Starting /dee2/code/volunteer_pipeline.sh SRR5579206 current disk space = 1522508845056 free memory = 1595012904 SRR5579206 SRAfilesize 41115083a5a650a7884f7ce27cbaa217 SRR5579206.sra SRR5579206.sra file validated SRR5579206 is paired end SRR5579206 is conventional basespace SRR5579206 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26575 34.0 33.0 34.0 31.0 34.0 2 33.011 34.0 33.0 34.0 31.0 34.0 3 33.14675 34.0 33.0 34.0 32.0 34.0 4 33.4295 34.0 33.0 34.0 33.0 34.0 5 33.4175 34.0 33.0 34.0 33.0 34.0 6 37.2265 38.0 38.0 38.0 36.0 38.0 7 37.47525 38.0 38.0 38.0 37.0 38.0 8 37.56675 38.0 38.0 38.0 38.0 38.0 9 37.51775 38.0 38.0 38.0 38.0 38.0 10-14 37.534499999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.518899999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.33665 38.0 38.0 38.0 37.0 38.0 25-29 37.294850000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.271 38.0 38.0 38.0 37.0 38.0 35-39 37.097750000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.92745000000001 38.0 38.0 38.0 35.6 38.0 45-49 37.097500000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.31484999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.22005 38.0 38.0 38.0 36.6 38.0 60-64 37.23045 38.0 38.0 38.0 36.8 38.0 65-69 36.9447 38.0 38.0 38.0 35.6 38.0 70-74 37.0086 38.0 38.0 38.0 35.8 38.0 75-79 36.8837 38.0 38.0 38.0 35.6 38.0 80-84 36.7295 38.0 38.0 38.0 35.0 38.0 85-89 36.9112 38.0 38.0 38.0 35.4 38.0 90-94 36.65505 38.0 38.0 38.0 34.6 38.0 95-99 36.729699999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.071299999999994 38.0 37.6 38.0 32.8 38.0 105-109 36.03975 38.0 37.6 38.0 33.2 38.0 110-114 35.806599999999996 38.0 37.0 38.0 31.8 38.0 115-119 35.6603 38.0 36.6 38.0 31.0 38.0 120-124 35.57445 38.0 36.2 38.0 31.0 38.0 125-129 35.5501 38.0 36.0 38.0 30.8 38.0 130-134 35.4421 38.0 36.0 38.0 30.6 38.0 135-139 35.2875 38.0 36.0 38.0 30.2 38.0 140-144 35.046049999999994 38.0 35.8 38.0 29.8 38.0 145-149 34.34490000000001 38.0 34.4 38.0 27.6 38.0 150-151 30.02675 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 3.0 19 3.0 20 3.0 21 6.0 22 9.0 23 5.0 24 9.0 25 16.0 26 14.0 27 23.0 28 27.0 29 37.0 30 48.0 31 61.0 32 74.0 33 95.0 34 164.0 35 229.0 36 571.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.674456083803385 14.692452323395111 9.239860327692721 32.39323126510879 2 22.650000000000002 19.475 35.825 22.05 3 21.275 25.15 25.1 28.475 4 26.5 31.974999999999998 20.474999999999998 21.05 5 25.5 33.75 21.65 19.1 6 20.625 34.375 23.799999999999997 21.2 7 16.275000000000002 19.875 42.199999999999996 21.65 8 20.3 21.7 27.3 30.7 9 19.375 20.3 32.300000000000004 28.025 10-14 22.264999999999997 27.16 25.14 25.435000000000002 15-19 22.905 26.11 25.435000000000002 25.55 20-24 23.075383922765244 25.741583712670703 26.001700765344403 25.181331599219646 25-29 22.594037615046016 26.285514205682276 25.52521008403361 25.595238095238095 30-34 22.55 26.055 26.474999999999998 24.92 35-39 22.902290229022903 25.992599259925992 25.63256325632563 25.472547254725477 40-44 23.167316731673168 26.067606760676064 25.432543254325434 25.332533253325334 45-49 22.679535907181435 26.44528905781156 25.3000600120024 25.575115023004603 50-54 23.17347602140321 25.353803070460568 26.038905835875383 25.433815072260842 55-59 23.25697709312794 26.44793438031409 25.112533760128038 25.182554766429927 60-64 23.131939581874562 25.81774532359708 25.682704811443436 25.367610283084925 65-69 23.54853227984198 25.52882932439866 25.51382707406111 25.408811321698256 70-74 22.624524904980998 26.05521104220844 25.96519303860772 