Starting /dee2/code/volunteer_pipeline.sh SRR5579202 current disk space = 1522506981376 free memory = 1373534432 SRR5579202 SRAfilesize b5a3ce9a9f4a172ec81e11557d0b55c1 SRR5579202.sra SRR5579202.sra file validated SRR5579202 is paired end SRR5579202 is conventional basespace SRR5579202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.52 34.0 32.0 34.0 2.0 34.0 2 32.353 34.0 33.0 34.0 28.0 34.0 3 32.489 34.0 33.0 34.0 28.0 34.0 4 32.964 34.0 33.0 34.0 32.0 34.0 5 33.0815 34.0 33.0 34.0 32.0 34.0 6 36.81625 38.0 37.0 38.0 35.0 38.0 7 37.14225 38.0 38.0 38.0 36.0 38.0 8 37.3305 38.0 38.0 38.0 37.0 38.0 9 37.36675 38.0 38.0 38.0 37.0 38.0 10-14 37.3652 38.0 38.0 38.0 37.0 38.0 15-19 37.3448 38.0 38.0 38.0 37.0 38.0 20-24 37.335699999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.2983 38.0 38.0 38.0 37.0 38.0 30-34 37.102 38.0 38.0 38.0 36.4 38.0 35-39 37.18945 38.0 38.0 38.0 36.6 38.0 40-44 37.01135 38.0 38.0 38.0 36.0 38.0 45-49 36.9998 38.0 38.0 38.0 35.8 38.0 50-54 36.883500000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.8279 38.0 38.0 38.0 35.0 38.0 60-64 36.757549999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.68645000000001 38.0 38.0 38.0 34.4 38.0 70-74 36.60015 38.0 38.0 38.0 34.0 38.0 75-79 36.595000000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.53395 38.0 38.0 38.0 34.0 38.0 85-89 36.443149999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.3187 38.0 38.0 38.0 33.6 38.0 95-99 36.18595 38.0 37.4 38.0 33.4 38.0 100-104 36.066100000000006 38.0 37.2 38.0 33.0 38.0 105-109 35.95435 38.0 37.0 38.0 32.6 38.0 110-114 35.80625 38.0 36.6 38.0 31.8 38.0 115-119 35.577349999999996 38.0 36.0 38.0 31.0 38.0 120-124 35.36435 38.0 36.0 38.0 30.2 38.0 125-129 35.1255 38.0 36.0 38.0 28.6 38.0 130-134 34.841449999999995 38.0 35.0 38.0 28.0 38.0 135-139 34.43814999999999 38.0 35.0 38.0 25.8 38.0 140-144 34.092 38.0 35.0 38.0 23.0 38.0 145-149 33.5364 38.0 34.6 38.0 19.0 38.0 150-151 30.062125 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 0.0 14 4.0 15 1.0 16 1.0 17 4.0 18 1.0 19 4.0 20 6.0 21 8.0 22 11.0 23 7.0 24 7.0 25 24.0 26 22.0 27 34.0 28 35.0 29 42.0 30 48.0 31 56.0 32 97.0 33 126.0 34 167.0 35 300.0 36 682.0 37 2307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.75403107593081 13.954851949574904 8.70712401055409 28.58399296394019 2 25.35 17.625 31.974999999999998 25.05 3 22.275 25.124999999999996 23.525 29.075 4 28.299999999999997 31.3 19.35 21.05 5 26.1 33.925 20.3 19.675 6 21.175 33.975 20.974999999999998 23.875 7 16.775000000000002 19.55 40.875 22.8 8 20.200000000000003 19.6 27.0 33.2 9 22.95 18.775 29.575000000000003 28.7 10-14 23.815 25.840000000000003 23.915 26.43 15-19 24.834999999999997 24.89 24.535 25.740000000000002 20-24 23.53 24.64 25.035 26.795 25-29 23.925 24.765 25.335 25.974999999999998 30-34 23.82 24.745 24.9 26.534999999999997 35-39 24.575 24.560000000000002 24.785 26.08 40-44 24.205 25.085 24.94 25.77 45-49 24.404999999999998 24.695 24.285 26.615 50-54 24.705 24.18 24.560000000000002 26.555 55-59 24.66 24.315 24.93 26.095000000000002 60-64 24.52 25.21 24.02 26.25 65-69 24.83 24.5 24.404999999999998 26.265 70-74 24.21 23.974999999999998 25.040000000000003 26.775 75-79 24.87 24.709999999999997 