Starting /dee2/code/volunteer_pipeline.sh SRR5579201 current disk space = 1522496200704 free memory = 1597336076 SRR5579201 SRAfilesize ffd366aeca8cda55c2fcef2a7a3a7303 SRR5579201.sra SRR5579201.sra file validated SRR5579201 is paired end SRR5579201 is conventional basespace SRR5579201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02125 34.0 33.0 34.0 32.0 34.0 2 33.22725 34.0 33.0 34.0 32.0 34.0 3 33.34575 34.0 33.0 34.0 32.0 34.0 4 33.463 34.0 34.0 34.0 33.0 34.0 5 33.484 34.0 34.0 34.0 33.0 34.0 6 37.32475 38.0 38.0 38.0 37.0 38.0 7 37.413 38.0 38.0 38.0 37.0 38.0 8 37.542 38.0 38.0 38.0 38.0 38.0 9 37.56875 38.0 38.0 38.0 38.0 38.0 10-14 37.60385 38.0 38.0 38.0 38.0 38.0 15-19 37.597750000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.5714 38.0 38.0 38.0 38.0 38.0 25-29 37.461349999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.4503 38.0 38.0 38.0 37.8 38.0 35-39 37.21195 38.0 38.0 38.0 37.0 38.0 40-44 37.156150000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.189299999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.37095 38.0 38.0 38.0 37.0 38.0 55-59 37.2198 38.0 38.0 38.0 37.0 38.0 60-64 37.26 38.0 38.0 38.0 37.0 38.0 65-69 37.087599999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.130399999999995 38.0 38.0 38.0 36.4 38.0 75-79 36.96125 38.0 38.0 38.0 35.6 38.0 80-84 36.870850000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.92015 38.0 38.0 38.0 35.8 38.0 90-94 36.73735 38.0 38.0 38.0 35.0 38.0 95-99 36.6494 38.0 38.0 38.0 35.0 38.0 100-104 36.29475 38.0 38.0 38.0 33.8 38.0 105-109 36.4467 38.0 38.0 38.0 34.0 38.0 110-114 35.9406 38.0 37.4 38.0 32.2 38.0 115-119 35.82899999999999 38.0 37.2 38.0 32.0 38.0 120-124 35.83645 38.0 37.0 38.0 32.0 38.0 125-129 35.62155 38.0 36.6 38.0 31.0 38.0 130-134 35.291 38.0 36.0 38.0 29.8 38.0 135-139 34.89325 38.0 35.8 38.0 29.0 38.0 140-144 34.3973 38.0 34.6 38.0 26.8 38.0 145-149 33.47035 38.0 33.0 38.0 21.6 38.0 150-151 28.051875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 3.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 1.0 17 3.0 18 1.0 19 4.0 20 4.0 21 3.0 22 6.0 23 16.0 24 6.0 25 12.0 26 11.0 27 17.0 28 33.0 29 36.0 30 36.0 31 60.0 32 76.0 33 92.0 34 131.0 35 231.0 36 613.0 37 2599.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.13366466126079 12.869474234894064 9.469003400470836 34.527857703374316 2 23.525 18.85 36.3 21.325 3 22.625 24.875 23.25 29.25 4 26.275 30.875000000000004 20.599999999999998 22.25 5 25.650000000000002 34.150000000000006 21.825 18.375 6 20.625 33.300000000000004 23.225 22.85 7 17.025000000000002 20.125 41.225 21.625 8 20.349999999999998 19.7 27.950000000000003 32.0 9 21.6 19.025 30.2 29.175 10-14 23.064999999999998 26.47 25.035 25.430000000000003 15-19 23.26 25.56 25.424999999999997 25.755 20-24 22.30280598209373 25.87905767018456 26.05411894162957 25.764017406092133 25-29 23.645 25.855 25.224999999999998 25.275 30-34 23.612083625087525 25.677703310993298 25.152545763729115 25.557667300190058 35-39 24.052405240524052 25.24252425242524 24.937493749374937 25.76757675767577 40-44 22.896448224112056 25.767883941970986 25.51775887943972 25.817908954477236 45-49 23.78665065545882 25.622936055238664 24.602221555088562 25.98819173421395 50-54 23.606245621058953 26.32869582624362 24.376939245320788 25.68811930737664 55-59 23.39637746422496 25.702992094466126 24.85740018012609 26.043230261182828 60-64 23.423738991192955 25.02502001601281 25.425340272217774 26.12590072057646 65-69 23.53117806025423 24.99249324391953 25.783204884395953 25.693123811430286 70-74 24.794835868694957 24.734787830264214 24.569655724579665 25.90072057646117 75-79 23.612083625087525 25.347604281284386 24.777433229968988 