Starting /dee2/code/volunteer_pipeline.sh SRR5579204 current disk space = 1522509074432 free memory = 1565588512 SRR5579204 SRAfilesize 5272b5baba33bf076ff8fb161495773e SRR5579204.sra SRR5579204.sra file validated SRR5579204 is paired end SRR5579204 is conventional basespace SRR5579204 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.8055 34.0 33.0 34.0 2.0 34.0 2 32.48925 34.0 33.0 34.0 28.0 34.0 3 32.673 34.0 33.0 34.0 28.0 34.0 4 33.04875 34.0 33.0 34.0 32.0 34.0 5 33.05475 34.0 33.0 34.0 32.0 34.0 6 36.8895 38.0 37.0 38.0 35.0 38.0 7 37.27775 38.0 38.0 38.0 36.0 38.0 8 37.354 38.0 38.0 38.0 37.0 38.0 9 37.3675 38.0 38.0 38.0 37.0 38.0 10-14 37.39375 38.0 38.0 38.0 37.0 38.0 15-19 37.456849999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.37365 38.0 38.0 38.0 37.0 38.0 25-29 37.34745 38.0 38.0 38.0 37.0 38.0 30-34 37.2817 38.0 38.0 38.0 37.0 38.0 35-39 37.2701 38.0 38.0 38.0 37.0 38.0 40-44 37.1041 38.0 38.0 38.0 36.0 38.0 45-49 36.9903 38.0 38.0 38.0 36.0 38.0 50-54 36.98100000000001 38.0 38.0 38.0 35.4 38.0 55-59 36.8777 38.0 38.0 38.0 35.2 38.0 60-64 36.84204999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.847300000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.71565 38.0 38.0 38.0 34.6 38.0 75-79 36.64705 38.0 38.0 38.0 34.0 38.0 80-84 36.6081 38.0 38.0 38.0 34.0 38.0 85-89 36.5012 38.0 38.0 38.0 34.0 38.0 90-94 36.4962 38.0 38.0 38.0 34.0 38.0 95-99 36.3022 38.0 37.8 38.0 33.6 38.0 100-104 36.1927 38.0 37.2 38.0 33.0 38.0 105-109 36.03635 38.0 37.0 38.0 32.6 38.0 110-114 35.822900000000004 38.0 36.8 38.0 32.2 38.0 115-119 35.56335 38.0 36.4 38.0 30.6 38.0 120-124 35.447050000000004 38.0 36.0 38.0 30.6 38.0 125-129 35.04075 38.0 35.4 38.0 27.8 38.0 130-134 35.03995 38.0 35.0 38.0 28.2 38.0 135-139 34.99975 38.0 35.2 38.0 29.0 38.0 140-144 34.4584 38.0 35.0 38.0 26.8 38.0 145-149 33.873650000000005 38.0 35.0 38.0 23.4 38.0 150-151 30.507125000000002 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 8.0 19 5.0 20 0.0 21 2.0 22 8.0 23 13.0 24 6.0 25 14.0 26 24.0 27 16.0 28 34.0 29 46.0 30 52.0 31 65.0 32 94.0 33 98.0 34 160.0 35 297.0 36 756.0 37 2294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.678810842320026 12.76595744680851 9.763917225298746 35.79131448557272 2 22.925 18.825 35.9 22.35 3 22.475 23.825 24.725 28.975 4 27.500000000000004 30.55 18.45 23.5 5 24.525 34.65 21.725 19.1 6 21.3 35.025 22.55 21.125 7 17.925 19.325 42.05 20.7 8 20.8 18.875 27.875 32.45 9 21.55 19.275000000000002 30.9 28.275 10-14 23.695 26.02 24.725 25.56 15-19 24.235 25.064999999999998 25.195 25.505 20-24 23.799999999999997 24.86 25.674999999999997 25.665 25-29 23.880000000000003 25.41 24.715 25.995 30-34 24.07 25.485000000000003 24.84 25.605 35-39 23.765 24.905 25.655 25.674999999999997 40-44 24.19 25.46 25.22 25.130000000000003 45-49 24.03 25.385 25.035 25.55 50-54 23.845 24.865000000000002 25.174999999999997 26.115 55-59 24.05 24.65 25.424999999999997 25.874999999999996 60-64 24.16 24.884999999999998 25.105 25.85 65-69 24.765 24.86 24.65 25.724999999999998 70-74 24.36 24.605 25.124999999999996 25.91 75-79 24.365000000000002 25.115 24.66 