Starting /dee2/code/volunteer_pipeline.sh SRR5579209 current disk space = 1522722893824 free memory = 1568309308 SRR5579209 SRAfilesize e4ededac225798c7cc543e05d087dc8d SRR5579209.sra SRR5579209.sra file validated SRR5579209 is paired end SRR5579209 is conventional basespace SRR5579209 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579209_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.65275 34.0 33.0 34.0 2.0 34.0 2 32.3465 34.0 33.0 34.0 28.0 34.0 3 32.635 34.0 33.0 34.0 28.0 34.0 4 33.08075 34.0 33.0 34.0 32.0 34.0 5 33.1565 34.0 33.0 34.0 32.0 34.0 6 36.878 38.0 37.0 38.0 35.0 38.0 7 37.0875 38.0 38.0 38.0 36.0 38.0 8 37.29275 38.0 38.0 38.0 37.0 38.0 9 37.343 38.0 38.0 38.0 37.0 38.0 10-14 37.42235 38.0 38.0 38.0 37.2 38.0 15-19 37.396049999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.374849999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.35594999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.30105 38.0 38.0 38.0 37.0 38.0 35-39 37.211549999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.054100000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.9841 38.0 38.0 38.0 35.6 38.0 50-54 36.899350000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.8609 38.0 38.0 38.0 35.0 38.0 60-64 36.8089 38.0 38.0 38.0 35.0 38.0 65-69 36.742599999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.636649999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.62285 38.0 38.0 38.0 34.0 38.0 80-84 36.54545 38.0 38.0 38.0 34.0 38.0 85-89 36.42385 38.0 38.0 38.0 33.8 38.0 90-94 36.239000000000004 38.0 37.8 38.0 33.6 38.0 95-99 36.1197 38.0 37.2 38.0 33.2 38.0 100-104 35.890750000000004 38.0 37.0 38.0 32.4 38.0 105-109 35.8673 38.0 37.0 38.0 32.4 38.0 110-114 35.701499999999996 38.0 36.4 38.0 31.2 38.0 115-119 35.52935 38.0 36.2 38.0 31.0 38.0 120-124 35.29705 38.0 36.0 38.0 29.8 38.0 125-129 35.0649 38.0 35.6 38.0 28.2 38.0 130-134 34.91175 38.0 35.0 38.0 28.0 38.0 135-139 34.662 38.0 35.0 38.0 27.0 38.0 140-144 34.19915 38.0 34.8 38.0 24.4 38.0 145-149 33.41605 38.0 34.2 38.0 20.4 38.0 150-151 29.564625 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 2.0 16 3.0 17 3.0 18 4.0 19 7.0 20 3.0 21 8.0 22 9.0 23 7.0 24 10.0 25 11.0 26 18.0 27 40.0 28 28.0 29 41.0 30 50.0 31 59.0 32 90.0 33 121.0 34 172.0 35 321.0 36 756.0 37 2230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.28872004675628 13.500876680303916 9.701928696668615 30.508474576271187 2 25.424999999999997 17.45 33.050000000000004 24.075 3 21.775 26.8 23.400000000000002 28.025 4 26.700000000000003 31.85 19.85 21.6 5 25.0 34.849999999999994 20.200000000000003 19.950000000000003 6 21.075 33.575 22.375 22.975 7 17.175 20.525 40.475 21.825 8 20.825 20.225 27.55 31.4 9 21.05 21.575 28.549999999999997 28.825 10-14 23.205000000000002 26.884999999999998 24.235 25.674999999999997 15-19 23.41 25.435000000000002 25.335 25.82 20-24 23.335 25.275 25.995 25.395 25-29 23.57 26.06 24.795 25.575 30-34 23.125 26.009999999999998 24.915000000000003 25.95 35-39 23.575 25.629999999999995 24.965 25.83 40-44 24.3 25.415 25.319999999999997 24.965 45-49 23.799999999999997 25.865 24.57 25.765 50-54 23.73 