26.2628788636591 80-84 24.00980196039208 24.70494098819764 25.1000200040008 26.185237047409483 85-89 24.40232069620886 24.672401720516156 25.322596779033713 25.602680804241274 90-94 23.85454181672669 25.280112044817926 25.01500600240096 25.850340136054424 95-99 24.145352620251266 24.836077881775864 25.04129335802593 25.97727613994694 100-104 24.56719703792655 25.2626838787151 25.25267687381167 24.917442209546685 105-109 24.224999999999998 24.895 24.75 26.13 110-114 24.192012827579294 24.863456431327354 24.798316380217468 26.146214360875884 115-119 25.047504750475046 25.052505250525055 24.5024502450245 25.397539753975394 120-124 24.67 25.09 24.365000000000002 25.874999999999996 125-129 24.185000000000002 25.215 24.085 26.515 130-134 24.884999999999998 25.330000000000002 23.98 25.805 135-139 24.265 25.36 24.135 26.240000000000002 140-144 24.84 24.98 24.404999999999998 25.775 145-149 24.705 25.25 24.12 25.924999999999997 150-151 25.4375 24.637500000000003 23.35 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 0.5 26 0.5 27 0.5 28 2.0 29 6.5 30 9.0 31 9.5 32 14.5 33 21.5 34 33.0 35 45.5 36 52.5 37 71.5 38 90.0 39 102.5 40 123.0 41 152.0 42 166.0 43 170.5 44 182.0 45 188.5 46 186.0 47 180.5 48 175.5 49 176.5 50 165.5 51 145.5 52 132.5 53 121.0 54 111.0 55 97.5 56 88.0 57 83.5 58 77.5 59 85.0 60 91.0 61 83.0 62 73.0 63 62.5 64 68.5 65 65.5 66 47.5 67 37.5 68 40.0 69 40.0 70 29.0 71 23.0 72 20.0 73 15.0 74 13.5 75 9.5 76 5.5 77 3.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.034999999999999996 25-29 0.0 30-34 0.03 35-39 0.01 40-44 0.05 45-49 0.06999999999999999 50-54 0.09 55-59 0.06999999999999999 60-64 0.08 65-69 0.09 70-74 0.08 75-79 0.03 80-84 0.02 85-89 0.03 90-94 0.04 95-99 0.105 100-104 0.06999999999999999 105-109 0.0 110-114 0.215 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04016165698408 98.02499999999999 2 0.9093205354887599 1.7999999999999998 3 0.025258903763576663 0.075 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.6875 0.0 0.0 0.0 0.0 120-121 5.075 0.0 0.0 0.0 0.0 122-123 5.75 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.0625 0.0 0.0 0.0 0.0 132-133 8.475000000000001 0.0 0.0 0.0 0.0 134-135 9.087499999999999 0.0 0.0 0.0 0.0 136-137 9.587499999999999 0.0 0.0 0.0 0.0 138-139 10.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82025 33.0 33.0 34.0 32.0 34.0 2 32.815 34.0 33.0 34.0 32.0 34.0 3 32.91675 34.0 33.0 34.0 32.0 34.0 4 32.91625 34.0 33.0 34.0 32.0 34.0 5 32.93075 34.0 33.0 34.0 32.0 34.0 6 37.02375 38.0 38.0 38.0 37.0 38.0 7 37.1855 38.0 38.0 38.0 37.0 38.0 8 37.189 38.0 38.0 38.0 37.0 38.0 9 36.96725 38.0 38.0 38.0 37.0 38.0 10-14 37.02760000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.058550000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.1046 38.0 38.0 38.0 37.0 38.0 25-29 37.01255 38.0 38.0 38.0 37.0 38.0 30-34 37.055 38.0 38.0 38.0 37.0 38.0 35-39 37.175599999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.1673 38.0 38.0 38.0 37.0 38.0 45-49 37.07865 38.0 38.0 38.0 37.0 38.0 50-54 37.070100000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.94265 38.0 38.0 38.0 36.2 38.0 60-64 36.9452 38.0 38.0 38.0 36.4 38.0 65-69 36.7581 38.0 38.0 38.0 35.8 38.0 70-74 36.463499999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.438399999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.44545 38.0 38.0 38.0 34.4 38.0 85-89 36.4127 38.0 38.0 38.0 34.2 38.0 90-94 36.50635 38.0 38.0 38.0 34.8 38.0 95-99 36.33819999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.074 38.0 38.0 38.0 33.6 38.0 105-109 35.9489 38.0 38.0 38.0 33.0 38.0 110-114 35.68285 38.0 37.6 38.0 31.6 38.0 115-119 35.45075 38.0 36.8 38.0 31.4 38.0 120-124 34.78775 38.0 36.0 38.0 26.8 38.0 