25.86 80-84 24.95 25.055 24.610000000000003 25.385 85-89 24.279999999999998 25.355 24.905 25.46 90-94 24.665 24.415 25.2 25.72 95-99 24.525 25.0 24.67 25.805 100-104 25.14 25.240000000000002 24.224999999999998 25.395 105-109 24.654999999999998 24.925 24.565 25.855 110-114 24.69 25.11 24.755 25.445 115-119 24.98 24.795 24.169999999999998 26.055 120-124 24.695 25.124999999999996 24.255 25.924999999999997 125-129 24.845 24.990000000000002 24.610000000000003 25.555 130-134 25.085 24.545 24.145 26.224999999999998 135-139 24.665 24.7 24.45 26.185000000000002 140-144 24.895 24.77 23.885 26.450000000000003 145-149 24.64 25.1 24.044999999999998 26.215 150-151 24.425 25.15 23.3375 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 1.5 28 2.5 29 5.5 30 7.5 31 10.0 32 16.0 33 22.0 34 23.0 35 36.5 36 52.0 37 61.5 38 82.5 39 110.0 40 131.5 41 142.5 42 159.0 43 173.0 44 172.5 45 191.5 46 203.0 47 202.0 48 203.0 49 170.0 50 142.5 51 132.5 52 126.0 53 114.5 54 94.5 55 96.5 56 96.5 57 89.5 58 87.0 59 79.0 60 71.0 61 68.5 62 76.0 63 69.5 64 60.5 65 59.5 66 49.5 67 42.0 68 41.0 69 40.5 70 36.0 71 31.5 72 28.0 73 27.0 74 19.5 75 10.0 76 8.0 77 6.5 78 5.0 79 3.5 80 3.5 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.224999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.8875 0.0 0.0 0.0 0.0 112-113 3.225 0.0 0.0 0.0 0.0 114-115 3.675 0.0 0.0 0.0 0.0 116-117 4.175 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.1125 0.0 0.0 0.0 0.0 122-123 5.6375 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.1625 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.8625 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACCGC 10 0.00456877 165.57143 1 CCAGGAT 10 0.00456877 165.57143 1 ATGAAAT 10 0.0068484643 144.875 7 >>END_MODULE SRR5579204 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6585 33.0 33.0 34.0 32.0 34.0 2 32.74825 33.0 33.0 34.0 32.0 34.0 3 32.717 34.0 33.0 34.0 32.0 34.0 4 32.69225 34.0 33.0 34.0 32.0 34.0 5 32.68775 34.0 33.0 34.0 32.0 34.0 6 36.728 38.0 38.0 38.0 35.0 38.0 7 36.806 38.0 38.0 38.0 35.0 38.0 8 36.8255 38.0 38.0 38.0 36.0 38.0 9 36.83125 38.0 38.0 38.0 36.0 38.0 10-14 36.830949999999994 38.0 38.0 38.0 35.8 38.0 15-19 36.7915 38.0 38.0 38.0 36.0 38.0 20-24 36.75664999999999 38.0 38.0 38.0 35.8 38.0 25-29 36.5697 38.0 38.0 38.0 35.2 38.0 30-34 36.76255 38.0 38.0 38.0 35.8 38.0 35-39 36.7425 38.0 38.0 38.0 35.8 38.0 40-44 36.74380000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.64790000000001 38.0 38.0 38.0 35.2 38.0 50-54 36.666 38.0 38.0 38.0 35.4 38.0 55-59 36.6542 38.0 38.0 38.0 35.2 38.0 60-64 36.561 38.0 38.0 38.0 34.8 38.0 65-69 36.531349999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.40625 38.0 38.0 38.0 34.4 38.0 75-79 36.3721 38.0 38.0 38.0 34.0 38.0 80-84 36.350049999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.2719 38.0 38.0 38.0 34.0 38.0 90-94 35.798449999999995 38.0 37.6 38.0 31.6 38.0 95-99 36.07435 38.0 38.0 38.0 33.4 38.0 100-104 35.847 38.0 38.0 38.0 32.8 38.0 105-109 35.73315 38.0 38.0 38.0 31.8 38.0 110-114 35.6918 38.0 38.0 38.0 32.2 38.0 115-119 35.518150000000006 38.0 37.4 38.0 31.2 38.0 