Starting /dee2/code/volunteer_pipeline.sh SRR5579208 current disk space = 1522716606464 free memory = 1568802536 SRR5579208 SRAfilesize 3dac3d60497d941201e84ef38447b32b SRR5579208.sra SRR5579208.sra file validated SRR5579208 is paired end SRR5579208 is conventional basespace SRR5579208 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579208_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.80875 34.0 33.0 34.0 2.0 34.0 2 32.47275 34.0 33.0 34.0 28.0 34.0 3 32.72375 34.0 33.0 34.0 28.0 34.0 4 33.11675 34.0 33.0 34.0 32.0 34.0 5 33.20425 34.0 33.0 34.0 32.0 34.0 6 37.0355 38.0 37.0 38.0 36.0 38.0 7 37.272 38.0 38.0 38.0 36.0 38.0 8 37.39425 38.0 38.0 38.0 37.0 38.0 9 37.41175 38.0 38.0 38.0 37.0 38.0 10-14 37.4277 38.0 38.0 38.0 37.0 38.0 15-19 37.39295 38.0 38.0 38.0 37.0 38.0 20-24 37.3861 38.0 38.0 38.0 37.0 38.0 25-29 37.361850000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3381 38.0 38.0 38.0 37.0 38.0 35-39 37.26715 38.0 38.0 38.0 37.0 38.0 40-44 37.0936 38.0 38.0 38.0 36.0 38.0 45-49 37.016299999999994 38.0 38.0 38.0 36.0 38.0 50-54 37.0056 38.0 38.0 38.0 36.0 38.0 55-59 36.940599999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.96895 38.0 38.0 38.0 35.6 38.0 65-69 36.848699999999994 38.0 38.0 38.0 35.0 38.0 70-74 36.83865 38.0 38.0 38.0 35.0 38.0 75-79 36.76605 38.0 38.0 38.0 35.0 38.0 80-84 36.658550000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.616249999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.511 38.0 38.0 38.0 34.0 38.0 95-99 36.44465 38.0 38.0 38.0 34.0 38.0 100-104 36.27535 38.0 37.6 38.0 33.6 38.0 105-109 36.224000000000004 38.0 37.6 38.0 33.6 38.0 110-114 35.9834 38.0 37.0 38.0 32.6 38.0 115-119 35.926300000000005 38.0 37.0 38.0 32.4 38.0 120-124 35.643950000000004 38.0 36.2 38.0 31.2 38.0 125-129 35.373850000000004 38.0 36.0 38.0 30.0 38.0 130-134 35.36535 38.0 36.0 38.0 31.0 38.0 135-139 35.057950000000005 38.0 35.2 38.0 28.8 38.0 140-144 34.647149999999996 38.0 35.0 38.0 27.2 38.0 145-149 34.17495 38.0 35.0 38.0 25.6 38.0 150-151 30.79375 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 1.0 20 4.0 21 7.0 22 5.0 23 10.0 24 13.0 25 17.0 26 11.0 27 15.0 28 36.0 29 41.0 30 56.0 31 63.0 32 70.0 33 110.0 34 167.0 35 254.0 36 665.0 37 2445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.14992721979622 14.759825327510917 7.685589519650655 26.404657933042213 2 23.474999999999998 19.400000000000002 34.9 22.225 3 22.125 26.150000000000002 24.45 27.275 4 27.725 30.575000000000003 20.225 21.475 5 25.05 32.45 22.925 19.575 6 20.025000000000002 33.475 23.974999999999998 22.525000000000002 7 18.05 19.25 40.150000000000006 22.55 8 19.55 21.15 26.875 32.425 9 22.5 19.775000000000002 29.825000000000003 27.900000000000002 10-14 23.59 25.759999999999998 24.25 26.400000000000002 15-19 24.02 24.965 25.185000000000002 25.83 20-24 23.505000000000003 25.314999999999998 25.974999999999998 25.205 25-29 24.0 25.47 25.21 25.319999999999997 30-34 24.13 24.63 24.89 26.35 35-39 24.154999999999998 24.63 25.014999999999997 26.200000000000003 40-44 23.525 25.55 24.875 26.05 45-49 24.03 25.009999999999998 25.135 25.825 50-54 23.705000000000002 25.135 24.77 26.39 55-59 24.185000000000002 25.380000000000003 24.779999999999998 25.655 60-64 24.215 24.29 25.4 26.095000000000002 65-69 23.79 25.185000000000002 24.915000000000003 26.11 70-74 24.490000000000002 