Starting /dee2/code/volunteer_pipeline.sh SRR5578514 current disk space = 1522473459712 free memory = 1568962080 SRR5578514 SRAfilesize b638def35d2d56abcaa37e909ebaab7f SRR5578514.sra SRR5578514.sra file validated SRR5578514 is paired end SRR5578514 is conventional basespace SRR5578514 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69375 34.0 34.0 34.0 33.0 34.0 2 33.44325 34.0 34.0 34.0 33.0 34.0 3 33.4885 34.0 34.0 34.0 33.0 34.0 4 33.555 34.0 34.0 34.0 33.0 34.0 5 33.611 34.0 34.0 34.0 33.0 34.0 6 37.31375 38.0 38.0 38.0 36.0 38.0 7 37.55225 38.0 38.0 38.0 37.0 38.0 8 37.64075 38.0 38.0 38.0 38.0 38.0 9 37.6645 38.0 38.0 38.0 38.0 38.0 10-14 37.67035 38.0 38.0 38.0 38.0 38.0 15-19 37.6639 38.0 38.0 38.0 38.0 38.0 20-24 37.6602 38.0 38.0 38.0 38.0 38.0 25-29 37.6571 38.0 38.0 38.0 38.0 38.0 30-34 37.61285 38.0 38.0 38.0 38.0 38.0 35-39 37.591249999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.50475 38.0 38.0 38.0 37.8 38.0 45-49 37.4785 38.0 38.0 38.0 37.4 38.0 50-54 37.41295 38.0 38.0 38.0 37.0 38.0 55-59 37.3819 38.0 38.0 38.0 37.0 38.0 60-64 37.342200000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.30175 38.0 38.0 38.0 37.0 38.0 70-74 37.1964 38.0 38.0 38.0 36.4 38.0 75-79 37.16459999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.1061 38.0 38.0 38.0 36.0 38.0 85-89 36.961 38.0 38.0 38.0 35.6 38.0 90-94 36.9222 38.0 38.0 38.0 35.2 38.0 95-99 36.82445 38.0 38.0 38.0 35.2 38.0 100-104 36.677499999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.45275 38.0 38.0 38.0 34.0 38.0 110-114 36.2798 38.0 38.0 38.0 33.8 38.0 115-119 36.1784 38.0 37.8 38.0 33.4 38.0 120-124 36.058949999999996 38.0 37.4 38.0 33.2 38.0 125-129 35.778499999999994 38.0 36.6 38.0 32.6 38.0 130-134 35.52815 38.0 36.0 38.0 31.2 38.0 135-139 35.15685 38.0 35.8 38.0 29.6 38.0 140-144 34.65285 38.0 35.0 38.0 28.0 38.0 145-149 33.9528 38.0 35.0 38.0 24.2 38.0 150-151 30.274749999999997 36.0 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 2.0 15 2.0 16 0.0 17 3.0 18 2.0 19 3.0 20 4.0 21 7.0 22 3.0 23 2.0 24 5.0 25 5.0 26 23.0 27 18.0 28 25.0 29 18.0 30 22.0 31 38.0 32 61.0 33 68.0 34 106.0 35 211.0 36 662.0 37 2708.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.15851775604735 11.091096242923316 7.771487390633042 36.97889861039629 2 23.95 13.950000000000001 33.4 28.7 3 22.0360180090045 18.48424212106053 24.83741870935468 34.642321160580295 4 27.275 26.85 20.549999999999997 25.324999999999996 5 26.150000000000002 31.175000000000004 22.525000000000002 20.150000000000002 6 23.674999999999997 32.4 22.85 21.075 7 17.675 23.200000000000003 40.2 18.925 8 19.8 23.25 29.4 27.55 9 20.599999999999998 21.575 32.775 25.05 10-14 23.50735073507351 26.137613761376137 26.062606260626065 24.292429242924293 15-19 23.369999999999997 25.82 25.569999999999997 25.240000000000002 20-24 23.14 25.505 25.83 25.525 25-29 23.0 25.619999999999997 26.540000000000003 24.84 30-34 23.145 25.35 25.935000000000002 25.569999999999997 35-39 23.415 25.624999999999996 25.28 25.679999999999996 40-44 23.365 25.259999999999998 25.8 25.575 45-49 23.175 25.314999999999998 25.75 25.759999999999998 50-54 23.32 25.7 25.41 25.569999999999997 55-59 22.52 25.759999999999998 25.765 25.955000000000002 60-64 23.13 25.53 25.46 25.88 65-69 23.595 25.324999999999996 25.335 25.745 70-74 23.205000000000002 25.629999999999995 25.490000000000002 25.674999999999997 75-79 23.765 24.795 25.974999999999998 25.465 80-84 23.880000000000003 25.415 25.490000000000002 25.215 85-89 23.605 25.455 25.290000000000003 25.650000000000002 