120-124 35.33325 38.0 36.6 38.0 31.0 38.0 125-129 35.041250000000005 38.0 36.0 38.0 29.0 38.0 130-134 34.56615 38.0 35.4 38.0 26.8 38.0 135-139 34.35025 38.0 35.2 38.0 25.6 38.0 140-144 33.93509999999999 38.0 35.0 38.0 22.0 38.0 145-149 33.1271 38.0 34.2 38.0 13.0 38.0 150-151 29.00025 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 4.0 5 3.0 6 5.0 7 1.0 8 1.0 9 2.0 10 2.0 11 3.0 12 2.0 13 7.0 14 1.0 15 2.0 16 6.0 17 7.0 18 6.0 19 10.0 20 6.0 21 7.0 22 12.0 23 11.0 24 24.0 25 27.0 26 35.0 27 32.0 28 20.0 29 39.0 30 43.0 31 54.0 32 92.0 33 104.0 34 144.0 35 240.0 36 480.0 37 2555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 13.925 11.75 31.974999999999998 2 27.224999999999998 22.225 29.049999999999997 21.5 3 23.95 25.324999999999996 24.125 26.6 4 28.075 31.025000000000002 17.05 23.849999999999998 5 27.900000000000002 34.25 18.675 19.175 6 21.85 34.025 20.025000000000002 24.099999999999998 7 21.725 15.15 38.0 25.124999999999996 8 22.8 21.0 23.7 32.5 9 24.025 20.825 25.724999999999998 29.425 10-14 25.874999999999996 25.650000000000002 23.135 25.34 15-19 25.929999999999996 24.385 23.86 25.825 20-24 25.230000000000004 25.5 23.86 25.41 25-29 26.200000000000003 24.86 23.075000000000003 25.865 30-34 25.4 24.715 23.845 26.040000000000003 35-39 25.915 24.67 23.974999999999998 25.44 40-44 26.11 24.654999999999998 23.849999999999998 25.385 45-49 26.095000000000002 24.26 23.995 25.650000000000002 50-54 26.090000000000003 24.41 23.9 25.6 55-59 26.165 24.41 23.82 25.605 60-64 25.924999999999997 24.425 24.025 25.624999999999996 65-69 25.929999999999996 24.935 24.36 24.775 70-74 26.005 24.355 24.175 25.465 75-79 25.585 24.7 24.01 25.705 80-84 26.015 24.54 24.235 25.21 85-89 26.33 24.67 23.865 25.135 90-94 25.855 24.69 24.47 24.985 95-99 25.415 24.82 24.525 25.240000000000002 100-104 26.064999999999998 24.465 24.145 25.324999999999996 105-109 26.484999999999996 25.069999999999997 23.93 24.515 110-114 26.450000000000003 25.11 23.544999999999998 24.895 115-119 26.950000000000003 24.535 23.915 24.6 120-124 26.99 25.55 23.78 23.68 125-129 27.255000000000003 25.509999999999998 23.575 23.66 130-134 27.67 24.779999999999998 24.2 23.35 135-139 27.42 25.490000000000002 24.104999999999997 22.985 140-144 27.794999999999998 25.205 23.7 23.3 145-149 27.485 26.055 23.89 22.57 150-151 28.4125 25.324999999999996 23.1625 23.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.0 29 2.5 30 5.5 31 9.0 32 12.0 33 16.0 34 19.5 35 31.5 36 38.0 37 41.5 38 61.0 39 86.0 40 101.0 41 121.0 42 141.5 43 149.5 44 171.5 45 184.5 46 183.0 47 185.0 48 178.5 49 171.0 50 152.5 51 132.0 52 118.5 53 107.5 54 104.5 55 94.0 56 93.0 57 109.0 58 101.5 59 85.5 60 81.5 61 79.5 62 79.5 63 79.0 64 81.0 65 75.5 66 69.5 67 65.0 68 65.5 69 64.0 70 54.0 71 45.0 72 43.5 73 41.0 74 25.0 75 11.0 76 5.5 77 4.5 78 3.5 79 4.5 80 4.