25.224999999999998 24.535 25.75 75-79 23.830000000000002 24.845 24.435000000000002 26.889999999999997 80-84 24.39 24.545 25.105 25.96 85-89 24.36 25.255 24.45 25.935000000000002 90-94 24.79 24.345 25.035 25.83 95-99 24.695 24.735 24.455 26.115 100-104 25.005 25.46 24.07 25.465 105-109 24.7 25.295 24.12 25.885 110-114 24.82 24.865000000000002 24.18 26.135 115-119 24.515 24.36 24.825 26.3 120-124 24.895 25.195 24.060000000000002 25.85 125-129 23.98 25.195 24.32 26.505000000000003 130-134 24.995 24.86 24.22 25.924999999999997 135-139 24.33 25.064999999999998 24.375 26.229999999999997 140-144 24.295 25.39 24.43 25.885 145-149 24.37 25.259999999999998 24.055 26.314999999999998 150-151 25.174999999999997 26.337500000000002 22.900000000000002 25.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 1.5 28 3.5 29 6.5 30 9.5 31 12.0 32 12.5 33 14.5 34 25.0 35 41.0 36 52.5 37 63.5 38 86.0 39 107.0 40 127.0 41 146.0 42 163.0 43 167.0 44 165.5 45 178.5 46 190.0 47 196.5 48 191.5 49 153.0 50 132.0 51 142.0 52 129.0 53 109.5 54 104.0 55 103.5 56 88.5 57 85.5 58 87.0 59 86.5 60 92.5 61 94.5 62 87.0 63 76.0 64 69.0 65 59.5 66 51.0 67 44.0 68 43.0 69 40.5 70 34.5 71 30.0 72 25.0 73 18.5 74 14.0 75 11.0 76 10.0 77 6.5 78 2.5 79 2.0 80 1.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.124999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.5249999999999999 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.725 0.0 0.0 0.0 0.0 98-99 2.0999999999999996 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.75 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.4124999999999996 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.575 0.0 0.0 0.0 0.0 114-115 5.0125 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 5.8625 0.0 0.0 0.0 0.0 120-121 6.3875 0.0 0.0 0.0 0.0 122-123 7.0 0.0 0.0 0.0 0.0 124-125 7.5375 0.0 0.0 0.0 0.0 126-127 8.05 0.0 0.0 0.0 0.0 128-129 8.6 0.0 0.0 0.0 0.0 130-131 9.2625 0.0 0.0 0.0 0.0 132-133 9.7875 0.0 0.0 0.0 0.0125 134-135 10.3625 0.0 0.0 0.0 0.025 136-137 11.037500000000001 0.0 0.0 0.0 0.025 138-139 11.7125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTTGC 10 0.0068519996 144.85 4 >>END_MODULE SRR5579208 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579208_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6595 33.0 33.0 34.0 32.0 34.0 2 32.81725 33.0 33.0 34.0 32.0 34.0 3 32.7955 34.0 33.0 34.0 32.0 34.0 4 32.7655 34.0 33.0 34.0 32.0 34.0 5 32.74975 34.0 33.0 34.0 32.0 34.0 6 36.8815 38.0 38.0 38.0 36.0 38.0 7 36.84725 38.0 38.0 38.0 36.0 38.0 8 36.824 38.0 38.0 38.0 36.0 38.0 9 36.87825 38.0 38.0 38.0 36.0 38.0 10-14 36.877050000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.8939 38.0 38.0 38.0 36.0 38.0 20-24 36.802049999999994 38.0 38.0 38.0 35.8 38.0 25-29 36.775299999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.82234999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.7291 38.0 38.0 38.0 35.4 38.0 40-44 36.739549999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.6776 38.0 38.0 38.0 35.6 38.0 50-54 36.59545 38.0 38.0 38.0 35.0 38.0 55-59 36.6085 38.0 38.0 38.0 35.0 38.0 60-64 36.58069999999999 38.0 38.0 38.0 35.0 38.0 65-69 36.507250000000006 38.0 38.0 38.0 34.8 38.0 70-74 36.4075 38.0 38.0 38.0 34.2 38.0 75-79 36.381150000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.385799999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.21325 