25.485000000000003 25.145 25.64 55-59 24.09 25.740000000000002 24.654999999999998 25.515 60-64 23.515 25.27 25.11 26.105 65-69 24.365000000000002 25.105 24.84 25.69 70-74 24.435000000000002 25.319999999999997 25.095 25.15 75-79 24.2 25.19 25.055 25.555 80-84 24.25 25.025 25.595000000000002 25.130000000000003 85-89 24.09 25.615 24.435000000000002 25.86 90-94 24.265 25.195 25.264999999999997 25.275 95-99 24.375 25.355 24.654999999999998 25.615 100-104 25.25 25.424999999999997 24.3 25.025 105-109 24.64 25.28 24.565 25.515 110-114 25.014999999999997 25.385 24.09 25.509999999999998 115-119 24.415 25.155 24.495 25.935000000000002 120-124 24.785 25.34 23.87 26.005 125-129 24.515 26.06 24.279999999999998 25.145 130-134 24.925 25.41 24.36 25.305 135-139 24.445 25.52 24.645 25.39 140-144 24.395 25.814999999999998 24.175 25.615 145-149 24.445 25.415 24.154999999999998 25.985000000000003 150-151 24.2625 25.8625 24.2625 25.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 4.0 28 5.0 29 5.0 30 7.5 31 12.0 32 12.5 33 16.5 34 27.5 35 44.0 36 50.5 37 60.5 38 77.0 39 96.5 40 130.0 41 135.5 42 150.5 43 185.0 44 185.0 45 188.5 46 197.5 47 195.5 48 182.5 49 174.5 50 170.5 51 153.5 52 138.5 53 124.5 54 115.5 55 107.0 56 99.5 57 97.5 58 90.0 59 83.5 60 83.0 61 78.0 62 68.5 63 63.5 64 57.5 65 50.5 66 50.0 67 50.5 68 39.5 69 22.5 70 22.0 71 23.0 72 17.5 73 14.0 74 11.0 75 8.5 76 5.0 77 2.5 78 2.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0125 70-71 0.075 0.0 0.0 0.0 0.025 72-73 0.075 0.0 0.0 0.0 0.025 74-75 0.0875 0.0 0.0 0.0 0.025 76-77 0.1 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.16249999999999998 0.0 0.0 0.0 0.025 82-83 0.2 0.0 0.0 0.0 0.025 84-85 0.30000000000000004 0.0 0.0 0.0 0.025 86-87 0.4125 0.0 0.0 0.0 0.025 88-89 0.475 0.0 0.0 0.0 0.025 90-91 0.55 0.0 0.0 0.0 0.025 92-93 0.725 0.0 0.0 0.0 0.025 94-95 1.0125 0.0 0.0 0.0 0.025 96-97 1.225 0.0 0.0 0.0 0.025 98-99 1.375 0.0 0.0 0.0 0.025 100-101 1.7375 0.0 0.0 0.0 0.025 102-103 2.05 0.0 0.0 0.0 0.025 104-105 2.4875 0.0 0.0 0.0 0.025 106-107 3.0 0.0 0.0 0.0 0.025 108-109 3.3499999999999996 0.0 0.0 0.0 0.025 110-111 3.7375 0.0 0.0 0.0 0.025 112-113 4.375 0.0 0.0 0.0 0.025 114-115 4.9375 0.0 0.0 0.0 0.025 116-117 5.5125 0.0 0.0 0.0 0.025 118-119 6.0125 0.0 0.0 0.0 0.025 120-121 6.45 0.0 0.0 0.0 0.025 122-123 6.862500000000001 0.0 0.0 0.0 0.025 124-125 7.225 0.0 0.0 0.0 0.025 126-127 7.65 0.0 0.0 0.0 0.025 128-129 8.287500000000001 0.0 0.0 0.0 0.025 130-131 8.825 0.0 0.0 0.0 0.025 132-133 9.524999999999999 0.0 0.0 0.0 0.025 134-135 10.375 0.0 0.0 0.0 0.025 136-137 11.125 0.0 0.0 0.0 0.025 138-139 11.725000000000001 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579209 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579209_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4905 33.0 33.0 34.0 32.0 34.0 2 32.68725 33.0 33.0 34.0 32.0 34.0 3 32.66775 34.0 33.0 34.0 32.0 34.0 4 32.5715 34.0 33.0 34.0 32.0 34.0 5 32.55225 34.0 33.0 34.0 32.0 34.0 6 36.71725 38.0 38.0 38.0 36.0 38.0 7 36.709 38.0 38.0 38.0 36.0 38.0 8 36.7475 38.0 38.0 38.0 36.0 38.0 9 36.60075 38.0 38.0 38.0 35.0 38.0 10-14 36.6771 38.0 38.0 38.0 