Starting /dee2/code/volunteer_pipeline.sh SRR5579207 current disk space = 1522502377472 free memory = 1562142976 SRR5579207 SRAfilesize ba88497c6939d4e4775f371394518bd4 SRR5579207.sra SRR5579207.sra file validated SRR5579207 is paired end SRR5579207 is conventional basespace SRR5579207 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.511 34.0 33.0 34.0 2.0 34.0 2 32.4 34.0 33.0 34.0 28.0 34.0 3 32.667 34.0 33.0 34.0 28.0 34.0 4 33.0825 34.0 33.0 34.0 32.0 34.0 5 33.172 34.0 33.0 34.0 32.0 34.0 6 36.96625 38.0 37.0 38.0 36.0 38.0 7 37.23625 38.0 38.0 38.0 36.0 38.0 8 37.42725 38.0 38.0 38.0 37.0 38.0 9 37.41925 38.0 38.0 38.0 37.0 38.0 10-14 37.38824999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.4279 38.0 38.0 38.0 37.2 38.0 20-24 37.40995 38.0 38.0 38.0 37.4 38.0 25-29 37.43634999999999 38.0 38.0 38.0 37.4 38.0 30-34 37.342 38.0 38.0 38.0 37.0 38.0 35-39 37.27745 38.0 38.0 38.0 36.8 38.0 40-44 37.137100000000004 38.0 38.0 38.0 36.0 38.0 45-49 37.046299999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.0543 38.0 38.0 38.0 36.0 38.0 55-59 36.9936 38.0 38.0 38.0 35.8 38.0 60-64 36.9779 38.0 38.0 38.0 35.8 38.0 65-69 36.8988 38.0 38.0 38.0 35.2 38.0 70-74 36.86965 38.0 38.0 38.0 35.0 38.0 75-79 36.7646 38.0 38.0 38.0 35.0 38.0 80-84 36.6882 38.0 38.0 38.0 34.4 38.0 85-89 36.628 38.0 38.0 38.0 34.6 38.0 90-94 36.47475 38.0 38.0 38.0 34.0 38.0 95-99 36.482350000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.23815 38.0 38.0 38.0 34.0 38.0 105-109 36.13355 38.0 38.0 38.0 33.6 38.0 110-114 36.01595 38.0 38.0 38.0 33.0 38.0 115-119 35.82185 38.0 37.2 38.0 32.6 38.0 120-124 35.56305 38.0 36.2 38.0 31.2 38.0 125-129 35.41155 38.0 36.0 38.0 30.6 38.0 130-134 35.2213 38.0 36.0 38.0 30.2 38.0 135-139 35.111000000000004 38.0 36.0 38.0 29.2 38.0 140-144 34.67505 38.0 35.4 38.0 27.0 38.0 145-149 34.00205 38.0 35.0 38.0 24.2 38.0 150-151 30.800875 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 3.0 16 3.0 17 5.0 18 7.0 19 5.0 20 6.0 21 5.0 22 7.0 23 9.0 24 9.0 25 11.0 26 16.0 27 27.0 28 22.0 29 38.0 30 52.0 31 60.0 32 76.0 33 96.0 34 147.0 35 238.0 36 577.0 37 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.862231380629964 12.952605239917576 10.685899322931999 32.49926405652046 2 24.15 18.9 32.425 24.525 3 23.65 24.8 22.925 28.625 4 27.950000000000003 31.175000000000004 19.5 21.375 5 26.05 32.125 21.45 20.375 6 21.375 33.95 22.825 21.85 7 17.549999999999997 19.925 40.75 21.775 8 20.225 20.25 28.475 31.05 9 20.549999999999997 20.025000000000002 30.075000000000003 29.349999999999998 10-14 24.195 26.314999999999998 23.23 26.26 15-19 24.33 25.345000000000002 24.355 25.97 20-24 24.044999999999998 25.05 24.615000000000002 26.290000000000003 25-29 24.295 25.180000000000003 24.310000000000002 26.215 30-34 24.84 25.385 24.04 25.735000000000003 35-39 24.765 25.14 24.505 25.590000000000003 40-44 24.44 24.905 24.065 26.590000000000003 45-49 24.605 24.51 24.560000000000002 26.325 50-54 24.605 24.73 24.075 26.590000000000003 55-59 24.66 25.040000000000003 23.665 26.634999999999998 60-64 24.665 24.815 23.885 26.634999999999998 65-69 24.965 24.65 23.965 26.419999999999998 70-74 25.014999999999997 25.205 23.965 25.814999999999998 75-79 25.455 24.435000000000002 24.075 26.035000000000004 80-84 24.845 24.88 24.285 25.990000000000002 85-89 25.374999999999996 24.48 23.669999999999998 26.474999999999998 90-94 