38.0 38.0 38.0 34.0 38.0 90-94 35.6091 38.0 37.2 38.0 30.2 38.0 95-99 35.90885000000001 38.0 38.0 38.0 33.0 38.0 100-104 35.692899999999995 38.0 37.6 38.0 31.8 38.0 105-109 35.66265 38.0 37.8 38.0 31.6 38.0 110-114 35.6091 38.0 37.2 38.0 31.2 38.0 115-119 35.4637 38.0 37.2 38.0 31.0 38.0 120-124 35.169200000000004 38.0 36.4 38.0 29.2 38.0 125-129 34.9944 38.0 36.0 38.0 28.6 38.0 130-134 34.7406 38.0 35.8 38.0 27.6 38.0 135-139 34.222500000000004 38.0 35.2 38.0 24.2 38.0 140-144 33.649649999999994 38.0 35.0 38.0 18.6 38.0 145-149 32.8291 38.0 33.4 38.0 11.2 38.0 150-151 28.557125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 1.0 6 2.0 7 2.0 8 3.0 9 1.0 10 3.0 11 2.0 12 2.0 13 6.0 14 2.0 15 6.0 16 5.0 17 7.0 18 9.0 19 2.0 20 9.0 21 17.0 22 12.0 23 15.0 24 12.0 25 28.0 26 26.0 27 31.0 28 35.0 29 32.0 30 53.0 31 69.0 32 84.0 33 110.0 34 136.0 35 245.0 36 540.0 37 2477.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.375 15.475 8.450000000000001 26.700000000000003 2 27.200000000000003 21.675 28.4 22.725 3 24.05 24.349999999999998 26.6 25.0 4 28.349999999999998 33.0 17.075000000000003 21.575 5 25.674999999999997 35.25 18.224999999999998 20.849999999999998 6 22.6 33.475 19.525000000000002 24.4 7 22.2 14.875 37.375 25.55 8 22.6 20.525 22.8 34.075 9 23.400000000000002 20.825 25.35 30.425 10-14 25.919999999999998 25.365 22.82 25.895000000000003 15-19 26.450000000000003 24.59 23.815 25.145 20-24 25.715 25.180000000000003 23.735 25.369999999999997 25-29 26.21 24.52 24.285 24.985 30-34 25.52 24.759999999999998 24.34 25.380000000000003 35-39 26.125 25.005 24.01 24.86 40-44 26.395000000000003 24.310000000000002 23.945 25.35 45-49 27.13 24.435000000000002 23.474999999999998 24.959999999999997 50-54 26.3 24.375 23.674999999999997 25.650000000000002 55-59 25.83 24.435000000000002 24.104999999999997 25.629999999999995 60-64 25.85 24.349999999999998 24.25 25.55 65-69 25.945 24.63 24.195 25.230000000000004 70-74 26.290000000000003 24.45 24.05 25.21 75-79 26.075 24.095 24.33 25.5 80-84 25.919999999999998 24.62 24.43 25.03 85-89 26.345000000000002 24.39 24.62 24.645 90-94 26.77 24.740000000000002 23.905 24.585 95-99 26.6 24.845 24.02 24.535 100-104 26.435 25.665 23.715 24.185000000000002 105-109 26.450000000000003 24.834999999999997 24.044999999999998 24.67 110-114 27.08 25.324999999999996 23.485 24.11 115-119 27.045 25.295 23.59 24.07 120-124 27.465 24.895 24.055 23.585 125-129 27.26 24.89 24.279999999999998 23.57 130-134 27.284999999999997 25.165 24.38 23.169999999999998 135-139 27.689999999999998 25.255 23.845 23.21 140-144 27.555000000000003 25.215 24.415 22.814999999999998 145-149 28.155 25.56 23.724999999999998 22.56 150-151 28.0875 26.224999999999998 23.45 22.237499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 0.5 29 1.5 30 4.0 31 7.0 32 8.0 33 11.0 34 18.5 35 31.0 36 39.0 37 41.0 38 61.0 39 94.0 40 107.5 41 110.0 42 127.5 43 152.0 44 166.5 45 167.0 46 173.5 47 187.5 48 176.0 49 165.5 50 153.0 51 145.0 52 130.0 53 102.0 54 108.5 55 106.5 56 98.5 57 90.0 58 89.5 59 108.5 60 106.0 61 98.0 62 115.0 63 104.5 64 83.0 65 71.0 66 65.5 67 69.5 68 58.5 69 52.0 70 47.0 71 38.0 72 32.0 73 26.5 74 16.0 75 10.0 76 6.0 77 3.5 78 3.5 79 2.5 80 2.