Starting /dee2/code/volunteer_pipeline.sh SRR5579203 current disk space = 1522505531392 free memory = 1565623484 SRR5579203 SRAfilesize e4dc4cbeec05085072b68169800e97eb SRR5579203.sra SRR5579203.sra file validated SRR5579203 is paired end SRR5579203 is conventional basespace SRR5579203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.47175 34.0 33.0 34.0 2.0 34.0 2 32.53675 34.0 33.0 34.0 28.0 34.0 3 32.689 34.0 33.0 34.0 28.0 34.0 4 33.02875 34.0 33.0 34.0 32.0 34.0 5 33.153 34.0 33.0 34.0 32.0 34.0 6 36.83225 38.0 37.0 38.0 35.0 38.0 7 37.1515 38.0 38.0 38.0 36.0 38.0 8 37.437 38.0 38.0 38.0 37.0 38.0 9 37.422 38.0 38.0 38.0 37.0 38.0 10-14 37.38199999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.38875 38.0 38.0 38.0 37.0 38.0 20-24 37.37575 38.0 38.0 38.0 37.0 38.0 25-29 37.31705 38.0 38.0 38.0 37.0 38.0 30-34 37.14215 38.0 38.0 38.0 36.4 38.0 35-39 37.1823 38.0 38.0 38.0 36.8 38.0 40-44 37.0535 38.0 38.0 38.0 36.0 38.0 45-49 37.012899999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.93045 38.0 38.0 38.0 35.2 38.0 55-59 36.938 38.0 38.0 38.0 35.2 38.0 60-64 36.8044 38.0 38.0 38.0 34.8 38.0 65-69 36.69995 38.0 38.0 38.0 34.6 38.0 70-74 36.64515 38.0 38.0 38.0 34.2 38.0 75-79 36.580999999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.5416 38.0 38.0 38.0 34.0 38.0 85-89 36.466300000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.30075 38.0 38.0 38.0 33.8 38.0 95-99 36.215450000000004 38.0 37.6 38.0 33.2 38.0 100-104 36.12105 38.0 37.8 38.0 33.2 38.0 105-109 35.875800000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.743550000000006 38.0 36.4 38.0 31.6 38.0 115-119 35.627700000000004 38.0 36.0 38.0 31.2 38.0 120-124 35.4762 38.0 36.0 38.0 30.6 38.0 125-129 35.35459999999999 38.0 36.0 38.0 30.6 38.0 130-134 34.851 38.0 35.0 38.0 28.0 38.0 135-139 34.5423 38.0 34.8 38.0 26.2 38.0 140-144 34.134699999999995 38.0 35.0 38.0 23.4 38.0 145-149 33.58225 38.0 34.8 38.0 20.6 38.0 150-151 30.006625 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 2.0 15 2.0 16 4.0 17 4.0 18 2.0 19 5.0 20 2.0 21 4.0 22 7.0 23 11.0 24 10.0 25 13.0 26 25.0 27 30.0 28 25.0 29 37.0 30 52.0 31 65.0 32 90.0 33 124.0 34 178.0 35 297.0 36 700.0 37 2304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.50042480883602 12.574341546304163 9.119229679977343 34.80600396488247 2 26.125 17.075000000000003 33.324999999999996 23.474999999999998 3 22.775000000000002 23.325000000000003 23.849999999999998 30.049999999999997 4 29.175 29.925 18.075 22.825 5 26.525 32.75 20.95 19.775000000000002 6 21.349999999999998 33.6 21.65 23.400000000000002 7 19.325 19.375 38.324999999999996 22.975 8 21.0 20.125 26.75 32.125 9 21.325 20.674999999999997 29.125 28.875 10-14 24.44 25.66 23.945 25.955000000000002 15-19 24.104999999999997 24.42 24.945 26.529999999999998 20-24 24.36 24.21 24.884999999999998 26.545 25-29 24.2 24.65 24.455 26.695 30-34 24.185000000000002 24.79 24.175 26.85 35-39 24.825 24.05 25.009999999999998 26.115 40-44 24.529999999999998 24.2 24.565 26.705000000000002 45-49 24.055 23.905 24.545 27.495000000000005 50-54 24.355 24.5 24.37 26.775 55-59 25.145 24.215 24.0 26.640000000000004 60-64 24.66 24.490000000000002 24.14 26.71 65-69 25.040000000000003 24.165 24.23 26.565 