35.8 38.0 15-19 36.61635 38.0 38.0 38.0 35.4 38.0 20-24 36.589600000000004 38.0 38.0 38.0 35.6 38.0 25-29 36.56014999999999 38.0 38.0 38.0 35.2 38.0 30-34 36.56765 38.0 38.0 38.0 35.6 38.0 35-39 36.52995 38.0 38.0 38.0 35.0 38.0 40-44 36.544250000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.438900000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.44815 38.0 38.0 38.0 35.0 38.0 55-59 36.385949999999994 38.0 38.0 38.0 34.6 38.0 60-64 36.32085 38.0 38.0 38.0 34.6 38.0 65-69 36.18975 38.0 38.0 38.0 34.0 38.0 70-74 36.04835 38.0 38.0 38.0 34.0 38.0 75-79 36.0137 38.0 38.0 38.0 33.8 38.0 80-84 36.03815 38.0 38.0 38.0 33.8 38.0 85-89 35.93095 38.0 38.0 38.0 33.4 38.0 90-94 35.9068 38.0 38.0 38.0 33.2 38.0 95-99 35.783950000000004 38.0 38.0 38.0 33.0 38.0 100-104 35.51475 38.0 37.8 38.0 31.2 38.0 105-109 35.40325 38.0 37.4 38.0 30.8 38.0 110-114 35.23635 38.0 37.0 38.0 29.4 38.0 115-119 35.06445 38.0 36.6 38.0 29.2 38.0 120-124 34.76904999999999 38.0 36.0 38.0 27.4 38.0 125-129 34.39295 38.0 35.6 38.0 24.2 38.0 130-134 33.835 38.0 34.6 38.0 21.8 38.0 135-139 33.3018 38.0 33.2 38.0 17.8 38.0 140-144 32.48265 38.0 33.0 38.0 12.2 38.0 145-149 31.576749999999997 38.0 32.6 38.0 3.8 38.0 150-151 26.221375000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 10.0 4 5.0 5 6.0 6 0.0 7 1.0 8 4.0 9 6.0 10 4.0 11 4.0 12 2.0 13 4.0 14 5.0 15 11.0 16 3.0 17 8.0 18 10.0 19 9.0 20 7.0 21 10.0 22 13.0 23 22.0 24 25.0 25 30.0 26 32.0 27 24.0 28 40.0 29 44.0 30 55.0 31 67.0 32 69.0 33 110.0 34 152.0 35 262.0 36 544.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.0 16.7 11.825 25.474999999999998 2 28.7 20.674999999999997 27.500000000000004 23.125 3 23.825 23.799999999999997 26.525 25.85 4 28.749999999999996 31.05 17.375 22.825 5 25.95 34.375 18.25 21.425 6 21.975 33.775 19.575 24.675 7 21.7 14.025000000000002 37.65 26.625 8 22.5 20.875 23.849999999999998 32.775 9 23.5 21.224999999999998 25.25 30.025000000000002 10-14 24.925 25.45 23.465 26.16 15-19 25.355 24.565 24.04 26.040000000000003 20-24 25.415 25.119999999999997 23.785 25.679999999999996 25-29 25.674999999999997 25.305 23.715 25.305 30-34 25.16 24.595 24.625 25.619999999999997 35-39 26.035000000000004 25.174999999999997 23.64 25.15 40-44 25.415 24.715 24.349999999999998 25.52 45-49 25.369999999999997 24.425 24.525 25.679999999999996 50-54 25.66 25.22 24.12 25.0 55-59 25.624999999999996 24.81 24.37 25.195 60-64 25.985000000000003 25.585 23.674999999999997 24.755 65-69 25.515 25.275 24.25 24.959999999999997 70-74 26.029999999999998 25.1 23.935000000000002 24.935 75-79 26.58 25.124999999999996 24.095 24.2 80-84 26.224999999999998 25.185000000000002 23.72 24.87 85-89 26.11 25.224999999999998 24.33 24.335 90-94 25.840000000000003 25.105 24.52 24.535 95-99 26.075 24.755 24.51 24.66 100-104 26.685 24.83 24.63 23.855 105-109 25.990000000000002 25.324999999999996 24.825 23.86 110-114 26.840000000000003 25.11 23.875 24.175 115-119 27.060000000000002 24.8 24.279999999999998 23.86 120-124 26.695 25.6 24.310000000000002 23.395 125-129 27.875 25.169999999999998 24.224999999999998 22.73 130-134 27.055 25.590000000000003 24.65 22.705000000000002 135-139 27.200000000000003 25.555 24.035 23.21 140-144 27.785 26.169999999999998 23.36 22.685 145-149 28.1 25.66 23.66 22.58 150-151 28.65 25.525 24.5125 21.