25.35507101420284 75-79 23.185 26.115 25.355 25.345000000000002 80-84 23.757375737573756 25.807580758075808 24.852485248524854 25.58255825582558 85-89 22.955000000000002 25.679999999999996 25.490000000000002 25.874999999999996 90-94 23.265 25.790000000000003 25.385 25.56 95-99 23.595 25.825 24.805 25.775 100-104 23.947184155246575 25.432629788936683 25.232569770931278 25.387616284885468 105-109 23.797607727340974 25.52424803563385 25.624343125969673 25.053801111055503 110-114 23.77569906457906 25.3564103846731 25.79160622280026 25.07628432794758 115-119 23.25465093018604 25.51510302060412 25.11002200440088 26.12022404480896 120-124 23.830000000000002 25.590000000000003 25.06 25.52 125-129 23.405 26.3 24.675 25.619999999999997 130-134 23.799999999999997 25.330000000000002 25.005 25.865 135-139 22.955000000000002 26.33 25.0 25.715 140-144 23.715 25.52 24.79 25.974999999999998 145-149 23.400000000000002 26.009999999999998 24.62 25.97 150-151 23.525 25.837500000000002 24.975 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 5.5 29 7.5 30 10.0 31 15.0 32 17.5 33 21.0 34 33.0 35 46.0 36 59.0 37 72.0 38 87.0 39 113.0 40 147.5 41 165.5 42 170.5 43 195.5 44 205.0 45 209.0 46 224.5 47 213.0 48 182.0 49 171.0 50 165.5 51 141.5 52 128.0 53 115.0 54 101.0 55 98.0 56 86.5 57 76.5 58 74.0 59 57.0 60 57.0 61 64.5 62 53.5 63 54.5 64 57.5 65 52.0 66 44.0 67 33.5 68 26.0 69 28.5 70 27.0 71 22.0 72 19.5 73 14.0 74 11.0 75 6.5 76 5.0 77 4.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.925000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.045 25-29 0.04 30-34 0.0 35-39 0.01 40-44 0.01 45-49 0.02 50-54 0.015 55-59 0.03 60-64 0.03 65-69 0.015 70-74 0.02 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.095 110-114 0.045 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.525 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.2125000000000004 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9499999999999997 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.625 0.0 0.0 0.0 0.0 138-139 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579206 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.602 33.0 33.0 34.0 32.0 34.0 2 32.8395 34.0 33.0 34.0 32.0 34.0 3 32.7745 34.0 33.0 34.0 32.0 34.0 4 32.75675 34.0 33.0 34.0 32.0 34.0 5 32.6585 34.0 33.0 34.0 32.0 34.0 6 36.8415 38.0 38.0 38.0 36.0 38.0 7 36.98125 38.0 38.0 38.0 37.0 38.0 8 36.88625 38.0 38.0 38.0 36.0 38.0 9 36.862 38.0 38.0 38.0 36.0 38.0 10-14 36.80265 38.0 38.0 38.0 35.6 38.0 15-19 36.92955 38.0 38.0 38.0 36.6 38.0 20-24 36.9294 38.0 38.0 38.0 36.6 38.0 25-29 36.9169 38.0 38.0 38.0 36.4 38.0 30-34 36.865750000000006 38.0 38.0 38.0 36.6 38.0 35-39 37.016450000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.0095 38.0 38.0 38.0 37.0 38.0 45-49 36.87695 38.0 38.0 38.0 36.6 38.0 50-54 36.8383 38.0 38.0 38.0 36.2 38.0 55-59 36.8018 38.0 38.0 38.0 36.2 38.0 60-64 36.777049999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.63685 38.0 38.0 38.0 35.4 38.0 70-74 36.388250000000006 38.0 38.0 38.0 34.6 38.0 75-79 36.03675 38.0 38.0 38.0 32.8 38.0 80-84 36.074 38.0 38.0 38.0 33.2 38.0 85-89 36.20315000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.36345 38.0 38.0 38.0 34.6 38.0 95-99 36.2548 38.0 38.0 38.0 34.2 38.0 100-104 36.166250000000005 38.0 38.0 38.0 34.0 38.0 105-109 35.86455 38.0 38.0 38.0 33.2 38.0 110-114 35.760949999999994 38.0 38.0 38.0 33.0 38.0 115-119 35.432100000000005 38.0 37.2 38.0 31.4 38.0 120-124 34.83065 38.0 36.2 38.0 27.0 38.0 125-129 34.54785 38.0 35.4 38.0 24.2 38.0 130-134 