70-74 25.224999999999998 23.855 24.015 26.905 75-79 25.180000000000003 24.255 23.474999999999998 27.089999999999996 80-84 24.825 24.43 24.365000000000002 26.38 85-89 25.385 23.82 23.674999999999997 27.12 90-94 24.795 24.044999999999998 24.165 26.995 95-99 25.355 23.375 24.675 26.595000000000002 100-104 25.97 24.0 23.695 26.334999999999997 105-109 25.82 24.104999999999997 23.605 26.47 110-114 25.655 23.925 23.835 26.584999999999997 115-119 25.929999999999996 24.035 23.765 26.27 120-124 25.380000000000003 24.315 23.380000000000003 26.924999999999997 125-129 25.929999999999996 24.165 22.97 26.935 130-134 25.324999999999996 24.29 23.695 26.69 135-139 25.509999999999998 24.505 22.845 27.139999999999997 140-144 25.745 24.455 22.545 27.255000000000003 145-149 25.669999999999998 24.3 22.91 27.12 150-151 25.575 24.25 23.425 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 1.5 28 2.0 29 3.0 30 4.0 31 9.0 32 13.5 33 15.0 34 17.0 35 27.5 36 49.0 37 63.5 38 71.5 39 90.5 40 110.5 41 119.0 42 136.0 43 158.5 44 159.5 45 166.5 46 162.0 47 140.5 48 145.5 49 151.5 50 142.5 51 145.0 52 138.5 53 131.0 54 129.0 55 114.5 56 112.5 57 116.5 58 112.5 59 101.5 60 92.5 61 86.5 62 76.0 63 73.5 64 70.0 65 72.0 66 71.5 67 64.5 68 54.0 69 40.0 70 37.0 71 40.0 72 38.5 73 30.5 74 30.5 75 23.0 76 13.0 77 9.0 78 4.5 79 3.0 80 2.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6313131313131313 1.25 3 0.10101010101010101 0.3 4 0.025252525252525252 0.1 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCTTGCTGAACTCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.5375 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.225 0.0 0.0 0.0 0.0 116-117 4.7 0.0 0.0 0.0 0.0 118-119 5.1625 0.0 0.0 0.0 0.0 120-121 5.6625 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 6.9625 0.0 0.0 0.0 0.0 126-127 7.6625 0.0 0.0 0.0 0.0 128-129 8.2625 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.4875 0.0 0.0 0.0 0.0 134-135 10.2875 0.0 0.0 0.0 0.0 136-137 11.0125 0.0 0.0 0.0 0.0 138-139 11.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCAAC 10 0.0068449317 144.90001 9 CCGATTC 10 0.0068449317 144.90001 2 >>END_MODULE SRR5579203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.28425 33.0 33.0 34.0 31.0 34.0 2 32.5685 33.0 33.0 34.0 32.0 34.0 3 32.6035 33.0 33.0 34.0 32.0 34.0 4 32.50925 33.0 33.0 34.0 31.0 34.0 5 32.5505 33.0 33.0 34.0 32.0 34.0 6 36.60075 38.0 38.0 38.0 35.0 38.0 7 36.66875 38.0 38.0 38.0 35.0 38.0 8 36.5565 38.0 38.0 38.0 35.0 38.0 9 36.607 38.0 38.0 38.0 35.0 38.0 10-14 36.5936 38.0 38.0 38.0 35.0 38.0 15-19 36.555899999999994 38.0 38.0 38.0 35.0 38.0 20-24 36.53605 38.0 38.0 38.0 35.0 38.0 25-29 36.549299999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.43095000000001 38.0 38.0 38.0 34.8 38.0 35-39 36.4356 38.0 38.0 38.0 34.4 38.0 40-44 36.48455 38.0 38.0 38.0 35.0 38.0 45-49 36.3594 38.0 38.0 38.0 34.0 38.0 50-54 36.349149999999995 38.0 38.0 38.0 34.2 38.0 55-59 36.3192 38.0 38.0 38.0 34.2 38.0 60-64 36.242149999999995 38.0 38.0 38.0 34.0 38.0 65-69 36.203900000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.1361 38.0 38.0 38.0 33.8 38.0 75-79 36.0269 38.0 38.0 38.0 33.4 38.0 80-84 36.00195 38.0 38.0 38.0 33.8 38.0 85-89 35.870099999999994 38.0 38.0 38.0 