 26.75 21.575 28.249999999999996 9 29.125 21.325 23.75 25.8 10-14 27.884759665883056 24.778672535387386 21.697594157955287 25.63897364077427 15-19 27.073536768384194 22.586293146573286 25.087543771885944 25.25262631315658 20-24 28.47423711855928 25.387693846923458 22.55127563781891 23.58679339669835 25-29 27.433716858429214 26.463231615807903 21.68584292146073 24.41720860430215 30-34 27.39869934967484 24.177088544272134 24.12206103051526 24.302151075537772 35-39 25.02876582120166 24.388413627495122 24.248336585121816 26.3344839661814 40-44 30.130065032516256 23.156578289144573 23.156578289144573 23.556778389194598 45-49 26.328164082041024 23.046523261630817 23.28664332166083 27.33866933466733 50-54 26.203101550775386 23.621810905452726 25.32266133066533 24.852426213106554 55-59 24.92246123061531 26.153076538269133 24.772386193096548 24.15207603801901 60-64 24.637318659329665 28.584292146073036 22.301150575287643 24.477238619309656 65-69 25.067533766883443 28.43421710855428 22.131065532766385 24.3671835917959 70-74 25.4990244634549 27.830306668667763 22.70748911901546 23.963179748861872 75-79 25.803062143500448 26.3434404082858 23.281296907835486 24.572200540378265 80-84 26.239679759819868 26.5749311983988 22.97723292469352 24.208156117087814 85-89 26.303151575787894 26.228114057028513 23.096548274137067 24.372186093046526 90-94 26.697013656145263 25.141313591116006 23.170426692011407 24.991246060727327 95-99 26.67333666833417 25.6128064032016 23.321660830415208 24.392196098049023 100-104 26.048024012006003 26.643321660830416 23.121560780390197 24.187093546773387 105-109 26.198099049524764 26.848424212106053 22.92146073036518 24.032016008004 110-114 26.041927252714263 27.087606944513936 23.014959723820482 23.85550607895132 115-119 27.01120672403442 27.036221733039824 22.093255953572143 23.859315589353614 120-124 27.113556778389196 26.428214107053527 22.991495747873934 23.466733366683343 125-129 27.988994497248626 26.193096548274138 22.911455727863935 22.90645322661331 130-134 27.63381690845423 26.58329164582291 22.911455727863935 22.87143571785893 135-139 27.94897448724362 27.308654327163584 22.666333166583293 22.076038019009506 140-144 28.18268220699315 27.157220749337203 22.685208343754688 21.974888699914963 145-149 27.763881940970485 27.148574287143575 22.521260630315158 22.566283141570786 150-151 28.457114278569644 27.11927981995499 23.1807951987997 21.24281070267567 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.5 29 3.5 30 4.0 31 5.0 32 7.0 33 13.0 34 25.5 35 38.5 36 46.0 37 63.5 38 89.0 39 112.5 40 125.0 41 141.5 42 148.0 43 136.5 44 144.5 45 157.0 46 151.5 47 147.0 48 142.5 49 143.0 50 139.0 51 128.0 52 123.5 53 116.0 54 112.5 55 110.0 56 108.0 57 102.5 58 93.0 59 97.0 60 101.5 61 93.5 62 95.0 63 87.0 64 83.5 65 84.5 66 71.5 67 61.0 68 59.0 69 60.5 70 51.5 71 50.5 72 44.0 73 26.5 74 17.5 75 11.5 76 9.0 77 6.5 78 2.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.055 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.055 75-79 0.06999999999999999 80-84 0.075 85-89 0.05 90-94 0.045 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.065 115-119 0.06 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.045 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34643534833289 90.7 2 1.3282732447817838 2.45 3 0.2439685551640011 0.675 4 0.02710761724044456 0.1 5 0.0 0.0 6 0.02710761724044456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02710761724044456 5.925 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 237 5.925 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.5499999999999998 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.0375 0.0 0.0 0.0 0.0 98-99 2.2750000000000004 0.0 0.0 0.0 0.0 100-101 2.55 