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 2.0 26 3.5 27 1.5 28 0.0 29 2.0 30 5.5 31 8.0 32 10.5 33 10.0 34 11.5 35 23.0 36 38.0 37 52.0 38 60.0 39 77.0 40 104.5 41 121.0 42 140.5 43 148.5 44 167.5 45 180.0 46 184.5 47 178.5 48 168.0 49 177.5 50 165.0 51 150.5 52 141.0 53 136.5 54 135.0 55 112.5 56 105.0 57 117.0 58 108.5 59 100.0 60 88.5 61 84.0 62 86.5 63 79.0 64 70.5 65 69.0 66 63.0 67 56.5 68 51.5 69 43.5 70 42.5 71 31.5 72 19.0 73 21.5 74 18.0 75 8.0 76 5.0 77 3.5 78 3.5 79 3.0 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.7 0.0 0.0 0.0 0.0 112-113 4.324999999999999 0.0 0.0 0.0 0.0 114-115 4.925 0.0 0.0 0.0 0.0 116-117 5.5125 0.0 0.0 0.0 0.0 118-119 5.9625 0.0 0.0 0.0 0.0 120-121 6.35 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.1625 0.0 0.0 0.0 0.0 126-127 7.5875 0.0 0.0 0.0 0.0 128-129 8.212499999999999 0.0 0.0 0.0 0.0 130-131 8.75 0.0 0.0 0.0 0.0 132-133 9.45 0.0 0.0 0.0 0.0 134-135 10.274999999999999 0.0 0.0 0.0 0.0 136-137 10.9875 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392960 spots for SRR5579209.sra Written 1392960 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra Read 1392948 spots for SRR5579209.sra Written 1392948 spots for SRR5579209.sra SRR ids: ['SRR5579209.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_grj2jdba SRR5579209.sra spots: 27858972 blocks: [[1, 1392948], [1392949, 2785896], [2785897, 4178844], [4178845, 5571792], [5571793, 6964740], [6964741, 8357688], [8357689, 9750636], [9750637, 11143584], [11143585, 12536532], [12536533, 13929480], [13929481, 15322428], [15322429, 16715376], [16715377, 18108324], [18108325, 19501272], [19501273, 20894220], [20894221, 22287168], [22287169, 23680116], [23680117, 25073064], [25073065, 26466012], [26466013, 27858972]] SRR5579209 file size 9418791 SRR5579209 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579209 SRR5579209_1.fastq SRR5579209_2.fastq Input file: SRR5579209_1.fastq Paired file: SRR5579209_2.fastq trimmed: SRR5579209-trimmed-pair1.fastq, SRR5579209-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:17:48 2024 >> started Mon Dec 9 22:18:24 2024 >> done (35.710s) 27858972 read pairs processed; of these: 80765 ( 0.29%) short read pairs filtered out after trimming by size control 71473 ( 0.26%) empty read pairs filtered out after trimming by size control 27706734 (99.45%) read pairs available; of these: 14062902 (50.76%) trimmed read pairs available after processing 13643832 (49.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 6 0.00% 21 16 0.00% 22 11 0.00% 23 18 0.00% 24 17 0.00% 25 17 0.00% 26 21 0.00% 27 22 0.00% 28 21 0.00% 29 28 0.00% 30 30 0.00% 31 34 0.00% 32 35 0.00% 33 38 0.00% 34 34 0.00% 35 39 0.00% 36 31 0.00% 37 58 0.00% 38 49 0.00% 39 57 0.00% 40 70 0.00% 41 74 0.00% 42 103 0.00% 43 87 0.00% 44 102 0.00% 45 141 0.00% 46 148 0.00% 47 192 0.00% 48 217 0.00% 49 201 0.00% 50 269 0.00% 51 285 0.00% 52 341 0.00% 53 384 0.00% 54 441 0.00% 55 441 0.00% 56 516 0.00% 57 613 