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06494819307557 98.0 2 0.859236795552186 1.7000000000000002 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4249999999999998 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.9249999999999998 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.3125 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.2375 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.675 0.0 0.0 0.0 0.0 124-125 6.225 0.0 0.0 0.0 0.0 126-127 6.675000000000001 0.0 0.0 0.0 0.0 128-129 7.237500000000001 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.3625 0.0 0.0 0.0 0.0 134-135 8.9625 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATAT 10 0.006830828 145.0 7 >>END_MODULE Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457179 spots for SRR5579204.sra Written 1457179 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra Read 1457161 spots for SRR5579204.sra Written 1457161 spots for SRR5579204.sra SRR ids: ['SRR5579204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t_itg5js SRR5579204.sra spots: 29143238 blocks: [[1, 1457161], [1457162, 2914322], [2914323, 4371483], [4371484, 5828644], [5828645, 7285805], [7285806, 8742966], [8742967, 10200127], [10200128, 11657288], [11657289, 13114449], [13114450, 14571610], [14571611, 16028771], [16028772, 17485932], [17485933, 18943093], [18943094, 20400254], [20400255, 21857415], [21857416, 23314576], [23314577, 24771737], [24771738, 26228898], [26228899, 27686059], [27686060, 29143238]] SRR5579204 file size 9853986 SRR5579204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579204 SRR5579204_1.fastq SRR5579204_2.fastq Input file: SRR5579204_1.fastq Paired file: SRR5579204_2.fastq trimmed: SRR5579204-trimmed-pair1.fastq, SRR5579204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:01:41 2024 >> started Mon Dec 9 22:02:18 2024 >> done (36.822s) 29143238 read pairs processed; of these: 44294 ( 0.15%) short read pairs filtered out after trimming by size control 41640 ( 0.14%) empty read pairs filtered out after trimming by size control 29057304 (99.71%) read pairs available; of these: 12952186 (44.57%) trimmed read pairs available after processing 16105118 (55.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 8 0.00% 21 12 0.00% 22 14 0.00% 23 7 0.00% 24 10 0.00% 25 11 0.00% 26 16 0.00% 27 17 0.00% 28 25 0.00% 29 15 0.00% 30 27 0.00% 31 17 0.00% 32 28 0.00% 33 21 0.00% 34 26 0.00% 35 23 0.00% 36 49 0.00% 37 49 0.00% 38 50 0.00% 39 58 0.00% 40 49 0.00% 41 69 0.00% 42 76 0.00% 43 70 0.00% 44 73 0.00% 45 90 0.00% 46 112 0.00% 47 146 0.00% 48 183 0.00% 49 191 0.00% 50 180 0.00% 51 235 0.00% 52 266 0.00% 53 270 0.00% 54 326 0.00% 55 358 0.00% 56 424 0.00% 57 472 0.00% 58 535 0.00% 59 630 0.00% 60 739 0.00% 61 857 0.00% 62 885 0.00% 63 1064 0.00% 64 1197 0.00% 65 1306 0.00% 66 1382 0.00% 67 1741 0.01% 68 2020 0.01% 69 2354 0.01% 70 2650 0.01% 71 2974 0.01% 72 3476 0.01% 73 3644 0.01% 74 4261 0.01% 75 4640 0.02% 76 5257 0.02% 77 5844 0.02% 78 6644 0.02% 79 7536 0.03% 80 8437 0.03% 81 9611 0.03% 82 10904 0.04% 83 11916 0.04% 84 14885 0.05% 85 16927 0.06% 86 17551 0.06% 87 18818 0.06% 88 19843 0.07% 89 21274 0.07% 90 23045 0.08% 91 24860 0.09% 92 26737 0.09% 93 28689 0.10% 94 30870 0.11% 95 32800 0.11% 96 34644 0.12% 97 35868 0.12% 98 37303 0.13% 99 39736 0.14% 100 41423 0.14% 101 44372 0.15% 102 47241 0.16% 103 49456 0.17% 104 51551 0.18% 105 53523 0.18% 106 56490 