34.6626 38.0 35.8 38.0 27.0 38.0 135-139 34.3718 38.0 35.4 38.0 26.0 38.0 140-144 33.91115 38.0 33.8 38.0 23.8 38.0 145-149 32.958749999999995 38.0 33.0 38.0 16.2 38.0 150-151 28.3955 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 2.0 5 1.0 6 0.0 7 4.0 8 2.0 9 4.0 10 3.0 11 2.0 12 3.0 13 5.0 14 1.0 15 7.0 16 8.0 17 6.0 18 3.0 19 5.0 20 5.0 21 11.0 22 7.0 23 12.0 24 15.0 25 22.0 26 19.0 27 25.0 28 48.0 29 43.0 30 51.0 31 50.0 32 75.0 33 91.0 34 156.0 35 237.0 36 489.0 37 2570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.63691073219659 14.167502507522567 11.860581745235708 28.335005015045134 2 26.65330661322645 22.369739478957914 30.210420841683366 20.766533066132265 3 23.570712136409227 24.623871614844532 26.68004012036108 25.125376128385156 4 28.986960882647946 32.74824473420261 17.301905717151456 20.962888665997994 5 26.48459032823854 35.07892758707091 18.59183162114758 19.84465046354297 6 20.87087087087087 35.13513513513514 20.77077077077077 23.223223223223226 7 20.586025544703233 15.502128725269221 39.24367643375908 24.66816929626847 8 23.015276734285 20.711244678186826 24.142248935637365 32.131229651890806 9 22.784176264396592 22.158237356034054 26.74011016524787 28.31747621432148 10-14 26.39827750237845 25.44689800210305 23.15357268038656 25.00125181513194 15-19 25.958938407611416 24.84226339509264 24.787180771156734 24.41161742613921 20-24 25.71972162419266 25.55950533219847 24.297802032744205 24.422971010864668 25-29 25.44061686360905 25.45563789305027 24.55938313639095 24.54436210694973 30-34 25.180252353294613 25.560785099138794 24.319046665331463 24.939915882235127 35-39 25.57708677582495 24.976215512493116 24.165039306995144 25.281658404686798 40-44 25.83617063889445 24.40416583216503 25.01001401962748 24.749649509313038 45-49 25.538199659557424 25.14769199959948 24.77721037348553 24.536897967357564 50-54 25.62215212057483 25.031295378298534 24.99624455460418 24.350307946522456 55-59 26.07672275641026 24.699519230769234 25.245392628205128 23.978365384615387 60-64 25.3267892021836 25.19657434767366 25.111433865878702 24.365202584264036 65-69 25.87268993839836 25.346822256723595 24.46035959332899 24.320128211549054 70-74 25.62227675664847 25.206590874943657 24.410276956979015 24.76085541142886 75-79 26.2124248496994 24.774549098196395 24.739478957915832 24.273547094188377 80-84 25.612382908380503 25.642438511245803 24.996243049641837 23.748935530731856 85-89 26.141826923076923 24.749599358974358 25.015024038461537 24.093549679487182 90-94 26.17688301282051 25.28545673076923 24.634415064102562 23.903245192307693 95-99 25.9978965292733 25.75749987479341 24.62563229328392 23.61897130264937 100-104 25.314237067454552 25.499524262607043 25.18904301667585 23.99719565326256 105-109 25.49707016577353 25.68738418390344 25.04131817498873 23.7742274753343 110-114 26.01422418110788 25.999198637684064 24.676950816387862 23.309626364820193 115-119 26.24067304321699 25.604687265261155 24.97871701136762 23.17592268015424 120-124 26.69003505257887 25.16775162744116 25.037556334501755 23.10465698547822 125-129 26.36245241434582 25.716289320777395 25.190342616710076 22.7309156481667 130-134 26.844662625857836 26.218504232830735 24.43019586234534 22.50663727896609 135-139 26.895722728638688 26.06430932585395 24.872282880897526 22.167685064609838 140-144 27.196233597115093 26.224581789041366 24.25623560052089 22.32294901332265 145-149 26.785535410197337 26.294700991685865 24.686967845337072 22.232795752779726 150-151 26.859504132231404 26.22088655146506 24.94365138993238 21.97595792637115 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.5 28 4.0 29 4.0 30 4.5 31 9.5 32 14.0 33 17.0 34 24.5 35 31.5 36 43.0 37 54.0 38 77.0 39 100.0 40 120.0 41 133.5 42 140.5 43 156.5 44 175.5 45 182.0 46 183.5 47 182.0 48 185.5 49 198.5 50 175.0 51 141.5 52 141.5 53 133.5 54 113.5 55 97.5 56 89.0 57 90.5 58 91.5 59 87.0 60 77.5 61 69.0 62 63.5 63 68.0 64 66.0 65 66.5 66 59.0 67 57.0 68 54.0 69 43.0 70 36.5 71 32.0 72 30.5 73 22.0 74 13.5 75 8.5 76 6.5 77 3.5 78 3.5 79 3.