125-129 34.5167 38.0 35.8 38.0 25.8 38.0 130-134 34.2302 38.0 35.0 38.0 24.6 38.0 135-139 33.74775 38.0 34.2 38.0 21.4 38.0 140-144 33.38225 38.0 34.0 38.0 18.6 38.0 145-149 31.9341 38.0 33.0 38.0 8.0 38.0 150-151 26.002125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 0.0 5 0.0 6 0.0 7 4.0 8 2.0 9 1.0 10 0.0 11 3.0 12 3.0 13 3.0 14 2.0 15 7.0 16 4.0 17 4.0 18 8.0 19 6.0 20 12.0 21 8.0 22 14.0 23 19.0 24 17.0 25 20.0 26 12.0 27 32.0 28 39.0 29 52.0 30 42.0 31 61.0 32 73.0 33 100.0 34 159.0 35 227.0 36 634.0 37 2421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.27295534370296 14.701455092824887 12.920220772704466 30.105368790767688 2 27.621675865529355 21.45007526342198 29.227295534370295 21.700953336678374 3 23.34923424554356 24.303288978157166 26.412252071303037 25.935224704996234 4 28.582183186951067 30.338770388958597 18.444165621079048 22.634880803011292 5 26.6432513798294 33.492222779729055 19.568489713998996 20.296036126442548 6 22.099447513812155 34.806629834254146 19.412355600200904 23.681567051732795 7 19.719368579303435 15.184164369832123 40.190428464044096 24.906038586820344 8 23.12703583061889 19.6191430719118 25.35705337008269 31.89676772738662 9 25.376506024096386 20.33132530120482 25.426706827309236 28.865461847389557 10-14 25.81825472407398 25.256879354418327 23.071525236830233 25.853340684677462 15-19 25.704701346818204 24.062484353877736 24.563160266359585 25.66965403294448 20-24 26.045789289113774 24.713190721907722 23.545914533340014 25.695105455638494 25-29 25.961153384060875 24.57949539447337 23.6984381257509 25.76091309571486 30-34 25.904971711810944 24.743403594853053 23.671957142141892 25.679667551194115 35-39 25.997696660157228 25.296680186270095 23.454008312052476 25.251614841520205 40-44 26.347425365658182 24.799639350831495 23.502304147465438 25.350631136044882 45-49 26.162324649298597 25.23046092184369 23.79759519038076 24.809619238476955 50-54 26.00811501277363 24.550418273806542 24.340029053749436 25.10143765967039 55-59 26.050378086033348 24.62817366918724 24.227552706695377 25.093895538084034 60-64 25.759094097604972 25.04759995991582 24.170758593045395 25.02254734943381 65-69 26.161712366534662 24.43230237104617 24.33204671913379 25.07393854328538 70-74 26.19238476953908 24.46392785571142 24.554108216432866 24.789579158316634 75-79 26.243799789568616 24.184578385690667 24.560348714865473 25.011273109875244 80-84 26.154693918445044 25.30808536218816 23.57980162308386 24.957419096282937 85-89 26.22162080890092 25.043853054678493 23.891144188843782 24.843381947576805 90-94 26.252003205128204 25.170272435897434 24.353966346153847 24.22375801282051 95-99 26.998997995991985 24.584168336673347 24.4438877755511 23.972945891783567 100-104 26.166166166166168 24.904904904904903 24.354354354354353 24.574574574574577 105-109 26.3626808148556 24.85609890384904 24.26047349717203 24.52074678412333 110-114 26.520693456258144 24.787052810902896 24.451347830443932 24.24090590239503 115-119 26.834885350956245 24.702112746570542 24.466806848903573 23.99619505356964 120-124 26.893237899794787 25.64192402022123 23.739926923269433 23.72491115671455 125-129 27.07456404088996 25.120264582080576 24.589096011224694 23.21607536580477 130-134 27.42121348764968 24.961170399318604 24.28979407785961 23.3278220351721 135-139 27.50826901874311 25.142828505562793 24.14553472987872 23.203367745815378 140-144 27.55751591398927 25.021302190366395 24.600270663124654 22.820911232519673 145-149 27.624724504107395 25.58104588258866 23.97315167301142 22.82107794029253 150-151 29.18702242264813 25.26619065514218 23.449830890642616 22.096956031567082 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.0 28 0.0 29 2.0 30 7.5 31 8.5 32 6.0 33 10.5 34 20.5 35 26.0 36 30.0 37 43.0 38 60.0 39 87.5 40 109.0 41 122.5 42 138.5 43 146.0 44 170.0 45 192.0 46 186.0 47 174.0 48 180.0 49 179.5 50 164.5 51 149.0 52 121.0 53 106.5 54 107.5 55 98.5 56 89.5 57 93.0 58 98.5 59 99.5 60 99.5 61 98.0 62 102.5 63 95.5 64 75.0 65 75.5 66 77.5 67 65.5 68 52.5 69 47.5 70 44.0 71 34.5 72 27.5 73 23.5 74 18.0 75 10.0 76 5.0 77 5.0 78 3.