25.095 24.59 24.185000000000002 26.13 95-99 25.165 24.349999999999998 23.72 26.765 100-104 25.645 24.565 23.380000000000003 26.41 105-109 25.415 24.315 23.82 26.450000000000003 110-114 25.61 24.575 23.47 26.345000000000002 115-119 25.2 24.745 23.44 26.615 120-124 25.6 24.285 23.235 26.88 125-129 25.919999999999998 24.085 23.28 26.715 130-134 25.46 24.715 22.805 27.02 135-139 25.779999999999998 24.97 22.66 26.590000000000003 140-144 26.169999999999998 23.810000000000002 22.68 27.339999999999996 145-149 25.580000000000002 24.435000000000002 23.115 26.87 150-151 26.400000000000002 24.25 22.525000000000002 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 3.0 28 5.0 29 4.5 30 6.0 31 6.0 32 13.5 33 21.5 34 23.5 35 35.5 36 51.0 37 67.5 38 82.5 39 106.0 40 131.5 41 144.0 42 137.0 43 153.0 44 175.0 45 167.5 46 179.0 47 166.5 48 151.0 49 150.5 50 137.5 51 119.5 52 106.5 53 111.0 54 104.0 55 94.0 56 91.5 57 95.5 58 93.5 59 86.0 60 95.5 61 98.5 62 87.0 63 78.5 64 78.0 65 90.5 66 82.5 67 64.0 68 61.5 69 57.0 70 44.0 71 30.0 72 30.0 73 28.0 74 21.5 75 15.0 76 7.0 77 3.5 78 2.0 79 1.0 80 0.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93858984078847 97.875 2 1.0361384887541065 2.0500000000000003 3 0.025271670457417232 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.5125 0.0 0.0 0.0 0.0 92-93 1.6375 0.0 0.0 0.0 0.0 94-95 2.0625 0.0 0.0 0.0 0.0 96-97 2.3875 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.1624999999999996 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 4.075 0.0 0.0 0.0 0.0 106-107 4.7625 0.0 0.0 0.0 0.0 108-109 5.362500000000001 0.0 0.0 0.0 0.0 110-111 5.9625 0.0 0.0 0.0 0.0 112-113 6.525 0.0 0.0 0.0 0.0 114-115 7.2 0.0 0.0 0.0 0.0 116-117 8.025 0.0 0.0 0.0 0.0 118-119 8.662500000000001 0.0 0.0 0.0 0.0 120-121 9.4875 0.0 0.0 0.0 0.0 122-123 10.100000000000001 0.0 0.0 0.0 0.0 124-125 10.8125 0.0 0.0 0.0 0.0 126-127 11.412500000000001 0.0 0.0 0.0 0.0 128-129 12.1625 0.0 0.0 0.0 0.0 130-131 13.05 0.0 0.0 0.0 0.0 132-133 13.9375 0.0 0.0 0.0 0.0 134-135 14.725000000000001 0.0 0.0 0.0 0.0 136-137 15.7375 0.0 0.0 0.0 0.0 138-139 16.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGCTG 10 0.0068519996 144.85 2 AAGTTGG 10 0.0068519996 144.85 9 >>END_MODULE SRR5579207 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579207_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.676 33.0 33.0 34.0 32.0 34.0 2 32.8065 34.0 33.0 34.0 32.0 34.0 3 32.75225 34.0 33.0 34.0 32.0 34.0 4 32.6875 34.0 33.0 34.0 32.0 34.0 5 32.73725 34.0 33.0 34.0 32.0 34.0 6 36.7785 38.0 38.0 38.0 36.0 38.0 7 36.84475 38.0 38.0 38.0 36.0 38.0 8 36.786 38.0 38.0 38.0 36.0 38.0 9 36.699 38.0 38.0 38.0 36.0 38.0 10-14 36.73885 38.0 38.0 38.0 36.0 38.0 15-19 36.66685 38.0 38.0 38.0 35.8 38.0 20-24 36.67954999999999 38.0 38.0 38.0 35.8 38.0 25-29 36.748000000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.6809 38.0 38.0 38.0 36.0 38.0 35-39 36.6771 38.0 38.0 38.0 36.0 38.0 40-44 36.69265 38.0 38.0 38.0 35.8 38.0 45-49 36.5938 38.0 38.0 38.0 35.6 38.0 50-54 36.55775 38.0 38.0 38.0 35.8 38.0 55-59 36.52695 38.0 38.0 38.0 35.0 38.0 60-64 36.4546 38.0 38.0 38.0 34.8 38.0 65-69 36.4173 38.0 38.0 38.0 34.8 38.0 70-74 36.357749999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.291250000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.2469 38.0 38.0 38.0 34.0 38.0 85-89 36.1768 38.0 38.0 38.0 34.0 38.0 90-94 