Starting /dee2/code/volunteer_pipeline.sh SRR5579205 current disk space = 1522523389952 free memory = 1568742516 SRR5579205 SRAfilesize 6c1826a7be97630de4646bdf73d1c6b0 SRR5579205.sra SRR5579205.sra file validated SRR5579205 is paired end SRR5579205 is conventional basespace SRR5579205 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2335 34.0 33.0 34.0 31.0 34.0 2 33.022 34.0 33.0 34.0 31.0 34.0 3 33.1835 34.0 33.0 34.0 32.0 34.0 4 33.36775 34.0 33.0 34.0 33.0 34.0 5 33.3895 34.0 33.0 34.0 33.0 34.0 6 37.1995 38.0 38.0 38.0 36.0 38.0 7 37.445 38.0 38.0 38.0 37.0 38.0 8 37.49225 38.0 38.0 38.0 38.0 38.0 9 37.525 38.0 38.0 38.0 38.0 38.0 10-14 37.56080000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.4918 38.0 38.0 38.0 38.0 38.0 20-24 37.38555 38.0 38.0 38.0 37.4 38.0 25-29 37.3277 38.0 38.0 38.0 37.0 38.0 30-34 37.3018 38.0 38.0 38.0 37.0 38.0 35-39 37.1659 38.0 38.0 38.0 36.8 38.0 40-44 36.93845 38.0 38.0 38.0 36.0 38.0 45-49 37.099000000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.34155 38.0 38.0 38.0 37.0 38.0 55-59 37.21875 38.0 38.0 38.0 36.8 38.0 60-64 37.248400000000004 38.0 38.0 38.0 36.6 38.0 65-69 36.9644 38.0 38.0 38.0 35.6 38.0 70-74 37.083600000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.899499999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.748149999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.914550000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.687749999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.784949999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.1441 38.0 37.6 38.0 33.2 38.0 105-109 36.1769 38.0 37.8 38.0 33.6 38.0 110-114 35.96425000000001 38.0 37.6 38.0 32.6 38.0 115-119 35.73995 38.0 36.8 38.0 31.8 38.0 120-124 35.7173 38.0 36.6 38.0 31.8 38.0 125-129 35.59755 38.0 36.2 38.0 31.0 38.0 130-134 35.39925 38.0 36.0 38.0 30.2 38.0 135-139 35.3926 38.0 36.0 38.0 31.0 38.0 140-144 35.057399999999994 38.0 35.8 38.0 29.4 38.0 145-149 34.26755 38.0 34.2 38.0 27.6 38.0 150-151 29.84075 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 1.0 19 4.0 20 4.0 21 6.0 22 5.0 23 7.0 24 12.0 25 16.0 26 18.0 27 18.0 28 25.0 29 32.0 30 64.0 31 55.0 32 74.0 33 106.0 34 147.0 35 205.0 36 568.0 37 2628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.531040042999194 14.350980919107768 9.889814565976888 31.228164471916152 2 23.799999999999997 18.65 34.300000000000004 23.25 3 22.35 24.25 25.174999999999997 28.225 4 27.450000000000003 29.975 20.775 21.8 5 24.625 33.575 21.7 20.1 6 21.099999999999998 33.4 22.175 23.325000000000003 7 16.725 19.45 42.275 21.55 8 19.6 21.375 27.6 31.424999999999997 9 21.349999999999998 20.0 30.625000000000004 28.025 10-14 23.05 25.71 25.28 25.96 15-19 23.599999999999998 25.405 25.36 25.635 20-24 22.77069267316829 25.586396599149786 25.391347836959238 26.25156289072268 25-29 22.40784274496074 25.87405591957185 25.66398239383784 26.05411894162957 30-34 23.474999999999998 25.305 25.72 25.5 35-39 22.919999999999998 25.355 25.865 25.86 40-44 23.575 25.729999999999997 25.155 25.540000000000003 45-49 23.382338233823383 25.367536753675367 25.52755275527553 25.722572257225725 50-54 23.064999999999998 25.259999999999998 25.865 25.81 55-59 22.742274227422744 25.007500750075007 25.7025702570257 26.547654765476548 60-64 23.239295718287316 25.08003201280512 25.33513405362145 26.345538215286112 65-69 23.533530029504426 25.068760314047108 25.348802320348053 26.048907336100413 70-74 23.43117155857793 25.10625531276564 25.746287314365716 25.716285814290714 75-79 23.89 24.595 25.5 26.015 80-84 24.005000000000003 24.935 25.165 25.895000000000003 85-89 24.04 25.09 25.009999999999998 25.86 90-94 24.349999999999998 25.495 24.615000000000002 25.540000000000003 95-99 23.87 25.069999999999997 25.005 26.055 