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0379746835443 97.8 2 0.8354430379746836 1.6500000000000001 3 0.0759493670886076 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.7 0.0 0.0 0.0 0.0 98-99 2.075 0.0 0.0 0.0 0.0 100-101 2.3375000000000004 0.0 0.0 0.0 0.0 102-103 2.725 0.0 0.0 0.0 0.0 104-105 2.9375 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.7875 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.050000000000001 0.0 0.0 0.0 0.0 116-117 5.4875 0.0 0.0 0.0 0.0 118-119 5.925000000000001 0.0 0.0 0.0 0.0 120-121 6.45 0.0 0.0 0.0 0.0 122-123 7.0375 0.0 0.0 0.0 0.0 124-125 7.6125 0.0 0.0 0.0 0.0 126-127 8.149999999999999 0.0 0.0 0.0 0.0 128-129 8.7 0.0 0.0 0.0 0.0 130-131 9.3875 0.0 0.0 0.0 0.0 132-133 9.9125 0.0 0.0 0.0 0.0 134-135 10.4875 0.0 0.0 0.0 0.0 136-137 11.2125 0.0 0.0 0.0 0.0 138-139 11.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCTTC 10 0.006830828 145.0 3 >>END_MODULE Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624675 spots for SRR5579208.sra Written 1624675 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra Read 1624663 spots for SRR5579208.sra Written 1624663 spots for SRR5579208.sra SRR ids: ['SRR5579208.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__g0hbbu5 SRR5579208.sra spots: 32493272 blocks: [[1, 1624663], [1624664, 3249326], [3249327, 4873989], [4873990, 6498652], [6498653, 8123315], [8123316, 9747978], [9747979, 11372641], [11372642, 12997304], [12997305, 14621967], [14621968, 16246630], [16246631, 17871293], [17871294, 19495956], [19495957, 21120619], [21120620, 22745282], [22745283, 24369945], [24369946, 25994608], [25994609, 27619271], [27619272, 29243934], [29243935, 30868597], [30868598, 32493272]] SRR5579208 file size 10989203 SRR5579208 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579208 SRR5579208_1.fastq SRR5579208_2.fastq Input file: SRR5579208_1.fastq Paired file: SRR5579208_2.fastq trimmed: SRR5579208-trimmed-pair1.fastq, SRR5579208-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:18:24 2024 >> started Mon Dec 9 22:19:03 2024 >> done (39.481s) 32493272 read pairs processed; of these: 60871 ( 0.19%) short read pairs filtered out after trimming by size control 45827 ( 0.14%) empty read pairs filtered out after trimming by size control 32386574 (99.67%) read pairs available; of these: 14518507 (44.83%) trimmed read pairs available after processing 17868067 (55.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 22 0.00% 20 24 0.00% 21 16 0.00% 22 29 0.00% 23 25 0.00% 24 29 0.00% 25 28 0.00% 26 35 0.00% 27 31 0.00% 28 39 0.00% 29 44 0.00% 30 46 0.00% 31 33 0.00% 32 47 0.00% 33 42 0.00% 34 49 0.00% 35 63 0.00% 36 59 0.00% 37 67 0.00% 38 83 0.00% 39 103 0.00% 40 105 0.00% 41 101 0.00% 42 129 0.00% 43 134 0.00% 44 138 0.00% 45 195 0.00% 46 203 0.00% 47 225 0.00% 48 252 0.00% 49 351 0.00% 50 382 0.00% 51 481 0.00% 52 496 0.00% 53 516 0.00% 54 547 0.00% 55 665 0.00% 56 726 0.00% 57 859 0.00% 58 942 0.00% 59 1124 0.00% 60 1305 0.00% 61 1550 0.00% 62 1682 0.01% 63 1920 0.01% 64 2104 0.01% 65 2171 0.01% 66 2642 0.01% 67 2877 0.01% 68 3227 0.01% 69 3846 0.01% 70 4625 0.01% 71 4993 0.02% 72 5743 0.02% 73 6399 0.02% 74 7074 0.02% 75 7726 0.02% 76 8545 0.03% 77 9459 0.03% 78 10435 0.03% 79 11616 0.04% 80 13221 0.04% 81 15123 0.05% 82 16800 0.05% 83 18451 0.06% 84 22714 0.07% 85 25266 0.08% 86 25821 0.08% 87 27934 0.09% 88 28976 0.09% 89 30762 0.09% 90 33103 0.10% 91 35858 0.11% 92 38584 0.12% 93 41798 0.13% 94 43515 0.13% 95 45014 0.14% 96 47051 0.15% 