36.02745 38.0 38.0 38.0 33.4 38.0 95-99 35.97835 38.0 38.0 38.0 33.4 38.0 100-104 35.732 38.0 38.0 38.0 32.4 38.0 105-109 35.648799999999994 38.0 38.0 38.0 32.8 38.0 110-114 35.479049999999994 38.0 38.0 38.0 31.6 38.0 115-119 35.2702 38.0 37.2 38.0 30.6 38.0 120-124 35.067750000000004 38.0 36.4 38.0 29.0 38.0 125-129 34.78099999999999 38.0 36.0 38.0 27.8 38.0 130-134 34.45335 38.0 35.8 38.0 25.4 38.0 135-139 33.990449999999996 38.0 35.0 38.0 22.6 38.0 140-144 33.3181 38.0 33.2 38.0 17.0 38.0 145-149 32.0963 38.0 33.0 38.0 8.0 38.0 150-151 27.153750000000002 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 11.0 4 4.0 5 1.0 6 5.0 7 5.0 8 0.0 9 1.0 10 2.0 11 1.0 12 3.0 13 7.0 14 7.0 15 6.0 16 8.0 17 4.0 18 5.0 19 8.0 20 11.0 21 4.0 22 10.0 23 16.0 24 23.0 25 28.0 26 21.0 27 26.0 28 37.0 29 38.0 30 56.0 31 62.0 32 73.0 33 96.0 34 141.0 35 234.0 36 522.0 37 2508.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.65 13.975000000000001 12.174999999999999 29.2 2 28.349999999999998 20.8 27.500000000000004 23.35 3 25.4 23.674999999999997 25.35 25.575 4 29.925 30.9 17.424999999999997 21.75 5 28.15 32.6 18.2 21.05 6 22.025 34.35 18.55 25.074999999999996 7 22.075 16.025 35.175 26.724999999999998 8 22.075 20.549999999999997 22.3 35.075 9 24.575 21.45 24.025 29.95 10-14 26.669999999999998 24.465 22.305 26.56 15-19 26.669999999999998 24.235 22.68 26.415 20-24 27.084999999999997 23.525 23.095 26.295 25-29 27.215 23.93 22.595000000000002 26.26 30-34 26.784999999999997 23.919999999999998 22.74 26.555 35-39 26.334999999999997 23.84 23.255 26.57 40-44 27.73 23.855 22.470000000000002 25.945 45-49 27.034999999999997 23.549999999999997 23.505000000000003 25.91 50-54 26.87 24.055 23.145 25.929999999999996 55-59 26.815 23.665 23.61 25.91 60-64 27.21 23.41 23.47 25.91 65-69 27.084999999999997 23.685000000000002 23.615 25.615 70-74 27.125 23.905 22.795 26.174999999999997 75-79 26.645000000000003 23.96 23.595 25.8 80-84 26.565 24.075 23.635 25.724999999999998 85-89 26.455000000000002 23.724999999999998 23.715 26.105 90-94 27.284999999999997 23.945 23.685000000000002 25.085 95-99 27.13 24.09 23.645 25.135 100-104 26.790000000000003 24.75 23.405 25.055 105-109 27.67 24.05 23.28 25.0 110-114 27.665 24.959999999999997 22.835 24.54 115-119 27.57 24.485 23.380000000000003 24.565 120-124 27.82 24.635 23.175 24.37 125-129 27.955000000000002 24.75 23.54 23.755000000000003 130-134 28.410000000000004 24.834999999999997 22.994999999999997 23.76 135-139 28.205000000000002 25.564999999999998 23.315 22.915 140-144 28.82 25.665 22.615 22.900000000000002 145-149 28.299999999999997 25.074999999999996 23.87 22.755 150-151 30.075000000000003 25.575 22.287499999999998 22.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 0.5 30 6.0 31 10.5 32 10.0 33 11.0 34 15.0 35 18.5 36 25.5 37 43.5 38 63.5 39 71.5 40 74.0 41 90.0 42 112.0 43 125.0 44 151.0 45 164.5 46 157.5 47 164.5 48 153.5 49 140.5 50 145.0 51 136.0 52 120.0 53 128.0 54 128.5 55 111.5 56 100.5 57 93.5 58 99.0 59 109.5 60 113.0 61 110.5 62 109.5 63 100.0 64 88.0 65 90.0 66 88.0 67 90.0 68 82.0 69 70.0 70 66.5 71 49.5 72 39.0 73 35.5 74 25.5 75 23.0 76 20.0 77 7.0 78 3.0 79 3.5 80 2.