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.425 0.0 0.0 0.0 0.0 106-107 3.975 0.0 0.0 0.0 0.0 108-109 4.7125 0.0 0.0 0.0 0.0 110-111 5.4375 0.0 0.0 0.0 0.0 112-113 5.95 0.0 0.0 0.0 0.0 114-115 6.6 0.0 0.0 0.0 0.0 116-117 7.4 0.0 0.0 0.0 0.0 118-119 7.949999999999999 0.0 0.0 0.0 0.0 120-121 8.5125 0.0 0.0 0.0 0.0 122-123 9.1125 0.0 0.0 0.0 0.0 124-125 9.8875 0.0 0.0 0.0 0.0 126-127 10.649999999999999 0.0 0.0 0.0 0.0 128-129 11.325 0.0 0.0 0.0 0.0 130-131 12.024999999999999 0.0 0.0 0.0 0.0 132-133 12.9375 0.0 0.0 0.0 0.0 134-135 13.6875 0.0 0.0 0.0 0.0 136-137 14.3875 0.0 0.0 0.0 0.0 138-139 15.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACAA 10 0.006830828 145.0 6 TACCAAC 10 0.006830828 145.0 4 GAGCGTC 100 2.1114429E-6 43.5 9 AAGAGCG 105 2.9547027E-6 41.42857 7 TCGGAAG 105 2.9547027E-6 41.42857 3 ATCGGAA 105 2.9547027E-6 41.42857 2 GATCGGA 110 4.0695504E-6 39.545456 1 AGAGCGT 110 4.0695504E-6 39.545456 8 CGGAAGA 115 5.5244836E-6 37.826088 4 GGAAGAG 115 5.5244836E-6 37.826088 5 GAAGAGC 120 7.400906E-6 36.25 6 GTATCAT 35 1.1966578E-4 24.857143 50-54 ATCATTA 35 1.1966578E-4 24.857143 50-54 TCATTAA 35 1.1966578E-4 24.857143 50-54 TCGCCGT 45 2.4877938E-5 22.555553 45-49 GTAGATC 65 0.0076375785 22.307692 145 TAAAAAA 40 2.9585467E-4 21.75 55-59 CCGTATC 40 2.9585467E-4 21.75 45-49 CATTAAA 40 2.9585467E-4 21.75 50-54 CGTATCA 40 2.9585467E-4 21.75 45-49 >>END_MODULE Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195072 spots for SRR5578513.sra Written 1195072 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra Read 1195060 spots for SRR5578513.sra Written 1195060 spots for SRR5578513.sra SRR ids: ['SRR5578513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2vm3n95r SRR5578513.sra spots: 23901212 blocks: [[1, 1195060], [1195061, 2390120], [2390121, 3585180], [3585181, 4780240], [4780241, 5975300], [5975301, 7170360], [7170361, 8365420], [8365421, 9560480], [9560481, 10755540], [10755541, 11950600], [11950601, 13145660], [13145661, 14340720], [14340721, 15535780], [15535781, 16730840], [16730841, 17925900], [17925901, 19120960], [19120961, 20316020], [20316021, 21511080], [21511081, 22706140], [22706141, 23901212]] SRR5578513 file size 8077636 SRR5578513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578513 SRR5578513_1.fastq SRR5578513_2.fastq Input file: SRR5578513_1.fastq Paired file: SRR5578513_2.fastq trimmed: SRR5578513-trimmed-pair1.fastq, SRR5578513-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:49:35 2024 >> started Mon Dec 9 21:50:05 2024 >> done (30.539s) 23901212 read pairs processed; of these: 47811 ( 0.20%) short read pairs filtered out after trimming by size control 1597888 ( 6.69%) empty read pairs filtered out after trimming by size control 22255513 (93.11%) read pairs available; of these: 12617738 (56.69%) trimmed read pairs available after processing 9637775 (43.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 14 0.00% 20 27 0.00% 21 21 0.00% 22 21 0.00% 23 29 0.00% 24 37 0.00% 25 28 0.00% 26 31 0.00% 27 38 0.00% 28 42 0.00% 29 34 0.00% 30 52 0.00% 31 46 0.00% 32 60 0.00% 33 63 0.00% 34 61 0.00% 35 71 0.00% 36 44 0.00% 37 69 0.00% 38 99 0.00% 39 109 0.00% 40 107 0.00% 41 113 0.00% 42 150 0.00% 43 166 0.00% 44 228 0.00% 45 330 0.00% 46 521 0.00% 47 558 0.00% 48 525 0.00% 49 596 0.00% 50 604 0.00% 51 639 0.00% 52 678 0.00% 53 757 0.00% 54 820 0.00% 55 873 0.00% 56 960 0.00% 57 1039 0.00% 58 1095 0.00% 59 1214 0.01% 60 1418 0.01% 61 1547 0.01% 62 1742 0.01% 63 1901 0.01% 64 2180 0.01% 65 2479 0.01% 66 2846 0.01% 67 3713 0.02% 68 4787 0.02% 69 8360 0.04% 70 10109 0.05% 71 6790 0.03% 72 6260 0.03% 73 6361 0.03% 74 7064 0.03% 75 7741 0.03% 76 8576 0.04% 77 9401 0.04% 78 10472 0.05% 79 11707 0.05% 80 12636 0.06% 81 