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.35000000000000003 3 0.42500000000000004 4 0.375 5 0.35000000000000003 6 0.44999999999999996 7 0.22499999999999998 8 0.22499999999999998 9 0.4 10-14 0.245 15-19 0.135 20-24 0.19499999999999998 25-29 0.12 30-34 0.135 35-39 0.145 40-44 0.18 45-49 0.2 50-54 0.185 55-59 0.155 60-64 0.21 65-69 0.255 70-74 0.2 75-79 0.20500000000000002 80-84 0.19 85-89 0.23500000000000001 90-94 0.16 95-99 0.2 100-104 0.1 105-109 0.105 110-114 0.21 115-119 0.13 120-124 0.105 125-129 0.22 130-134 0.20500000000000002 135-139 0.22999999999999998 140-144 0.245 145-149 0.18 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7577671129072998 1.5 3 0.10103561505430665 0.3 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.9625 0.0 0.0 0.0 0.0 116-117 4.324999999999999 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.05 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.3625 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.45 0.0 0.0 0.0 0.0 130-131 8.037500000000001 0.0 0.0 0.0 0.0 132-133 8.475000000000001 0.0 0.0 0.0 0.0 134-135 9.05 0.0 0.0 0.0 0.0 136-137 9.5125 0.0 0.0 0.0 0.0 138-139 10.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACATCT 10 0.006830828 145.0 145 >>END_MODULE Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944205 spots for SRR5579201.sra Written 944205 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra Read 944191 spots for SRR5579201.sra Written 944191 spots for SRR5579201.sra SRR ids: ['SRR5579201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n9uhxx7x SRR5579201.sra spots: 18883834 blocks: [[1, 944191], [944192, 1888382], [1888383, 2832573], [2832574, 3776764], [3776765, 4720955], [4720956, 5665146], [5665147, 6609337], [6609338, 7553528], [7553529, 8497719], [8497720, 9441910], [9441911, 10386101], [10386102, 11330292], [11330293, 12274483], [12274484, 13218674], [13218675, 14162865], [14162866, 15107056], [15107057, 16051247], [16051248, 16995438], [16995439, 17939629], [17939630, 18883834]] SRR5579201 file size 6377411 SRR5579201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579201 SRR5579201_1.fastq SRR5579201_2.fastq Input file: SRR5579201_1.fastq Paired file: SRR5579201_2.fastq trimmed: SRR5579201-trimmed-pair1.fastq, SRR5579201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 21:58:27 2024 >> started Mon Dec 9 21:58:49 2024 >> done (21.562s) 18883834 read pairs processed; of these: 20440 ( 0.11%) short read pairs filtered out after trimming by size control 81566 ( 0.43%) empty read pairs filtered out after trimming by size control 18781828 (99.46%) read pairs available; of these: 10730572 (57.13%) trimmed read pairs available after processing 8051256 (42.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 8 0.00% 21 15 0.00% 22 13 0.00% 23 18 0.00% 24 16 0.00% 25 25 0.00% 26 15 0.00% 27 26 0.00% 28 17 0.00% 29 19 0.00% 30 35 0.00% 31 34 0.00% 32 34 0.00% 33 21 0.00% 34 23 0.00% 35 34 0.00% 36 46 0.00% 37 45 0.00% 38 51 0.00% 39 51 0.00% 40 65 0.00% 41 74 0.00% 42 78 0.00% 43 97 0.00% 44 99 0.00% 45 113 0.00% 46 115 0.00% 47 136 0.00% 48 164 0.00% 49 191 0.00% 50 217 0.00% 51 244 0.00% 52 245 0.00% 53 292 0.00% 54 306 0.00% 55 342 0.00% 56 373 0.00% 57 461 0.00% 58 535 0.00% 59 594 0.00% 60 691 0.00% 61 760 0.00% 62 833 0.00% 63 925 0.00% 