24.21 26.21 80-84 25.224999999999998 23.93 24.705 26.14 85-89 25.395 24.25 24.295 26.06 90-94 24.935 24.025 24.395 26.645000000000003 95-99 24.69 24.125 24.779999999999998 26.405 100-104 25.06 24.610000000000003 24.175 26.155 105-109 25.485000000000003 23.72 24.395 26.400000000000002 110-114 24.52 24.45 24.740000000000002 26.290000000000003 115-119 25.369999999999997 24.745 23.91 25.974999999999998 120-124 24.94 24.6 23.95 26.51 125-129 25.290000000000003 24.86 23.425 26.424999999999997 130-134 24.83 24.425 24.044999999999998 26.700000000000003 135-139 24.775 24.490000000000002 24.03 26.705000000000002 140-144 25.235000000000003 24.310000000000002 23.830000000000002 26.625 145-149 24.855 25.14 23.61 26.395000000000003 150-151 24.962500000000002 25.3 23.0625 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 2.0 28 3.5 29 4.5 30 5.5 31 6.5 32 10.5 33 18.5 34 24.0 35 25.5 36 38.5 37 60.5 38 78.0 39 88.0 40 113.0 41 139.0 42 141.5 43 164.0 44 187.0 45 188.5 46 189.5 47 177.5 48 158.0 49 143.5 50 149.0 51 152.0 52 135.0 53 109.5 54 87.5 55 100.5 56 103.5 57 104.5 58 108.0 59 94.0 60 91.0 61 90.5 62 86.5 63 80.0 64 73.0 65 65.5 66 64.0 67 52.5 68 49.5 69 53.0 70 45.0 71 36.5 72 27.5 73 22.0 74 16.5 75 12.0 76 5.5 77 3.0 78 5.5 79 4.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.125 0.0 0.0 0.0 0.0 106-107 3.4125 0.0 0.0 0.0 0.0 108-109 3.775 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.725 0.0 0.0 0.0 0.0 114-115 5.2125 0.0 0.0 0.0 0.0 116-117 5.800000000000001 0.0 0.0 0.0 0.0 118-119 6.4875 0.0 0.0 0.0 0.0 120-121 7.025 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.4875 0.0 0.0 0.0 0.0 128-129 9.087499999999999 0.0 0.0 0.0 0.0 130-131 9.4625 0.0 0.0 0.0 0.0 132-133 10.024999999999999 0.0 0.0 0.0 0.0 134-135 10.712499999999999 0.0 0.0 0.0 0.0 136-137 11.3125 0.0 0.0 0.0 0.0 138-139 12.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAA 10 0.0068484643 144.875 5 AAAACCA 10 0.0068484643 144.875 4 GACCTCC 10 0.0068484643 144.875 3 >>END_MODULE SRR5579202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.391 33.0 33.0 34.0 31.0 34.0 2 32.58375 33.0 33.0 34.0 32.0 34.0 3 32.63275 33.0 33.0 34.0 32.0 34.0 4 32.509 33.0 33.0 34.0 32.0 34.0 5 32.57575 33.0 33.0 34.0 32.0 34.0 6 36.66875 38.0 38.0 38.0 35.0 38.0 7 36.67425 38.0 38.0 38.0 35.0 38.0 8 36.72025 38.0 38.0 38.0 35.0 38.0 9 36.6175 38.0 38.0 38.0 35.0 38.0 10-14 36.67215 38.0 38.0 38.0 35.2 38.0 15-19 36.618900000000004 38.0 38.0 38.0 35.2 38.0 20-24 36.5692 38.0 38.0 38.0 35.2 38.0 25-29 36.56305 38.0 38.0 38.0 35.0 38.0 30-34 36.5299 38.0 38.0 38.0 35.2 38.0 35-39 36.517700000000005 38.0 38.0 38.0 35.0 38.0 40-44 36.49505 38.0 38.0 38.0 35.0 38.0 45-49 36.451499999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.409200000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.431850000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.3369 38.0 38.0 38.0 34.4 38.0 65-69 36.25169999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.16695 38.0 38.0 38.0 34.0 38.0 75-79 36.18339999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.0933 38.0 38.0 38.0 33.8 38.0 85-89 36.035199999999996 38.0 38.0 38.0 33.6 38.0 90-94 35.92975 38.0 38.0 38.0 33.2 38.0 95-99 