100-104 23.993397689191216 25.418896613814834 25.018756564797677 25.568949132196266 105-109 23.686317685917327 25.282754479031126 25.342808527674908 25.68811930737664 110-114 24.25970388155262 25.325130052020807 24.324729891956785 26.09043617446979 115-119 23.962396239623963 25.13751375137514 24.827482748274825 26.072607260726073 120-124 23.799999999999997 25.4 24.4 26.400000000000002 125-129 24.215 25.1 24.72 25.965 130-134 24.215 25.85 23.974999999999998 25.96 135-139 24.26 25.35 23.615 26.775 140-144 23.94 25.385 24.425 26.25 145-149 24.43 24.88 24.375 26.314999999999998 150-151 23.925 25.224999999999998 24.325 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 2.5 29 5.0 30 9.5 31 12.5 32 16.0 33 24.0 34 30.5 35 34.0 36 42.5 37 67.5 38 88.0 39 102.0 40 124.5 41 140.5 42 168.0 43 185.0 44 199.0 45 223.5 46 211.5 47 181.5 48 172.5 49 170.5 50 165.5 51 148.5 52 123.0 53 116.0 54 105.0 55 94.0 56 95.5 57 89.0 58 81.5 59 87.5 60 83.0 61 72.0 62 66.5 63 56.0 64 57.5 65 54.0 66 53.0 67 54.5 68 35.5 69 28.5 70 27.5 71 22.0 72 19.0 73 17.0 74 13.5 75 9.0 76 6.0 77 2.5 78 0.5 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.034999999999999996 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.01 60-64 0.04 65-69 0.015 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.09 110-114 0.04 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.7056451612903225 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.025 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.65 0.0 0.0 0.0 0.0 112-113 4.050000000000001 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.125 0.0 0.0 0.0 0.0 120-121 5.55 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.575 0.0 0.0 0.0 0.0 126-127 7.175 0.0 0.0 0.0 0.0 128-129 7.824999999999999 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 8.9125 0.0 0.0 0.0 0.0 134-135 9.5 0.0 0.0 0.0 0.0 136-137 10.287500000000001 0.0 0.0 0.0 0.0 138-139 11.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTTTT 10 0.0054020355 156.67567 1 ACCTCAG 35 0.0035472352 20.703571 135-139 >>END_MODULE SRR5579205 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56525 33.0 33.0 34.0 32.0 34.0 2 32.81825 34.0 33.0 34.0 32.0 34.0 3 32.7865 34.0 33.0 34.0 32.0 34.0 4 32.71725 34.0 33.0 34.0 32.0 34.0 5 32.63775 34.0 33.0 34.0 32.0 34.0 6 36.795 38.0 38.0 38.0 36.0 38.0 7 36.976 38.0 38.0 38.0 37.0 38.0 8 36.9465 38.0 38.0 38.0 36.0 38.0 9 36.8345 38.0 38.0 38.0 36.0 38.0 10-14 36.7765 38.0 38.0 38.0 35.8 38.0 15-19 36.895149999999994 38.0 38.0 38.0 36.8 38.0 20-24 36.884249999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.8845 38.0 38.0 38.0 36.4 38.0 30-34 36.85495 38.0 38.0 38.0 36.4 38.0 35-39 36.992900000000006 38.0 38.0 38.0 37.0 38.0 40-44 36.98629999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.9199 38.0 38.0 38.0 36.8 38.0 50-54 36.863350000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.81265 38.0 38.0 38.0 36.4 38.0 60-64 36.833349999999996 38.0 38.0 38.0 36.4 38.0 65-69 36.69415 38.0 38.0 38.0 36.0 38.0 70-74 36.3857 38.0 38.0 38.0 34.4 38.0 75-79 36.04065 38.0 38.0 38.0 32.4 38.0 80-84 36.123900000000006 38.0 38.0 38.0 33.4 38.0 85-89 36.331149999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.4234 38.0 38.0 38.0 34.8 38.0 95-99 36.34845 38.0 38.0 38.0 34.4 38.0 100-104 36.158899999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.84310000000001 38.0 38.0 38.0 33.0 38.0 110-114 35.76545 38.0 38.0 38.0 32.6 38.0 115-119 35.3607 38.0 37.2 38.0 30.8 38.0 120-124 34.7818 38.0 36.0 38.0 26.6 38.0 125-129 34.4144 38.0 35.2 38.0 23.6 38.0 130-134 34.443200000000004 38.0 35.2 38.0 25.2 38.0 135-139 34.08265 38.0 34.8 38.0 24.0 38.0 140-144 33.488350000000004 38.0 33.2 38.0 21.4 38.0 145-149 32.53995 38.0 33.0 38.0 10.4 38.0 150-151 28.085875 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 5.0 4 0.0 5 2.0 6 3.0 7 3.0 8 2.0 9 1.0 10 2.0 11 0.0 12 2.0 13 3.0 14 4.0 15 4.0 16 6.0 17 4.0 18 13.0 19 7.0 20 5.0 21 9.0 22 13.0 23 12.0 24 16.0 25 16.0 26 20.0 27 36.0 28 32.0 29 35.0 30 51.0 31 57.0 32 76.0 33 107.0 34 157.0 35 217.0 36 559.0 37 2503.