32.6 38.0 90-94 35.81775 38.0 38.0 38.0 32.8 38.0 95-99 35.66705 38.0 38.0 38.0 31.8 38.0 100-104 35.5816 38.0 37.8 38.0 31.4 38.0 105-109 35.324600000000004 38.0 37.4 38.0 30.4 38.0 110-114 35.229400000000005 38.0 37.0 38.0 30.2 38.0 115-119 35.048500000000004 38.0 36.2 38.0 29.4 38.0 120-124 34.8467 38.0 36.0 38.0 27.6 38.0 125-129 34.5908 38.0 35.6 38.0 26.0 38.0 130-134 34.19375 38.0 35.2 38.0 22.6 38.0 135-139 33.8558 38.0 35.0 38.0 21.4 38.0 140-144 33.3725 38.0 34.8 38.0 17.0 38.0 145-149 32.584799999999994 38.0 33.8 38.0 11.2 38.0 150-151 28.421 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 6.0 4 2.0 5 6.0 6 3.0 7 6.0 8 3.0 9 3.0 10 2.0 11 2.0 12 3.0 13 4.0 14 8.0 15 6.0 16 8.0 17 3.0 18 9.0 19 9.0 20 7.0 21 8.0 22 18.0 23 17.0 24 27.0 25 25.0 26 30.0 27 36.0 28 37.0 29 30.0 30 57.0 31 65.0 32 84.0 33 111.0 34 154.0 35 220.0 36 478.0 37 2492.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.9 13.975000000000001 12.325 30.8 2 28.4 20.974999999999998 28.225 22.400000000000002 3 26.375 22.5 24.8 26.325 4 29.2 29.775000000000002 18.025 23.0 5 28.075 32.425 19.05 20.45 6 22.25 33.35 18.725 25.674999999999997 7 21.95 15.9 35.075 27.075 8 22.1 19.825 23.724999999999998 34.35 9 23.025000000000002 21.025 25.3 30.65 10-14 26.27 24.815 21.765 27.150000000000002 15-19 26.465 24.19 22.78 26.565 20-24 26.6 24.45 22.98 25.97 25-29 26.87 24.62 22.305 26.205000000000002 30-34 26.950000000000003 24.245 22.27 26.534999999999997 35-39 26.939999999999998 24.335 22.35 26.375 40-44 27.145000000000003 24.01 22.95 25.895000000000003 45-49 27.51 23.674999999999997 23.16 25.655 50-54 26.665 23.825 22.655 26.855 55-59 27.075 23.305 23.34 26.279999999999998 60-64 26.634999999999998 24.05 23.064999999999998 26.25 65-69 27.089999999999996 23.895 23.255 25.759999999999998 70-74 27.495000000000005 23.315 22.755 26.435 75-79 26.235000000000003 23.87 23.565 26.33 80-84 27.05 23.82 23.215 25.915 85-89 26.665 23.685000000000002 23.385 26.265 90-94 26.685 24.02 23.53 25.765 95-99 27.54 24.055 22.919999999999998 25.485000000000003 100-104 27.125 23.555 23.75 25.569999999999997 105-109 26.945000000000004 24.23 23.315 25.509999999999998 110-114 27.615000000000002 24.240000000000002 23.28 24.865000000000002 115-119 27.389999999999997 24.81 22.705000000000002 25.095 120-124 27.965 23.935000000000002 23.285 24.815 125-129 27.575 24.855 22.685 24.884999999999998 130-134 28.92 24.395 22.400000000000002 24.285 135-139 28.299999999999997 24.63 23.075000000000003 23.995 140-144 28.67 24.64 22.825 23.865 145-149 29.03 25.28 22.485 23.205000000000002 150-151 29.1875 25.8125 22.287499999999998 22.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 2.0 28 2.0 29 2.0 30 3.5 31 6.5 32 6.0 33 7.0 34 14.5 35 26.0 36 31.5 37 37.0 38 59.5 39 74.0 40 81.5 41 96.0 42 107.0 43 123.5 44 150.0 45 148.5 46 138.0 47 149.5 48 156.0 49 151.5 50 142.0 51 128.5 52 119.0 53 122.0 54 141.0 55 130.0 56 106.0 57 108.0 58 111.5 59 111.5 60 100.0 61 96.5 62 103.0 63 98.0 64 93.0 65 89.0 66 85.5 67 83.0 68 75.0 69 69.5 70 63.5 71 56.0 72 52.0 73 41.5 74 29.0 75 24.0 76 15.0 77 9.5 78 7.5 79 4.5 80 1.5 81 1.0 82 2.