35.71124999999999 38.0 38.0 38.0 32.4 38.0 100-104 35.624399999999994 38.0 38.0 38.0 32.0 38.0 105-109 35.4682 38.0 38.0 38.0 31.0 38.0 110-114 35.37365 38.0 37.2 38.0 31.0 38.0 115-119 35.0041 38.0 36.2 38.0 28.8 38.0 120-124 34.8515 38.0 36.0 38.0 28.0 38.0 125-129 34.5199 38.0 35.6 38.0 25.6 38.0 130-134 34.31345 38.0 35.4 38.0 23.8 38.0 135-139 33.86985 38.0 35.0 38.0 21.8 38.0 140-144 33.33 38.0 35.0 38.0 15.6 38.0 145-149 32.492599999999996 38.0 33.8 38.0 11.0 38.0 150-151 28.27075 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 7.0 4 7.0 5 2.0 6 4.0 7 3.0 8 5.0 9 1.0 10 4.0 11 4.0 12 2.0 13 6.0 14 2.0 15 4.0 16 8.0 17 6.0 18 8.0 19 7.0 20 8.0 21 12.0 22 15.0 23 7.0 24 20.0 25 18.0 26 25.0 27 31.0 28 42.0 29 44.0 30 66.0 31 59.0 32 99.0 33 101.0 34 127.0 35 225.0 36 522.0 37 2477.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.425000000000004 14.95 10.375 26.25 2 27.800000000000004 21.725 26.75 23.724999999999998 3 25.924999999999997 24.675 24.7 24.7 4 28.599999999999998 31.0 17.075000000000003 23.325000000000003 5 26.8 34.225 17.474999999999998 21.5 6 23.549999999999997 33.625 18.025 24.8 7 21.625 15.575 36.275 26.525 8 22.325 19.15 24.175 34.35 9 23.599999999999998 20.925 24.4 31.075000000000003 10-14 25.840000000000003 25.115 22.7 26.345000000000002 15-19 26.32 23.93 23.155 26.595000000000002 20-24 26.115 24.685000000000002 23.09 26.11 25-29 26.450000000000003 24.54 23.035 25.974999999999998 30-34 26.31 24.495 23.244999999999997 25.95 35-39 26.695 24.625 23.044999999999998 25.635 40-44 26.305 24.895 23.21 25.590000000000003 45-49 26.46 24.57 23.66 25.31 50-54 25.985000000000003 24.055 24.23 25.729999999999997 55-59 26.57 24.125 23.225 26.08 60-64 26.345000000000002 24.404999999999998 23.485 25.765 65-69 26.240000000000002 24.959999999999997 23.44 25.36 70-74 26.605 24.09 23.68 25.624999999999996 75-79 26.205000000000002 24.26 23.715 25.82 80-84 26.200000000000003 24.43 23.87 25.5 85-89 27.265 23.810000000000002 23.345 25.580000000000002 90-94 26.705000000000002 24.385 23.655 25.255 95-99 27.055 23.86 24.185000000000002 24.9 100-104 27.060000000000002 24.43 23.59 24.92 105-109 27.015 24.5 23.48 25.005 110-114 27.63 24.73 23.34 24.3 115-119 27.255000000000003 25.22 22.865 24.66 120-124 28.060000000000002 24.275 22.93 24.735 125-129 27.735 25.025 23.11 24.13 130-134 28.360000000000003 24.645 23.28 23.715 135-139 28.02 24.645 23.46 23.875 140-144 28.15 25.64 23.355 22.855 145-149 28.275 25.705 22.74 23.28 150-151 29.012500000000003 25.2625 23.1875 22.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 0.0 27 1.0 28 1.5 29 2.5 30 5.0 31 9.5 32 12.0 33 13.5 34 17.5 35 26.0 36 39.5 37 46.5 38 59.0 39 77.5 40 84.5 41 101.5 42 135.0 43 150.0 44 142.5 45 155.5 46 175.5 47 163.0 48 150.5 49 147.5 50 143.5 51 133.5 52 121.5 53 117.5 54 116.5 55 123.5 56 111.0 57 92.5 58 100.0 59 107.0 60 106.5 61 96.0 62 98.5 63 98.5 64 75.5 65 76.0 66 80.5 67 77.5 68 74.0 69 67.0 70 60.0 71 48.5 72 44.0 73 39.0 74 24.0 75 14.5 76 12.5 77 7.5 78 2.5 79 2.5 80 3.5 81 1.