0.19% 107 57132 0.20% 108 59581 0.21% 109 61339 0.21% 110 63818 0.22% 111 66830 0.23% 112 69952 0.24% 113 71959 0.25% 114 75546 0.26% 115 79024 0.27% 116 80677 0.28% 117 82702 0.28% 118 84075 0.29% 119 85365 0.29% 120 88717 0.31% 121 90559 0.31% 122 94189 0.32% 123 98110 0.34% 124 101994 0.35% 125 105245 0.36% 126 117578 0.40% 127 100023 0.34% 128 110504 0.38% 129 113799 0.39% 130 115464 0.40% 131 118869 0.41% 132 124236 0.43% 133 128086 0.44% 134 133644 0.46% 135 140182 0.48% 136 144853 0.50% 137 149083 0.51% 138 155166 0.53% 139 152664 0.53% 140 159380 0.55% 141 169136 0.58% 142 182369 0.63% 143 196208 0.68% 144 217880 0.75% 145 248186 0.85% 146 292910 1.01% 147 367955 1.27% 148 520212 1.79% 149 959915 3.30% 150 5442571 18.73% 151 16105118 55.43% 29057304 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=28 prefix-density=0.62 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=43.22 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.6 sequence=ATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=20 prefix-density=0.69 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=75.29 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579204 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:03:11 Started mapping on | Dec 09 22:03:11 Finished on | Dec 09 22:06:52 Mapping speed, Million of reads per hour | 473.33 Number of input reads | 29057304 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 27645967 Uniquely mapped reads % | 95.14% Average mapped length | 291.20 Number of splices: Total | 29677480 Number of splices: Annotated (sjdb) | 27888320 Number of splices: GT/AG | 29295739 Number of splices: GC/AG | 348464 Number of splices: AT/AC | 13806 Number of splices: Non-canonical | 19471 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360625 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 38236 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1077060 1077060 1077060 N_multimapping 360625 360625 360625 N_noFeature 1088148 26846852 1381739 N_ambiguous 611775 4173 107023 UnstrandedReadsAssigned:25946044 PositiveStrandReadsAssigned:794942 NegativeStrandReadsAssigned:26157205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579204-trimmed-pair1.fastq SRR5579204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,057,304 reads, 26,327,548 reads pseudoaligned [quant] estimated average fragment length: 249.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR5579204.ke.tsv 35125 SRR5579204.se.tsv 88098 total ==> SRR5579204.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.357 0 0 PNS24247 1044 795.842 72.8131 5.05836 PNS24249 1928 1679.84 121.932 4.01306 PNS24246 1044 795.842 72.8131 5.05836 PNS24248 1044 795.842 72.8131 5.05836 PNS24244 1471 1222.84 147.629 6.67464 PNS24243 293 102.44 0 0 KQK14069 1603 1354.84 2763.83 112.785 KQK14071 474 245.695 54.8114 12.3339 ==> SRR5579204.se.tsv <== BRADI_1g14170v3 3053 BRADI_1g53295v3 287 BRADI_1g59795v3 452 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 3096 BRADI_1g74790v3 200 BRADI_1g09890v3 3 BRADI_1g77505v3 460 BRADI_1g48960v3 0 SRR5579204 completed mapping pipeline successfully