90-94 23.235 26.195 24.52 26.05 95-99 23.735 25.34 25.629999999999995 25.295 100-104 23.715 25.385 25.7 25.2 105-109 24.315 25.03 25.25 25.405 110-114 23.915 25.145 25.430000000000003 25.509999999999998 115-119 23.525 25.97 24.95 25.555 120-124 24.0 26.174999999999997 24.779999999999998 25.045 125-129 23.93 25.569999999999997 25.055 25.445 130-134 24.07 25.874999999999996 24.349999999999998 25.705 135-139 23.380000000000003 26.015 24.745 25.86 140-144 23.7 26.009999999999998 24.279999999999998 26.009999999999998 145-149 23.549999999999997 25.91 24.68 25.86 150-151 23.200000000000003 25.724999999999998 24.875 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 4.0 28 5.0 29 2.5 30 3.5 31 14.0 32 19.5 33 23.0 34 34.5 35 41.0 36 55.0 37 84.0 38 100.5 39 117.0 40 133.5 41 156.0 42 182.5 43 186.5 44 193.0 45 194.0 46 184.0 47 172.5 48 169.0 49 161.0 50 143.5 51 134.5 52 136.0 53 128.0 54 103.5 55 91.5 56 85.0 57 89.0 58 94.0 59 81.0 60 77.5 61 74.0 62 63.5 63 61.5 64 60.0 65 57.0 66 50.5 67 42.5 68 41.0 69 34.5 70 23.5 71 19.5 72 23.5 73 19.5 74 9.5 75 6.5 76 3.5 77 3.0 78 2.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8329126703685007 1.6500000000000001 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.325 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.862500000000001 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 8.1875 0.0 0.0 0.0 0.0 130-131 8.8125 0.0 0.0 0.0 0.0 132-133 9.649999999999999 0.0 0.0 0.0 0.0 134-135 10.325 0.0 0.0 0.0 0.0 136-137 11.1 0.0 0.0 0.0 0.0 138-139 11.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATT 10 0.0068343505 144.975 6 GAACTCC 45 0.008963385 48.325 145 >>END_MODULE SRR5578514 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578514_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95175 33.0 33.0 34.0 32.0 34.0 2 33.13625 34.0 33.0 34.0 33.0 34.0 3 33.1495 34.0 33.0 34.0 33.0 34.0 4 33.06925 34.0 33.0 34.0 33.0 34.0 5 33.1305 34.0 33.0 34.0 33.0 34.0 6 37.32 38.0 38.0 38.0 38.0 38.0 7 37.19575 38.0 38.0 38.0 37.0 38.0 8 37.21325 38.0 38.0 38.0 37.0 38.0 9 37.2665 38.0 38.0 38.0 37.0 38.0 10-14 37.292699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.2755 38.0 38.0 38.0 37.6 38.0 20-24 37.2315 38.0 38.0 38.0 37.0 38.0 25-29 37.227 38.0 38.0 38.0 37.0 38.0 30-34 37.213699999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.212599999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.23960000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.231849999999994 38.0 38.0 38.0 37.2 38.0 50-54 37.194050000000004 38.0 38.0 38.0 37.4 38.0 55-59 37.0894 38.0 38.0 38.0 37.0 38.0 60-64 37.0552 38.0 38.0 38.0 37.0 38.0 65-69 37.01495 38.0 38.0 38.0 37.0 38.0 70-74 36.889300000000006 38.0 38.0 38.0 36.2 38.0 75-79 36.83175 38.0 38.0 38.0 36.0 38.0 80-84 36.825900000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.711949999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.632600000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.507999999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.39545 38.0 38.0 38.0 34.4 38.0 105-109 36.230149999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.07860000000001 38.0 38.0 38.0 33.8 38.0 115-119 35.87895 38.0 37.8 38.0 33.4 38.0 120-124 35.763799999999996 38.0 38.0 38.0 33.0 38.0 125-129 35.40285 38.0 36.4 38.0 31.0 38.0 130-134 34.935500000000005 38.0 36.0 38.0 29.4 38.0 135-139 34.51405 38.0 35.2 38.0 27.2 38.0 140-144 33.727549999999994 38.0 33.0 38.0 22.4 38.0 145-149 32.7179 38.0 33.0 38.0 12.8 38.0 150-151 27.381124999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 0.0 5 3.0 6 1.0 7 2.0 8 1.0 9 0.0 10 1.0 11 2.0 12 5.0 13 4.0 14 3.0 15 1.0 16 3.0 17 7.0 18 4.0 19 7.0 20 7.0 21 8.0 22 6.0 23 11.0 24 16.0 25 10.0 26 18.0 27 12.0 28 21.0 29 29.0 30 39.0 31 43.0 32 64.0 33 78.0 34 125.0 35 234.0 36 579.0 37 2645.