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83514813876931 97.575 2 1.063560395036718 2.1 3 0.07596859964547988 0.22499999999999998 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.4125 0.0 0.0 0.0 0.0 108-109 3.775 0.0 0.0 0.0 0.0 110-111 4.237500000000001 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.375 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.4 0.0 0.0 0.0 0.0 124-125 7.925000000000001 0.0 0.0 0.0 0.0 126-127 8.399999999999999 0.0 0.0 0.0 0.0 128-129 8.9875 0.0 0.0 0.0 0.0 130-131 9.3625 0.0 0.0 0.0 0.0 132-133 9.975000000000001 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 11.3 0.0 0.0 0.0 0.0 138-139 12.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACGA 10 0.006830828 145.0 4 CGAAACG 10 0.006830828 145.0 3 >>END_MODULE Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539919 spots for SRR5579202.sra Written 1539919 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra Read 1539912 spots for SRR5579202.sra Written 1539912 spots for SRR5579202.sra SRR ids: ['SRR5579202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aew_44cc SRR5579202.sra spots: 30798247 blocks: [[1, 1539912], [1539913, 3079824], [3079825, 4619736], [4619737, 6159648], [6159649, 7699560], [7699561, 9239472], [9239473, 10779384], [10779385, 12319296], [12319297, 13859208], [13859209, 15399120], [15399121, 16939032], [16939033, 18478944], [18478945, 20018856], [20018857, 21558768], [21558769, 23098680], [23098681, 24638592], [24638593, 26178504], [26178505, 27718416], [27718417, 29258328], [29258329, 30798247]] SRR5579202 file size 10414814 SRR5579202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579202 SRR5579202_1.fastq SRR5579202_2.fastq Input file: SRR5579202_1.fastq Paired file: SRR5579202_2.fastq trimmed: SRR5579202-trimmed-pair1.fastq, SRR5579202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:02:48 2024 >> started Mon Dec 9 22:05:32 2024 >> done (164.166s) 30798247 read pairs processed; of these: 72494 ( 0.24%) short read pairs filtered out after trimming by size control 69678 ( 0.23%) empty read pairs filtered out after trimming by size control 30656075 (99.54%) read pairs available; of these: 14310664 (46.68%) trimmed read pairs available after processing 16345411 (53.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 24 0.00% 20 19 0.00% 21 11 0.00% 22 15 0.00% 23 20 0.00% 24 23 0.00% 25 19 0.00% 26 19 0.00% 27 25 0.00% 28 41 0.00% 29 50 0.00% 30 44 0.00% 31 35 0.00% 32 51 0.00% 33 54 0.00% 34 58 0.00% 35 60 0.00% 36 65 0.00% 37 83 0.00% 38 89 0.00% 39 97 0.00% 40 133 0.00% 41 114 0.00% 42 166 0.00% 43 169 0.00% 44 180 0.00% 45 232 0.00% 46 241 0.00% 47 264 0.00% 48 322 0.00% 49 393 0.00% 50 393 0.00% 51 492 0.00% 52 619 0.00% 53 647 0.00% 54 690 0.00% 55 740 0.00% 56 894 0.00% 57 1000 0.00% 58 1221 0.00% 59 1408 0.00% 60 1637 0.01% 61 1750 0.01% 62 2013 0.01% 63 2135 0.01% 64 2467 0.01% 65 2779 0.01% 66 3030 0.01% 67 3507 0.01% 68 4091 0.01% 69 4882 0.02% 70 5737 0.02% 71 6072 0.02% 72 6812 0.02% 73 7494 0.02% 74 8057 0.03% 75 8832 0.03% 76 9614 0.03% 77 10755 0.04% 78 11786 0.04% 79 13535 0.04% 80 14830 0.05% 81 16703 0.05% 82 18509 0.06% 83 20619 0.07% 84 25196 0.08% 85 27400 0.09% 86 28472 0.09% 87 29878 0.10% 88 31151 0.10% 89 32659 0.11% 90 35379 0.12% 91 37180 0.12% 92 39751 0.13% 93 43181 0.14% 94 45037 0.15% 95 46065 0.15% 96 48040 0.16% 97 49391 0.16% 98 51047 0.17% 99 53329 0.17% 100 55540 0.18% 101 