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.89078583981923 16.921918152146624 11.197589756464977 26.989706251569167 2 27.822378324134473 22.478675363773206 28.299046663321626 21.3998996487707 3 23.901581722319857 24.328395681647 27.190559879487825 24.579462716545315 4 27.99397439116244 30.981672106452425 18.52874717549586 22.495606326889277 5 26.15461847389558 34.56325301204819 19.45281124497992 19.829317269076306 6 22.414224893563738 34.73578762834961 20.160280490859 22.68970698722765 7 21.21896162528217 16.93002257336343 36.16754451968899 25.68347128166541 8 23.319959879638915 21.063189568706118 23.89669007021063 31.72016048144433 9 25.206715108995237 21.373089451265347 24.605362064645455 28.81483337509396 10-14 25.726744186046513 25.21551724137931 23.586607858861267 25.47113071371291 15-19 26.112670408981554 24.894747393744986 23.822173215717722 25.170408981555738 20-24 26.364046294904554 24.745728743925046 23.77373615912621 25.11648880204419 25-29 26.23377924745729 24.810862267648677 24.109424319855705 24.845934165038326 30-34 26.520693456258144 24.907305341216553 23.89517987774326 24.676821324782043 35-39 26.268851144846938 25.096447717821533 24.20461946991332 24.430081667418207 40-44 25.87303973144947 24.815872538704344 24.490204920086175 24.820882809760008 45-49 26.550135229890813 24.701993388760894 24.396474005809875 24.351397375538415 50-54 26.123778501628664 25.56251566023553 24.074166875469807 24.239538962666 55-59 26.345864661654133 24.977443609022558 23.74436090225564 24.93233082706767 60-64 26.17937534466336 24.76061563142327 24.44979194866396 24.61021707524941 65-69 26.204441770692334 25.652980398054847 23.98355642452499 24.159021406727827 70-74 25.925183030789288 25.228161668839633 24.160064186139802 24.68659111423127 75-79 25.69880062227129 24.695137250966027 24.5947709138355 25.011291212927183 80-84 25.910504665395806 24.917226848600382 24.551018360589946 24.621250125413866 85-89 25.950255741650786 24.967405475880053 24.024671547487713 25.057667234981444 90-94 25.872442839951866 24.96490172482952 24.61893301243482 24.543722422783794 95-99 25.911073236753722 25.449897237956794 24.773171587548248 23.86585793774124 100-104 25.95339513906289 24.770734151841644 24.620395890754196 24.65547481834127 105-109 26.148215002005614 25.00501403931007 24.769354191736863 24.077416766947454 110-114 26.519558676028083 25.887662988966902 23.691073219658975 23.90170511534604 115-119 26.85677057231633 25.613911997594467 23.864889245264106 23.6644281848251 120-124 26.92731829573935 25.05263157894737 24.451127819548873 23.56892230576441 125-129 27.317415730337082 26.088483146067414 23.700842696629213 22.89325842696629 130-134 27.22941117464139 26.095897281572878 24.220082254990473 22.454609288795265 135-139 27.140063186399882 26.207311569128933 24.401985858281932 22.25063938618926 140-144 28.014842300556587 25.532768389911247 24.00340971769543 22.448979591836736 145-149 27.986758952753537 25.99558631758451 23.818838399037016 22.198816330624936 150-151 28.270412642669008 25.611438605292864 23.491784773610938 22.626363978427193 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 2.5 29 4.5 30 6.5 31 8.5 32 10.5 33 18.5 34 25.5 35 30.5 36 35.0 37 49.5 38 73.5 39 84.5 40 99.0 41 120.0 42 147.0 43 171.5 44 184.0 45 180.0 46 186.5 47 188.0 48 167.5 49 152.0 50 142.5 51 142.0 52 134.0 53 120.0 54 108.0 55 105.5 56 93.0 57 87.5 58 100.0 59 99.5 60 99.0 61 94.0 62 93.0 63 91.0 64 78.0 65 70.5 66 62.0 67 53.5 68 49.0 69 46.5 70 49.0 71 40.5 72 22.5 73 18.0 74 14.0 75 8.5 76 7.5 77 5.0 78 3.0 79 2.