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42319430315362 96.75 2 1.449643947100712 2.85 3 0.10172939979654119 0.3 4 0.025432349949135298 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.9125 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.2 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 90-91 1.5375 0.0 0.0 0.0 0.0 92-93 1.65 0.0 0.0 0.0 0.0 94-95 2.05 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.1375 0.0 0.0 0.0 0.0 102-103 3.5 0.0 0.0 0.0 0.0 104-105 4.0125 0.0 0.0 0.0 0.0 106-107 4.675000000000001 0.0 0.0 0.0 0.0 108-109 5.2875 0.0 0.0 0.0 0.0 110-111 5.85 0.0 0.0 0.0 0.0 112-113 6.4375 0.0 0.0 0.0 0.0 114-115 7.125 0.0 0.0 0.0 0.0 116-117 7.9375 0.0 0.0 0.0 0.0 118-119 8.5625 0.0 0.0 0.0 0.0 120-121 9.3625 0.0 0.0 0.0 0.0 122-123 9.95 0.0 0.0 0.0 0.0 124-125 10.675 0.0 0.0 0.0 0.0 126-127 11.275 0.0 0.0 0.0 0.0 128-129 12.0375 0.0 0.0 0.0 0.0 130-131 12.9 0.0 0.0 0.0 0.0 132-133 13.850000000000001 0.0 0.0 0.0 0.0 134-135 14.649999999999999 0.0 0.0 0.0 0.0 136-137 15.675 0.0 0.0 0.0 0.0 138-139 16.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464494 spots for SRR5579207.sra Written 1464494 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra Read 1464493 spots for SRR5579207.sra Written 1464493 spots for SRR5579207.sra SRR ids: ['SRR5579207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ziv9o23s SRR5579207.sra spots: 29289861 blocks: [[1, 1464493], [1464494, 2928986], [2928987, 4393479], [4393480, 5857972], [5857973, 7322465], [7322466, 8786958], [8786959, 10251451], [10251452, 11715944], [11715945, 13180437], [13180438, 14644930], [14644931, 16109423], [16109424, 17573916], [17573917, 19038409], [19038410, 20502902], [20502903, 21967395], [21967396, 23431888], [23431889, 24896381], [24896382, 26360874], [26360875, 27825367], [27825368, 29289861]] SRR5579207 file size 9903672 SRR5579207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579207 SRR5579207_1.fastq SRR5579207_2.fastq Input file: SRR5579207_1.fastq Paired file: SRR5579207_2.fastq trimmed: SRR5579207-trimmed-pair1.fastq, SRR5579207-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:11:08 2024 >> started Mon Dec 9 22:11:39 2024 >> done (31.533s) 29289861 read pairs processed; of these: 66591 ( 0.23%) short read pairs filtered out after trimming by size control 95338 ( 0.33%) empty read pairs filtered out after trimming by size control 29127932 (99.45%) read pairs available; of these: 15118791 (51.90%) trimmed read pairs available after processing 14009141 (48.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 16 0.00% 21 17 0.00% 22 13 0.00% 23 17 0.00% 24 24 0.00% 25 24 0.00% 26 20 0.00% 27 27 0.00% 28 22 0.00% 29 48 0.00% 30 41 0.00% 31 46 0.00% 32 55 0.00% 33 57 0.00% 34 60 0.00% 35 83 0.00% 36 100 0.00% 37 106 0.00% 38 110 0.00% 39 153 0.00% 40 179 0.00% 41 176 0.00% 42 212 0.00% 43 244 0.00% 44 270 0.00% 45 320 0.00% 46 375 0.00% 47 433 0.00% 48 566 0.00% 49 652 0.00% 50 742 0.00% 51 860 0.00% 52 898 0.00% 53 910 0.00% 54 1057 0.00% 55 1190 0.00% 56 1372 0.00% 57 1603 0.01% 58 1891 0.01% 59 2106 0.01% 60 2417 0.01% 61 2660 0.01% 62 3103 0.01% 63 3397 0.01% 64 3707 0.01% 65 4078 0.01% 66 4666 0.02% 67 5420 0.02% 68 6439 0.02% 69 8014 0.03% 70 8736 0.03% 71 9018 0.03% 72 10158 0.03% 73 10988 0.04% 74 11945 0.04% 75 13098 0.04% 76 14296 0.05% 77 15792 0.05% 78 17456 0.06% 79 19445 0.07% 80 21480 0.07% 81 24560 0.08% 82 26982 0.09% 83 29524 0.10% 84 33884 0.12% 85 37195 0.13% 86 38076 0.13% 87 40857 0.14% 88 43822 0.15% 89 45665 0.16% 90 48387 0.17% 91 52519 0.18% 92 55970 0.19% 93 59630 0.20% 