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.675000000000004 18.35 10.725 29.25 2 28.299999999999997 23.75 28.125 19.825 3 22.6 24.575 27.650000000000002 25.174999999999997 4 27.175 31.624999999999996 19.85 21.349999999999998 5 27.0 34.525 19.025 19.45 6 23.724999999999998 35.025 20.95 20.3 7 22.45 18.7 35.125 23.724999999999998 8 22.85 22.650000000000002 23.974999999999998 30.525000000000002 9 23.425 22.875 27.6 26.1 10-14 26.055 25.35 23.1 25.495 15-19 25.76144036009002 25.34133533383346 24.001000250062514 24.896224056014006 20-24 25.472641792537758 25.862758827648296 24.462338701610484 24.202260678203462 25-29 25.96928310570814 25.469007954374906 24.108259542748513 24.45344939716844 30-34 25.970776621297038 25.230184147317853 24.789831865492392 24.009207365892713 35-39 25.380228136882128 25.320192115269162 24.704822893736242 24.594756854112468 40-44 25.80419230576817 25.328930912001603 24.308369603281804 24.55850717894842 45-49 25.841797168159303 24.721068694651525 24.721068694651525 24.716065442537648 50-54 25.39769884942471 25.027513756878438 24.832416208104053 24.742371185592795 55-59 26.41745483661112 24.48581294099985 24.69098733923835 24.40574488315068 60-64 25.63922942206655 25.01376032024018 24.658493870402804 24.68851638729047 65-69 26.309994494770034 24.993744056854013 24.533306641309245 24.162954807066715 70-74 25.57930033531855 25.09383914718983 25.003753565887592 24.323106951604025 75-79 25.87570056044836 24.914931945556447 24.92994395516413 24.279423538831065 80-84 25.61433361693609 25.168910464941696 24.998748811370803 24.21800710675141 85-89 25.764017406092133 25.023758315410394 24.653628770069524 24.55859550842795 90-94 25.455182072829132 25.390156062424968 25.03001200480192 24.12464985994398 95-99 26.06824777344141 25.537876513559493 24.3670569398579 24.026818773141198 100-104 26.30973229922442 25.31898924193145 24.90868151113335 23.462596947710786 105-109 26.40876789110199 25.97838054248824 24.767290561505355 22.845561004904415 110-114 26.196196196196198 26.036036036036037 24.24924924924925 23.51851851851852 115-119 26.140061070230765 25.759623567102167 24.468138359112977 23.632177003554087 120-124 26.615607949141513 25.569404815537865 24.603293787856035 23.211693447464583 125-129 26.325274065174952 26.315262551934726 24.493167142213544 22.86629624067678 130-134 26.50783322488613 26.74308023424596 24.095300065068322 22.65378647579959 135-139 27.147645969880426 26.53224595987392 24.3208085255416 21.99929954470406 140-144 27.32549412059044 26.184638478859146 24.0180135101326 22.471853890417815 145-149 28.144701290903633 26.228359851896325 24.31201841288902 21.314920444311017 150-151 28.49818682005752 26.384894335375762 23.783918969613605 21.332999874953106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.5 27 3.0 28 5.0 29 7.5 30 9.0 31 10.0 32 16.5 33 21.5 34 23.5 35 30.5 36 44.0 37 66.5 38 87.5 39 98.0 40 119.0 41 148.5 42 163.0 43 157.5 44 172.5 45 182.0 46 169.0 47 169.0 48 173.0 49 169.5 50 149.5 51 142.5 52 121.0 53 101.5 54 98.0 55 101.0 56 97.0 57 83.0 58 85.5 59 94.0 60 96.0 61 81.5 62 80.0 63 86.0 64 82.0 65 69.5 66 64.0 67 57.5 68 49.0 69 50.0 70 41.5 71 33.0 72 27.0 73 18.0 74 13.0 75 7.5 76 6.5 77 6.