97 48834 0.15% 98 50286 0.16% 99 53790 0.17% 100 55436 0.17% 101 59209 0.18% 102 62734 0.19% 103 65719 0.20% 104 68343 0.21% 105 70756 0.22% 106 72567 0.22% 107 73451 0.23% 108 75778 0.23% 109 77248 0.24% 110 79796 0.25% 111 83502 0.26% 112 87644 0.27% 113 90016 0.28% 114 94485 0.29% 115 96877 0.30% 116 97650 0.30% 117 99849 0.31% 118 100040 0.31% 119 102654 0.32% 120 105689 0.33% 121 108290 0.33% 122 111605 0.34% 123 116408 0.36% 124 120804 0.37% 125 122699 0.38% 126 125710 0.39% 127 126596 0.39% 128 127350 0.39% 129 130271 0.40% 130 132077 0.41% 131 134643 0.42% 132 141393 0.44% 133 146686 0.45% 134 151033 0.47% 135 157616 0.49% 136 160201 0.49% 137 163154 0.50% 138 168483 0.52% 139 173611 0.54% 140 179456 0.55% 141 188221 0.58% 142 201154 0.62% 143 215511 0.67% 144 238048 0.74% 145 268469 0.83% 146 312314 0.96% 147 391585 1.21% 148 545745 1.69% 149 999380 3.09% 150 5868209 18.12% 151 17868067 55.17% 32386574 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.74 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.20 sequence-density-rank=25 fanout-score=12.81 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=7 prefix-density=0.88 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=80.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.3 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579208 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:19:48 Started mapping on | Dec 09 22:19:48 Finished on | Dec 09 22:23:25 Mapping speed, Million of reads per hour | 537.29 Number of input reads | 32386574 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 30724915 Uniquely mapped reads % | 94.87% Average mapped length | 289.53 Number of splices: Total | 32036270 Number of splices: Annotated (sjdb) | 30357959 Number of splices: GT/AG | 31620687 Number of splices: GC/AG | 376699 Number of splices: AT/AC | 15202 Number of splices: Non-canonical | 23682 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310226 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 12051 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1392339 1392339 1392339 N_multimapping 310226 310226 310226 N_noFeature 932707 29851602 1220379 N_ambiguous 685017 4022 100599 UnstrandedReadsAssigned:29107191 PositiveStrandReadsAssigned:869291 NegativeStrandReadsAssigned:29403937 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579208 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579208-trimmed-pair1.fastq SRR5579208-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,386,574 reads, 29,522,410 reads pseudoaligned [quant] estimated average fragment length: 242.011 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR5579208.ke.tsv 35125 SRR5579208.se.tsv 88098 total ==> SRR5579208.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.293 0 0 PNS24247 1044 802.989 83.5039 4.98307 PNS24249 1928 1686.99 126.964 3.60635 PNS24246 1044 802.989 83.5039 4.98307 PNS24248 1044 802.989 83.5039 4.98307 PNS24244 1471 1229.99 139.524 5.43561 PNS24243 293 106.372 1 0.450478 KQK14069 1603 1361.99 6268.71 220.549 KQK14071 474 251.584 183.512 34.9527 ==> SRR5579208.se.tsv <== BRADI_1g14170v3 7140 BRADI_1g53295v3 106 BRADI_1g59795v3 803 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 3645 BRADI_1g74790v3 100 BRADI_1g09890v3 2 BRADI_1g77505v3 390 BRADI_1g48960v3 0 SRR5579208 completed mapping pipeline successfully