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.2 3 0.3 4 0.3 5 0.22499999999999998 6 0.1 7 0.17500000000000002 8 0.17500000000000002 9 0.15 10-14 0.145 15-19 0.15 20-24 0.135 25-29 0.13999999999999999 30-34 0.13999999999999999 35-39 0.145 40-44 0.13999999999999999 45-49 0.13 50-54 0.145 55-59 0.16 60-64 0.165 65-69 0.165 70-74 0.165 75-79 0.2 80-84 0.185 85-89 0.16 90-94 0.16 95-99 0.165 100-104 0.155 105-109 0.165 110-114 0.16999999999999998 115-119 0.155 120-124 0.15 125-129 0.18 130-134 0.185 135-139 0.16999999999999998 140-144 0.16999999999999998 145-149 0.16999999999999998 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.5125 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 8.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCTTT 10 0.006830828 145.0 8 GAGATCA 10 0.006830828 145.0 4 >>END_MODULE Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136498 spots for SRR5579206.sra Written 1136498 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra Read 1136490 spots for SRR5579206.sra Written 1136490 spots for SRR5579206.sra SRR ids: ['SRR5579206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fngd61mf SRR5579206.sra spots: 22729808 blocks: [[1, 1136490], [1136491, 2272980], [2272981, 3409470], [3409471, 4545960], [4545961, 5682450], [5682451, 6818940], [6818941, 7955430], [7955431, 9091920], [9091921, 10228410], [10228411, 11364900], [11364901, 12501390], [12501391, 13637880], [13637881, 14774370], [14774371, 15910860], [15910861, 17047350], [17047351, 18183840], [18183841, 19320330], [19320331, 20456820], [20456821, 21593310], [21593311, 22729808]] SRR5579206 file size 7680685 SRR5579206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579206 SRR5579206_1.fastq SRR5579206_2.fastq Input file: SRR5579206_1.fastq Paired file: SRR5579206_2.fastq trimmed: SRR5579206-trimmed-pair1.fastq, SRR5579206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:08:44 2024 >> started Mon Dec 9 22:09:11 2024 >> done (26.641s) 22729808 read pairs processed; of these: 40143 ( 0.18%) short read pairs filtered out after trimming by size control 92087 ( 0.41%) empty read pairs filtered out after trimming by size control 22597578 (99.42%) read pairs available; of these: 11761891 (52.05%) trimmed read pairs available after processing 10835687 (47.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 11 0.00% 20 17 0.00% 21 16 0.00% 22 26 0.00% 23 19 0.00% 24 18 0.00% 25 24 0.00% 26 19 0.00% 27 30 0.00% 28 18 0.00% 29 28 0.00% 30 26 0.00% 31 22 0.00% 32 28 0.00% 33 33 0.00% 34 23 0.00% 35 39 0.00% 36 30 0.00% 37 43 0.00% 38 50 0.00% 39 63 0.00% 40 57 0.00% 41 61 0.00% 42 58 0.00% 43 65 0.00% 44 74 0.00% 45 69 0.00% 46 111 0.00% 47 116 0.00% 48 162 0.00% 49 142 0.00% 50 155 0.00% 51 169 0.00% 52 192 0.00% 53 193 0.00% 54 246 0.00% 55 271 0.00% 56 275 0.00% 57 330 0.00% 58 380 0.00% 59 477 0.00% 60 499 0.00% 61 610 0.00% 62 641 0.00% 63 780 0.00% 64 761 0.00% 65 907 0.00% 66 1012 0.00% 67 1148 0.01% 68 1411 0.01% 69 1835 0.01% 70 1975 0.01% 71 2117 0.01% 72 2381 0.01% 73 2585 0.01% 74 2763 0.01% 75 