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.35000000000000003 3 0.42500000000000004 4 0.42500000000000004 5 0.4 6 0.17500000000000002 7 0.325 8 0.3 9 0.22499999999999998 10-14 0.24 15-19 0.24 20-24 0.20500000000000002 25-29 0.20500000000000002 30-34 0.21 35-39 0.20500000000000002 40-44 0.20500000000000002 45-49 0.16999999999999998 50-54 0.22499999999999998 55-59 0.25 60-64 0.265 65-69 0.265 70-74 0.29 75-79 0.365 80-84 0.33 85-89 0.29 90-94 0.27999999999999997 95-99 0.255 100-104 0.22499999999999998 105-109 0.27999999999999997 110-114 0.3 115-119 0.22999999999999998 120-124 0.25 125-129 0.32 130-134 0.31 135-139 0.295 140-144 0.28500000000000003 145-149 0.31 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34393136512742 98.425 2 0.5046681806712087 1.0 3 0.0757002271006813 0.22499999999999998 4 0.05046681806712087 0.2 5 0.0 0.0 6 0.025233409033560434 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.5374999999999996 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.199999999999999 0.0 0.0 0.0 0.0 114-115 4.525 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.324999999999999 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.2 0.0 0.0 0.0 0.0 124-125 6.75 0.0 0.0 0.0 0.0 126-127 7.3625 0.0 0.0 0.0 0.0 128-129 8.037500000000001 0.0 0.0 0.0 0.0 130-131 8.5375 0.0 0.0 0.0 0.0 132-133 9.075 0.0 0.0 0.0 0.0 134-135 9.649999999999999 0.0 0.0 0.0 0.0 136-137 10.4125 0.0 0.0 0.0 0.0 138-139 11.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGC 10 0.006830828 145.0 1 GGCAGTC 10 0.006830828 145.0 2 >>END_MODULE Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070985 spots for SRR5579205.sra Written 1070985 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra Read 1070971 spots for SRR5579205.sra Written 1070971 spots for SRR5579205.sra SRR ids: ['SRR5579205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f2z8rmz7 SRR5579205.sra spots: 21419434 blocks: [[1, 1070971], [1070972, 2141942], [2141943, 3212913], [3212914, 4283884], [4283885, 5354855], [5354856, 6425826], [6425827, 7496797], [7496798, 8567768], [8567769, 9638739], [9638740, 10709710], [10709711, 11780681], [11780682, 12851652], [12851653, 13922623], [13922624, 14993594], [14993595, 16064565], [16064566, 17135536], [17135537, 18206507], [18206508, 19277478], [19277479, 20348449], [20348450, 21419434]] SRR5579205 file size 7236642 SRR5579205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579205 SRR5579205_1.fastq SRR5579205_2.fastq Input file: SRR5579205_1.fastq Paired file: SRR5579205_2.fastq trimmed: SRR5579205-trimmed-pair1.fastq, SRR5579205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:01:03 2024 >> started Mon Dec 9 22:01:26 2024 >> done (22.822s) 21419434 read pairs processed; of these: 42361 ( 0.20%) short read pairs filtered out after trimming by size control 93918 ( 0.44%) empty read pairs filtered out after trimming by size control 21283155 (99.36%) read pairs available; of these: 11378697 (53.46%) trimmed read pairs available after processing 9904458 (46.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 18 0.00% 20 9 0.00% 21 21 0.00% 22 20 0.00% 23 14 0.00% 24 13 0.00% 25 22 0.00% 26 24 0.00% 27 15 0.00% 28 24 0.00% 29 29 0.00% 30 41 0.00% 31 28 0.00% 32 29 0.00% 33 33 0.00% 34 33 0.00% 35 37 0.00% 36 39 0.00% 37 51 0.00% 38 63 0.00% 39 70 0.00% 40 68 0.00% 41 73 0.00% 42 80 0.00% 43 75 0.00% 44 93 0.00% 45 109 0.00% 46 120 0.00% 47 144 0.00% 48 175 0.00% 49 187 0.00% 50 209 0.00% 51 223 0.00% 52 278 0.00% 53 295 0.00% 54 325 0.00% 55 359 0.00% 56 402 0.00% 57 523 0.00% 58 547 0.00% 59 689 0.00% 60 771 0.00% 61 875 0.00% 62 990 0.00% 63 1059 0.00% 64 