14276 0.06% 82 16179 0.07% 83 18125 0.08% 84 21145 0.10% 85 23345 0.10% 86 24782 0.11% 87 26348 0.12% 88 27801 0.12% 89 29278 0.13% 90 31778 0.14% 91 34214 0.15% 92 36478 0.16% 93 38848 0.17% 94 41355 0.19% 95 43055 0.19% 96 45241 0.20% 97 47310 0.21% 98 48405 0.22% 99 50424 0.23% 100 53819 0.24% 101 55436 0.25% 102 59325 0.27% 103 62091 0.28% 104 64276 0.29% 105 66457 0.30% 106 68740 0.31% 107 70634 0.32% 108 71725 0.32% 109 73987 0.33% 110 74808 0.34% 111 78129 0.35% 112 81356 0.37% 113 83979 0.38% 114 87667 0.39% 115 91100 0.41% 116 91520 0.41% 117 93391 0.42% 118 93388 0.42% 119 94601 0.43% 120 97411 0.44% 121 98451 0.44% 122 100568 0.45% 123 104619 0.47% 124 107669 0.48% 125 109307 0.49% 126 113017 0.51% 127 113528 0.51% 128 114209 0.51% 129 117213 0.53% 130 117928 0.53% 131 119663 0.54% 132 122578 0.55% 133 126278 0.57% 134 128612 0.58% 135 131548 0.59% 136 134682 0.61% 137 137865 0.62% 138 141763 0.64% 139 147288 0.66% 140 152227 0.68% 141 160411 0.72% 142 171751 0.77% 143 183918 0.83% 144 201749 0.91% 145 229990 1.03% 146 270983 1.22% 147 345970 1.55% 148 497025 2.23% 149 969651 4.36% 150 4773976 21.45% 151 9637775 43.31% 22255513 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=11 prefix-density=1.06 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=13.41 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.6 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=11 prefix-density=0.82 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=20.07 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.9 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATATCAAAGCGG SRR5578513 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:50:59 Started mapping on | Dec 09 21:50:59 Finished on | Dec 09 21:55:55 Mapping speed, Million of reads per hour | 270.68 Number of input reads | 22255513 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 20165414 Uniquely mapped reads % | 90.61% Average mapped length | 285.93 Number of splices: Total | 19571419 Number of splices: Annotated (sjdb) | 18502235 Number of splices: GT/AG | 19320705 Number of splices: GC/AG | 228220 Number of splices: AT/AC | 8942 Number of splices: Non-canonical | 13552 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364850 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 72133 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.76% % of reads unmapped: other | 1.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1746345 1746345 1746345 N_multimapping 364850 364850 364850 N_noFeature 621702 19568806 780032 N_ambiguous 517687 2319 79803 UnstrandedReadsAssigned:19026025 PositiveStrandReadsAssigned:594289 NegativeStrandReadsAssigned:19305579 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR5578513 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578513-trimmed-pair1.fastq SRR5578513-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,255,513 reads, 19,416,346 reads pseudoaligned [quant] estimated average fragment length: 220.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR5578513.ke.tsv 35125 SRR5578513.se.tsv 88098 total ==> SRR5578513.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.654 0 0 PNS24247 1044 824.369 44.2577 3.50986 PNS24249 1928 1708.37 61.7076 2.36146 PNS24246 1044 824.369 44.2577 3.50986 PNS24248 1044 824.369 44.2577 3.50986 PNS24244 1471 1251.37 90.5193 4.7291 PNS24243 293 114.159 1 0.572682 KQK14069 1603 1383.37 2815.74 133.069 KQK14071 474 266.219 90.4053 22.2012 ==> SRR5578513.se.tsv <== BRADI_1g14170v3 3184 BRADI_1g53295v3 39 BRADI_1g59795v3 610 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 3086 BRADI_1g74790v3 88 BRADI_1g09890v3 7 BRADI_1g77505v3 348 BRADI_1g48960v3 0 SRR5578513 completed mapping pipeline successfully