3113 0.01% 76 3423 0.02% 77 3819 0.02% 78 4513 0.02% 79 4949 0.02% 80 5388 0.02% 81 6336 0.03% 82 7377 0.03% 83 8034 0.04% 84 9934 0.04% 85 11085 0.05% 86 11946 0.05% 87 13100 0.06% 88 13857 0.06% 89 15064 0.07% 90 15659 0.07% 91 17445 0.08% 92 18723 0.08% 93 19381 0.09% 94 20806 0.09% 95 21950 0.10% 96 22841 0.10% 97 24391 0.11% 98 25590 0.11% 99 27892 0.12% 100 29208 0.13% 101 31704 0.14% 102 32095 0.14% 103 32946 0.15% 104 34586 0.15% 105 36670 0.16% 106 38018 0.17% 107 38437 0.17% 108 40217 0.18% 109 41506 0.18% 110 42736 0.19% 111 45345 0.20% 112 48433 0.21% 113 49524 0.22% 114 52131 0.23% 115 53441 0.24% 116 54670 0.24% 117 56225 0.25% 118 57094 0.25% 119 58697 0.26% 120 61621 0.27% 121 63322 0.28% 122 66136 0.29% 123 68867 0.30% 124 71959 0.32% 125 74083 0.33% 126 76939 0.34% 127 78298 0.35% 128 79430 0.35% 129 81951 0.36% 130 83491 0.37% 131 86556 0.38% 132 91526 0.41% 133 96159 0.43% 134 99608 0.44% 135 104882 0.46% 136 109012 0.48% 137 114445 0.51% 138 119060 0.53% 139 125371 0.55% 140 133119 0.59% 141 144174 0.64% 142 158315 0.70% 143 172444 0.76% 144 198056 0.88% 145 232765 1.03% 146 289036 1.28% 147 368233 1.63% 148 550725 2.44% 149 1075369 4.76% 150 5451009 24.12% 151 10835687 47.95% 22597578 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=31.17 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=CTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=16 prefix-density=0.59 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=122.86 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579206 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:10:00 Started mapping on | Dec 09 22:10:00 Finished on | Dec 09 22:14:06 Mapping speed, Million of reads per hour | 330.70 Number of input reads | 22597578 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21239042 Uniquely mapped reads % | 93.99% Average mapped length | 291.84 Number of splices: Total | 23823628 Number of splices: Annotated (sjdb) | 22448280 Number of splices: GT/AG | 23507219 Number of splices: GC/AG | 289058 Number of splices: AT/AC | 12673 Number of splices: Non-canonical | 14678 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333248 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 41873 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1051883 1051883 1051883 N_multimapping 333248 333248 333248 N_noFeature 874143 20622888 1090848 N_ambiguous 477606 3648 78586 UnstrandedReadsAssigned:19887293 PositiveStrandReadsAssigned:612506 NegativeStrandReadsAssigned:20069608 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5579206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579206-trimmed-pair1.fastq SRR5579206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,597,578 reads, 20,250,704 reads pseudoaligned [quant] estimated average fragment length: 265.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR5579206.ke.tsv 35125 SRR5579206.se.tsv 88098 total ==> SRR5579206.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.918 0 0 PNS24247 1044 779.082 57.5672 5.34773 PNS24249 1928 1663.08 57.1896 2.48874 PNS24246 1044 779.082 57.5672 5.34773 PNS24248 1044 779.082 57.5672 5.34773 PNS24244 1471 1206.08 149.109 8.94753 PNS24243 293 100.112 0 0 KQK14069 1603 1338.08 3277.41 177.266 KQK14071 474 237.188 133.657 40.7828 ==> SRR5579206.se.tsv <== BRADI_1g14170v3 4019 BRADI_1g53295v3 181 BRADI_1g59795v3 521 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 3192 BRADI_1g74790v3 164 BRADI_1g09890v3 3 BRADI_1g77505v3 360 BRADI_1g48960v3 0 SRR5579206 completed mapping pipeline successfully