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36567926455567 96.3 2 1.2768130745658837 2.5 3 0.22982635342185903 0.675 4 0.10214504596527069 0.4 5 0.02553626149131767 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.95 0.0 0.0 0.0 0.0 114-115 4.2375 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.175 0.0 0.0 0.0 0.0 120-121 5.725 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 7.025 0.0 0.0 0.0 0.0 126-127 7.737500000000001 0.0 0.0 0.0 0.0 128-129 8.375 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.625 0.0 0.0 0.0 0.0 134-135 10.4125 0.0 0.0 0.0 0.0 136-137 11.1125 0.0 0.0 0.0 0.0 138-139 11.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234982 spots for SRR5579203.sra Written 1234982 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra Read 1234972 spots for SRR5579203.sra Written 1234972 spots for SRR5579203.sra SRR ids: ['SRR5579203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hwqw7mu_ SRR5579203.sra spots: 24699450 blocks: [[1, 1234972], [1234973, 2469944], [2469945, 3704916], [3704917, 4939888], [4939889, 6174860], [6174861, 7409832], [7409833, 8644804], [8644805, 9879776], [9879777, 11114748], [11114749, 12349720], [12349721, 13584692], [13584693, 14819664], [14819665, 16054636], [16054637, 17289608], [17289609, 18524580], [18524581, 19759552], [19759553, 20994524], [20994525, 22229496], [22229497, 23464468], [23464469, 24699450]] SRR5579203 file size 8348132 SRR5579203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579203 SRR5579203_1.fastq SRR5579203_2.fastq Input file: SRR5579203_1.fastq Paired file: SRR5579203_2.fastq trimmed: SRR5579203-trimmed-pair1.fastq, SRR5579203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:00:09 2024 >> started Mon Dec 9 22:00:38 2024 >> done (28.092s) 24699450 read pairs processed; of these: 52505 ( 0.21%) short read pairs filtered out after trimming by size control 56857 ( 0.23%) empty read pairs filtered out after trimming by size control 24590088 (99.56%) read pairs available; of these: 11810889 (48.03%) trimmed read pairs available after processing 12779199 (51.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 8 0.00% 21 10 0.00% 22 9 0.00% 23 17 0.00% 24 14 0.00% 25 19 0.00% 26 11 0.00% 27 17 0.00% 28 22 0.00% 29 32 0.00% 30 21 0.00% 31 21 0.00% 32 21 0.00% 33 28 0.00% 34 31 0.00% 35 26 0.00% 36 40 0.00% 37 32 0.00% 38 39 0.00% 39 59 0.00% 40 56 0.00% 41 82 0.00% 42 81 0.00% 43 79 0.00% 44 124 0.00% 45 122 0.00% 46 150 0.00% 47 138 0.00% 48 198 0.00% 49 227 0.00% 50 237 0.00% 51 250 0.00% 52 278 0.00% 53 323 0.00% 54 328 0.00% 55 363 0.00% 56 448 0.00% 57 459 0.00% 58 602 0.00% 59 699 0.00% 60 781 0.00% 61 823 0.00% 62 997 0.00% 63 1101 0.00% 64 1248 0.01% 65 1411 0.01% 66 1602 0.01% 67 1884 0.01% 68 2179 0.01% 69 2760 0.01% 70 3110 0.01% 71 3100 0.01% 72 3525 0.01% 73 4104 0.02% 74 4357 0.02% 75 4863 0.02% 76 5424 0.02% 77 5929 0.02% 78 6904 0.03% 79 7660 0.03% 80 8644 0.04% 81 9783 0.04% 82 10762 0.04% 83 12148 0.05% 84 15310 0.06% 85 17241 0.07% 86 17985 0.07% 87 19296 0.08% 88 20240 0.08% 89 21635 0.09% 90 23378 0.10% 91 25259 0.10% 92 26501 0.11% 93 28986 0.12% 94 30815 0.13% 95 32397 0.13% 96 33669 0.14% 97 35217 0.14% 98 36437 0.15% 99 39101 0.16% 100 41153 0.17% 101 43140 0.18% 102 46157 0.19% 103 47985 0.20% 104 50602 0.21% 105 51863 0.21% 106 54223 0.22% 107 