58728 0.19% 102 62255 0.20% 103 64515 0.21% 104 66585 0.22% 105 68946 0.22% 106 70620 0.23% 107 70307 0.23% 108 73029 0.24% 109 74484 0.24% 110 77397 0.25% 111 80533 0.26% 112 83626 0.27% 113 86195 0.28% 114 90000 0.29% 115 92750 0.30% 116 93289 0.30% 117 95592 0.31% 118 95180 0.31% 119 97563 0.32% 120 100267 0.33% 121 102694 0.33% 122 105974 0.35% 123 110243 0.36% 124 115068 0.38% 125 116834 0.38% 126 119852 0.39% 127 119638 0.39% 128 120471 0.39% 129 123995 0.40% 130 125031 0.41% 131 129044 0.42% 132 135325 0.44% 133 139838 0.46% 134 145087 0.47% 135 150300 0.49% 136 154544 0.50% 137 157927 0.52% 138 163693 0.53% 139 168980 0.55% 140 175720 0.57% 141 185676 0.61% 142 199250 0.65% 143 216275 0.71% 144 240328 0.78% 145 273501 0.89% 146 320045 1.04% 147 404181 1.32% 148 574206 1.87% 149 1046485 3.41% 150 5691022 18.56% 151 16345411 53.32% 30656075 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=20 prefix-density=1.00 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=30 fanout-score=14.87 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=4.4 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=10 prefix-density=0.77 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=68.97 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579202 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:06:34 Started mapping on | Dec 09 22:06:34 Finished on | Dec 09 22:19:06 Mapping speed, Million of reads per hour | 146.76 Number of input reads | 30656075 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 28983986 Uniquely mapped reads % | 94.55% Average mapped length | 289.21 Number of splices: Total | 29449484 Number of splices: Annotated (sjdb) | 27836599 Number of splices: GT/AG | 29068805 Number of splices: GC/AG | 345751 Number of splices: AT/AC | 14745 Number of splices: Non-canonical | 20183 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364822 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 57819 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1349946 1349946 1349946 N_multimapping 364822 364822 364822 N_noFeature 930791 28138620 1226448 N_ambiguous 645964 3622 98770 UnstrandedReadsAssigned:27407231 PositiveStrandReadsAssigned:841744 NegativeStrandReadsAssigned:27658768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579202-trimmed-pair1.fastq SRR5579202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,656,075 reads, 27,788,292 reads pseudoaligned [quant] estimated average fragment length: 248.351 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR5579202.ke.tsv 35125 SRR5579202.se.tsv 88098 total ==> SRR5579202.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.078 0 0 PNS24247 1044 796.649 52.0434 3.31962 PNS24249 1928 1680.65 114.135 3.4509 PNS24246 1044 796.649 52.0434 3.31962 PNS24248 1044 796.649 52.0434 3.31962 PNS24244 1471 1223.65 91.7348 3.8095 PNS24243 293 105.592 0 0 KQK14069 1603 1355.65 354.007 13.2695 KQK14071 474 247.552 23.3175 4.78637 ==> SRR5579202.se.tsv <== BRADI_1g14170v3 446 BRADI_1g53295v3 234 BRADI_1g59795v3 459 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 2517 BRADI_1g74790v3 138 BRADI_1g09890v3 7 BRADI_1g77505v3 363 BRADI_1g48960v3 0 SRR5579202 completed mapping pipeline successfully