64 1022 0.01% 65 1230 0.01% 66 1398 0.01% 67 1531 0.01% 68 1763 0.01% 69 2428 0.01% 70 2649 0.01% 71 2579 0.01% 72 2959 0.02% 73 3236 0.02% 74 3444 0.02% 75 3956 0.02% 76 4473 0.02% 77 4859 0.03% 78 5454 0.03% 79 5992 0.03% 80 6785 0.04% 81 7714 0.04% 82 8629 0.05% 83 9607 0.05% 84 11279 0.06% 85 12567 0.07% 86 13301 0.07% 87 14362 0.08% 88 15121 0.08% 89 16206 0.09% 90 18927 0.10% 91 18354 0.10% 92 19739 0.11% 93 21102 0.11% 94 22672 0.12% 95 23021 0.12% 96 24098 0.13% 97 25367 0.14% 98 26146 0.14% 99 27720 0.15% 100 29367 0.16% 101 31328 0.17% 102 32885 0.18% 103 34826 0.19% 104 35850 0.19% 105 37324 0.20% 106 39162 0.21% 107 39285 0.21% 108 40503 0.22% 109 42343 0.23% 110 43326 0.23% 111 45163 0.24% 112 47609 0.25% 113 49095 0.26% 114 51319 0.27% 115 52951 0.28% 116 54092 0.29% 117 55251 0.29% 118 55700 0.30% 119 57183 0.30% 120 59498 0.32% 121 61220 0.33% 122 62754 0.33% 123 66062 0.35% 124 68894 0.37% 125 70462 0.38% 126 73274 0.39% 127 73575 0.39% 128 74978 0.40% 129 77519 0.41% 130 79133 0.42% 131 82205 0.44% 132 85344 0.45% 133 89560 0.48% 134 92991 0.50% 135 98245 0.52% 136 103413 0.55% 137 108414 0.58% 138 113009 0.60% 139 117631 0.63% 140 123823 0.66% 141 132970 0.71% 142 144185 0.77% 143 158022 0.84% 144 177504 0.95% 145 206968 1.10% 146 250013 1.33% 147 330527 1.76% 148 492817 2.62% 149 968821 5.16% 150 4811966 25.62% 151 8051256 42.87% 18781828 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.24 sequence-density-rank=26 fanout-score=11.50 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=4.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=8 prefix-density=0.93 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=94.64 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579201 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 21:59:36 Started mapping on | Dec 09 21:59:36 Finished on | Dec 09 22:02:30 Mapping speed, Million of reads per hour | 388.59 Number of input reads | 18781828 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17977982 Uniquely mapped reads % | 95.72% Average mapped length | 289.92 Number of splices: Total | 19080381 Number of splices: Annotated (sjdb) | 18067329 Number of splices: GT/AG | 18836439 Number of splices: GC/AG | 222025 Number of splices: AT/AC | 8625 Number of splices: Non-canonical | 13292 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169184 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 8310 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656891 656891 656891 N_multimapping 169184 169184 169184 N_noFeature 537966 17443400 719192 N_ambiguous 412613 2388 60008 UnstrandedReadsAssigned:17027403 PositiveStrandReadsAssigned:532194 NegativeStrandReadsAssigned:17198782 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579201-trimmed-pair1.fastq SRR5579201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,781,828 reads, 17,262,019 reads pseudoaligned [quant] estimated average fragment length: 250.526 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR5579201.ke.tsv 35125 SRR5579201.se.tsv 88098 total ==> SRR5579201.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.273 0 0 PNS24247 1044 794.474 44.1713 4.50866 PNS24249 1928 1678.47 41.1667 1.98892 PNS24246 1044 794.474 44.1713 4.50866 PNS24248 1044 794.474 44.1713 4.50866 PNS24244 1471 1221.47 107.319 7.12494 PNS24243 293 104.313 0 0 KQK14069 1603 1353.47 1490.61 89.3099 KQK14071 474 246.445 41.2566 13.5757 ==> SRR5579201.se.tsv <== BRADI_1g14170v3 1801 BRADI_1g53295v3 48 BRADI_1g59795v3 572 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2494 BRADI_1g74790v3 53 BRADI_1g09890v3 2 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR5579201 completed mapping pipeline successfully