54595 0.22% 108 57378 0.23% 109 59140 0.24% 110 60642 0.25% 111 63449 0.26% 112 66430 0.27% 113 68299 0.28% 114 71307 0.29% 115 73837 0.30% 116 75876 0.31% 117 76875 0.31% 118 77381 0.31% 119 79548 0.32% 120 82401 0.34% 121 84071 0.34% 122 86659 0.35% 123 90657 0.37% 124 93877 0.38% 125 96291 0.39% 126 98133 0.40% 127 98987 0.40% 128 100271 0.41% 129 102630 0.42% 130 103534 0.42% 131 106907 0.43% 132 111651 0.45% 133 115594 0.47% 134 119788 0.49% 135 124723 0.51% 136 128452 0.52% 137 131291 0.53% 138 136280 0.55% 139 141291 0.57% 140 145847 0.59% 141 154709 0.63% 142 167455 0.68% 143 180298 0.73% 144 201966 0.82% 145 228852 0.93% 146 270616 1.10% 147 343350 1.40% 148 494715 2.01% 149 910722 3.70% 150 4804686 19.54% 151 12779199 51.97% 24590088 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=10 prefix-density=1.28 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.47 sequence-density-rank=15 fanout-score=4.53 fanout-score-rank=1 prefix-density=1.37 prefix-fanout=1.6 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=9 prefix-density=0.98 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=13.95 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5579203 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:01:37 Started mapping on | Dec 09 22:01:38 Finished on | Dec 09 22:06:24 Mapping speed, Million of reads per hour | 309.53 Number of input reads | 24590088 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22407128 Uniquely mapped reads % | 91.12% Average mapped length | 289.92 Number of splices: Total | 23649185 Number of splices: Annotated (sjdb) | 22320686 Number of splices: GT/AG | 23340688 Number of splices: GC/AG | 283616 Number of splices: AT/AC | 11248 Number of splices: Non-canonical | 13633 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393758 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 81090 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.98% % of reads unmapped: other | 1.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1818279 1818279 1818279 N_multimapping 393758 393758 393758 N_noFeature 663956 21769401 851104 N_ambiguous 540900 3269 90902 UnstrandedReadsAssigned:21202272 PositiveStrandReadsAssigned:634458 NegativeStrandReadsAssigned:21465122 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579203-trimmed-pair1.fastq SRR5579203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,590,088 reads, 21,657,066 reads pseudoaligned [quant] estimated average fragment length: 245.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52973 SRR5579203.ke.tsv 35125 SRR5579203.se.tsv 88098 total ==> SRR5579203.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.622 0 0 PNS24247 1044 799.181 43.0089 3.1651 PNS24249 1928 1683.18 115.822 4.047 PNS24246 1044 799.181 43.0089 3.1651 PNS24248 1044 799.181 43.0089 3.1651 PNS24244 1471 1226.18 97.1518 4.65984 PNS24243 293 104.85 0 0 KQK14069 1603 1358.18 1352.97 58.5876 KQK14071 474 247.773 30.6356 7.27189 ==> SRR5579203.se.tsv <== BRADI_1g14170v3 1441 BRADI_1g53295v3 57 BRADI_1g59795v3 250 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 3219 BRADI_1g74790v3 367 BRADI_1g09890v3 6 BRADI_1g77505v3 396 BRADI_1g48960v3 1 SRR5579203 completed mapping pipeline successfully