94 62484 0.21% 95 64579 0.22% 96 67069 0.23% 97 69257 0.24% 98 70559 0.24% 99 74432 0.26% 100 76546 0.26% 101 80281 0.28% 102 85280 0.29% 103 87888 0.30% 104 90724 0.31% 105 92850 0.32% 106 95732 0.33% 107 95272 0.33% 108 98044 0.34% 109 100533 0.35% 110 102356 0.35% 111 106090 0.36% 112 110752 0.38% 113 113366 0.39% 114 117267 0.40% 115 120152 0.41% 116 120807 0.41% 117 121631 0.42% 118 121309 0.42% 119 123280 0.42% 120 126753 0.44% 121 128478 0.44% 122 130759 0.45% 123 136465 0.47% 124 140881 0.48% 125 144055 0.49% 126 145398 0.50% 127 144995 0.50% 128 145498 0.50% 129 146806 0.50% 130 148271 0.51% 131 151329 0.52% 132 156879 0.54% 133 161521 0.55% 134 165201 0.57% 135 170533 0.59% 136 173261 0.59% 137 176094 0.60% 138 178858 0.61% 139 183292 0.63% 140 187071 0.64% 141 195524 0.67% 142 205832 0.71% 143 219727 0.75% 144 239360 0.82% 145 269929 0.93% 146 311790 1.07% 147 385235 1.32% 148 550565 1.89% 149 970310 3.33% 150 5309078 18.23% 151 14009141 48.10% 29127932 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=31 prefix-density=0.90 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.53 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TTCAAAATCTGACAATCTTTTGTTCATAAGATCCTCGTAATTAATTTACATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.97 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5579207 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:12:25 Started mapping on | Dec 09 22:12:25 Finished on | Dec 09 22:16:20 Mapping speed, Million of reads per hour | 446.22 Number of input reads | 29127932 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 26971821 Uniquely mapped reads % | 92.60% Average mapped length | 284.97 Number of splices: Total | 23823255 Number of splices: Annotated (sjdb) | 22519946 Number of splices: GT/AG | 23526348 Number of splices: GC/AG | 270687 Number of splices: AT/AC | 10107 Number of splices: Non-canonical | 16113 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445321 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 80238 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1746226 1746226 1746226 N_multimapping 445321 445321 445321 N_noFeature 744411 26099351 1001623 N_ambiguous 714767 3270 100185 UnstrandedReadsAssigned:25512643 PositiveStrandReadsAssigned:869200 NegativeStrandReadsAssigned:25870013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR5579207 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579207-trimmed-pair1.fastq SRR5579207-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,127,932 reads, 26,029,814 reads pseudoaligned [quant] estimated average fragment length: 222.576 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR5579207.ke.tsv 35125 SRR5579207.se.tsv 88098 total ==> SRR5579207.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.817 6.2337e-06 4.16322e-07 PNS24247 1044 822.424 33.0868 1.9206 PNS24249 1928 1706.42 63.4302 1.77455 PNS24246 1044 822.424 33.0868 1.9206 PNS24248 1044 822.424 33.0868 1.9206 PNS24244 1471 1249.42 229.309 8.76174 PNS24243 293 115.242 0 0 KQK14069 1603 1381.42 7270.15 251.243 KQK14071 474 265.615 171.793 30.8767 ==> SRR5579207.se.tsv <== BRADI_1g14170v3 7996 BRADI_1g53295v3 61 BRADI_1g59795v3 680 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 2572 BRADI_1g74790v3 129 BRADI_1g09890v3 10 BRADI_1g77505v3 476 BRADI_1g48960v3 1 SRR5579207 completed mapping pipeline successfully