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.03 25-29 0.055 30-34 0.08 35-39 0.06 40-44 0.055 45-49 0.065 50-54 0.05 55-59 0.08499999999999999 60-64 0.075 65-69 0.095 70-74 0.095 75-79 0.08 80-84 0.095 85-89 0.034999999999999996 90-94 0.04 95-99 0.06999999999999999 100-104 0.075 105-109 0.09 110-114 0.1 115-119 0.11499999999999999 120-124 0.11499999999999999 125-129 0.11499999999999999 130-134 0.105 135-139 0.065 140-144 0.075 145-149 0.06999999999999999 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80710659898477 97.32499999999999 2 1.015228426395939 2.0 3 0.07614213197969542 0.22499999999999998 4 0.050761421319796954 0.2 5 0.050761421319796954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.2125 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.8375000000000004 0.0 0.0 0.0 0.0 116-117 4.262499999999999 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.199999999999999 0.0 0.0 0.0 0.0 122-123 5.800000000000001 0.0 0.0 0.0 0.0 124-125 6.45 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.9875 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.4125 0.0 0.0 0.0 0.0 134-135 10.075 0.0 0.0 0.0 0.0 136-137 10.837499999999999 0.0 0.0 0.0 0.0 138-139 11.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAG 40 0.005621335 54.375 145 >>END_MODULE Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812450 spots for SRR5578514.sra Written 812450 spots for SRR5578514.sra Read 812461 spots for SRR5578514.sra Written 812461 spots for SRR5578514.sra SRR ids: ['SRR5578514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9dlfbsyy SRR5578514.sra spots: 16249011 blocks: [[1, 812450], [812451, 1624900], [1624901, 2437350], [2437351, 3249800], [3249801, 4062250], [4062251, 4874700], [4874701, 5687150], [5687151, 6499600], [6499601, 7312050], [7312051, 8124500], [8124501, 8936950], [8936951, 9749400], [9749401, 10561850], [10561851, 11374300], [11374301, 12186750], [12186751, 12999200], [12999201, 13811650], [13811651, 14624100], [14624101, 15436550], [15436551, 16249011]] SRR5578514 file size 5484556 SRR5578514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578514 SRR5578514_1.fastq SRR5578514_2.fastq Input file: SRR5578514_1.fastq Paired file: SRR5578514_2.fastq trimmed: SRR5578514-trimmed-pair1.fastq, SRR5578514-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:53:08 2024 >> started Mon Dec 9 21:53:25 2024 >> done (16.831s) 16249011 read pairs processed; of these: 21953 ( 0.14%) short read pairs filtered out after trimming by size control 35468 ( 0.22%) empty read pairs filtered out after trimming by size control 16191590 (99.65%) read pairs available; of these: 8463311 (52.27%) trimmed read pairs available after processing 7728279 (47.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 23 0.00% 20 14 0.00% 21 19 0.00% 22 22 0.00% 23 9 0.00% 24 25 0.00% 25 19 0.00% 26 9 0.00% 27 12 0.00% 28 19 0.00% 29 24 0.00% 30 24 0.00% 31 19 0.00% 32 26 0.00% 33 29 0.00% 34 29 0.00% 35 24 0.00% 36 35 0.00% 37 41 0.00% 38 48 0.00% 39 41 0.00% 40 44 0.00% 41 48 0.00% 42 58 0.00% 43 58 0.00% 44 67 0.00% 45 79 0.00% 46 69 0.00% 47 101 0.00% 48 118 0.00% 49 126 0.00% 50 146 0.00% 51 148 0.00% 52 158 0.00% 53 219 0.00% 54 196 0.00% 55 245 0.00% 56 251 0.00% 57 298 0.00% 58 326 0.00% 59 411 0.00% 60 470 0.00% 61 561 0.00% 62 593 0.00% 63 692 0.00% 64 797 0.00% 65 900 0.01% 66 992 0.01% 67 1235 0.01% 68 1377 0.01% 69 1603 0.01% 70 1904 0.01% 71 1927 0.01% 72 2068 0.01% 73 2426 0.01% 74 2798 0.02% 75 3102 0.02% 76 3577 0.02% 77 3753 0.02% 78 4418 0.03% 79 4971 0.03% 80 5409 0.03% 81 6098 0.04% 82 7050 0.04% 