1180 0.01% 65 1317 0.01% 66 1528 0.01% 67 1739 0.01% 68 2127 0.01% 69 2645 0.01% 70 2892 0.01% 71 3101 0.01% 72 3477 0.02% 73 3919 0.02% 74 4372 0.02% 75 4743 0.02% 76 5117 0.02% 77 5619 0.03% 78 6459 0.03% 79 7298 0.03% 80 8152 0.04% 81 9415 0.04% 82 10698 0.05% 83 11594 0.05% 84 13996 0.07% 85 15515 0.07% 86 16516 0.08% 87 17575 0.08% 88 18724 0.09% 89 19964 0.09% 90 21135 0.10% 91 23012 0.11% 92 24896 0.12% 93 25923 0.12% 94 27844 0.13% 95 28887 0.14% 96 30079 0.14% 97 31492 0.15% 98 32457 0.15% 99 34957 0.16% 100 36482 0.17% 101 39498 0.19% 102 40319 0.19% 103 41560 0.20% 104 43166 0.20% 105 45322 0.21% 106 46466 0.22% 107 46328 0.22% 108 48465 0.23% 109 49837 0.23% 110 51145 0.24% 111 53459 0.25% 112 55710 0.26% 113 58220 0.27% 114 60935 0.29% 115 62214 0.29% 116 62855 0.30% 117 64191 0.30% 118 64893 0.30% 119 65562 0.31% 120 68381 0.32% 121 70295 0.33% 122 72508 0.34% 123 75595 0.36% 124 78552 0.37% 125 81219 0.38% 126 83452 0.39% 127 83739 0.39% 128 84687 0.40% 129 86602 0.41% 130 87414 0.41% 131 90463 0.43% 132 95015 0.45% 133 98521 0.46% 134 101812 0.48% 135 107582 0.51% 136 111357 0.52% 137 114844 0.54% 138 119319 0.56% 139 123844 0.58% 140 129893 0.61% 141 139162 0.65% 142 152092 0.71% 143 164870 0.77% 144 186410 0.88% 145 217731 1.02% 146 267407 1.26% 147 337174 1.58% 148 498095 2.34% 149 962572 4.52% 150 4961781 23.31% 151 9904458 46.54% 21283155 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=10 prefix-density=0.92 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.32 sequence-density-rank=15 fanout-score=5.91 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=1.8 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=8 prefix-density=0.74 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=16.00 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5579205 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:02:11 Started mapping on | Dec 09 22:02:11 Finished on | Dec 09 22:05:01 Mapping speed, Million of reads per hour | 450.70 Number of input reads | 21283155 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20031897 Uniquely mapped reads % | 94.12% Average mapped length | 289.64 Number of splices: Total | 21679696 Number of splices: Annotated (sjdb) | 20494819 Number of splices: GT/AG | 21390521 Number of splices: GC/AG | 263984 Number of splices: AT/AC | 10662 Number of splices: Non-canonical | 14529 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294700 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 37889 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 983311 983311 983311 N_multimapping 294700 294700 294700 N_noFeature 747750 19413114 976375 N_ambiguous 459895 3047 70231 UnstrandedReadsAssigned:18824252 PositiveStrandReadsAssigned:615736 NegativeStrandReadsAssigned:18985291 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579205-trimmed-pair1.fastq SRR5579205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,283,155 reads, 19,125,624 reads pseudoaligned [quant] estimated average fragment length: 250.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR5579205.ke.tsv 35125 SRR5579205.se.tsv 88098 total ==> SRR5579205.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.643 0 0 PNS24247 1044 794.073 49.1945 4.65569 PNS24249 1928 1678.07 53.9432 2.41576 PNS24246 1044 794.073 49.1945 4.65569 PNS24248 1044 794.073 49.1945 4.65569 PNS24244 1471 1221.07 130.473 8.02986 PNS24243 293 104.998 0 0 KQK14069 1603 1353.07 1747.06 97.0321 KQK14071 474 247.155 48.7284 14.8163 ==> SRR5579205.se.tsv <== BRADI_1g14170v3 1946 BRADI_1g53295v3 95 BRADI_1g59795v3 483 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2806 BRADI_1g74790v3 161 BRADI_1g09890v3 1 BRADI_1g77505v3 297 BRADI_1g48960v3 0 SRR5579205 completed mapping pipeline successfully