83 8069 0.05% 84 9573 0.06% 85 10396 0.06% 86 11212 0.07% 87 12193 0.08% 88 12914 0.08% 89 13477 0.08% 90 14071 0.09% 91 15381 0.09% 92 16527 0.10% 93 17518 0.11% 94 19034 0.12% 95 20049 0.12% 96 21212 0.13% 97 22322 0.14% 98 22999 0.14% 99 24184 0.15% 100 25646 0.16% 101 26885 0.17% 102 28687 0.18% 103 30433 0.19% 104 31327 0.19% 105 32357 0.20% 106 34080 0.21% 107 35050 0.22% 108 36302 0.22% 109 37259 0.23% 110 38728 0.24% 111 40417 0.25% 112 42331 0.26% 113 43789 0.27% 114 45994 0.28% 115 47571 0.29% 116 48503 0.30% 117 49836 0.31% 118 50936 0.31% 119 51790 0.32% 120 53533 0.33% 121 55492 0.34% 122 56904 0.35% 123 59283 0.37% 124 61637 0.38% 125 62681 0.39% 126 64890 0.40% 127 65697 0.41% 128 66658 0.41% 129 68355 0.42% 130 69473 0.43% 131 71247 0.44% 132 74474 0.46% 133 76901 0.47% 134 78424 0.48% 135 82046 0.51% 136 84836 0.52% 137 86763 0.54% 138 89909 0.56% 139 94182 0.58% 140 98527 0.61% 141 104657 0.65% 142 113405 0.70% 143 122304 0.76% 144 137343 0.85% 145 158473 0.98% 146 191148 1.18% 147 248153 1.53% 148 363133 2.24% 149 714128 4.41% 150 3677197 22.71% 151 7728279 47.73% 16191590 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=10 prefix-density=0.85 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=28.18 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=4.2 sequence=ACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=79.92 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578514 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:54:10 Started mapping on | Dec 09 21:54:10 Finished on | Dec 09 21:56:58 Mapping speed, Million of reads per hour | 346.96 Number of input reads | 16191590 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14846807 Uniquely mapped reads % | 91.69% Average mapped length | 289.99 Number of splices: Total | 15952061 Number of splices: Annotated (sjdb) | 15053036 Number of splices: GT/AG | 15738053 Number of splices: GC/AG | 194502 Number of splices: AT/AC | 8317 Number of splices: Non-canonical | 11189 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260692 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 39823 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.18% % of reads unmapped: other | 1.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1097455 1097455 1097455 N_multimapping 260692 260692 260692 N_noFeature 644458 14409977 788448 N_ambiguous 344951 2115 52324 UnstrandedReadsAssigned:13857398 PositiveStrandReadsAssigned:434715 NegativeStrandReadsAssigned:14006035 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578514 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578514-trimmed-pair1.fastq SRR5578514-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,191,590 reads, 14,134,516 reads pseudoaligned [quant] estimated average fragment length: 240.452 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR5578514.ke.tsv 35125 SRR5578514.se.tsv 88098 total ==> SRR5578514.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.103 0 0 PNS24247 1044 804.548 35.3298 4.48378 PNS24249 1928 1688.55 61.1811 3.69964 PNS24246 1044 804.548 35.3298 4.48378 PNS24248 1044 804.548 35.3298 4.48378 PNS24244 1471 1231.55 64.8295 5.37498 PNS24243 293 107.092 0 0 KQK14069 1603 1363.55 1101.11 82.455 KQK14071 474 253.216 29.4626 11.8805 ==> SRR5578514.se.tsv <== BRADI_1g14170v3 1229 BRADI_1g53295v3 69 BRADI_1g59795v3 374 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2142 BRADI_1g74790v3 140 BRADI_1g09890v3 1 BRADI_1g77505v3 202 BRADI_1g48960v3 0 SRR5578514 completed mapping pipeline successfully