0.00% 58 759 0.00% 59 892 0.00% 60 991 0.00% 61 1159 0.00% 62 1258 0.00% 63 1413 0.01% 64 1564 0.01% 65 1780 0.01% 66 1987 0.01% 67 2251 0.01% 68 2692 0.01% 69 3175 0.01% 70 3955 0.01% 71 4419 0.02% 72 4852 0.02% 73 5418 0.02% 74 5814 0.02% 75 6476 0.02% 76 7044 0.03% 77 7706 0.03% 78 8973 0.03% 79 10043 0.04% 80 11165 0.04% 81 12931 0.05% 82 14485 0.05% 83 16844 0.06% 84 20557 0.07% 85 23143 0.08% 86 24242 0.09% 87 25394 0.09% 88 26418 0.10% 89 28180 0.10% 90 30413 0.11% 91 32705 0.12% 92 35446 0.13% 93 38215 0.14% 94 39828 0.14% 95 41167 0.15% 96 43179 0.16% 97 44002 0.16% 98 45729 0.17% 99 48509 0.18% 100 50483 0.18% 101 53784 0.19% 102 57464 0.21% 103 59861 0.22% 104 62235 0.22% 105 65031 0.23% 106 65814 0.24% 107 66948 0.24% 108 68696 0.25% 109 71111 0.26% 110 72903 0.26% 111 77047 0.28% 112 80035 0.29% 113 83393 0.30% 114 86841 0.31% 115 88687 0.32% 116 89641 0.32% 117 91446 0.33% 118 91741 0.33% 119 94383 0.34% 120 97466 0.35% 121 100316 0.36% 122 103917 0.38% 123 108476 0.39% 124 112386 0.41% 125 114998 0.42% 126 116498 0.42% 127 117068 0.42% 128 118715 0.43% 129 121686 0.44% 130 124605 0.45% 131 127832 0.46% 132 133883 0.48% 133 137231 0.50% 134 141795 0.51% 135 147736 0.53% 136 152628 0.55% 137 156022 0.56% 138 162397 0.59% 139 167250 0.60% 140 174398 0.63% 141 186232 0.67% 142 200033 0.72% 143 217304 0.78% 144 242135 0.87% 145 273746 0.99% 146 324096 1.17% 147 410475 1.48% 148 592797 2.14% 149 1095322 3.95% 150 5613511 20.26% 151 13643832 49.24% 27706734 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=2.9 sequence=CGCTGCTGGTCCGGGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=850.73 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=28.9 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=32 prefix-density=0.35 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=687.34 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579209 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:19:33 Started mapping on | Dec 09 22:19:33 Finished on | Dec 09 22:35:01 Mapping speed, Million of reads per hour | 107.48 Number of input reads | 27706734 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 22641289 Uniquely mapped reads % | 81.72% Average mapped length | 288.89 Number of splices: Total | 23544426 Number of splices: Annotated (sjdb) | 22215138 Number of splices: GT/AG | 23234332 Number of splices: GC/AG | 275420 Number of splices: AT/AC | 17092 Number of splices: Non-canonical | 17582 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256269 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 10744 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.08% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4850837 4850837 4850837 N_multimapping 256269 256269 256269 N_noFeature 635935 22013975 868774 N_ambiguous 444538 2820 51707 UnstrandedReadsAssigned:21560816 PositiveStrandReadsAssigned:624494 NegativeStrandReadsAssigned:21720808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5579209 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579209-trimmed-pair1.fastq SRR5579209-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,706,734 reads, 22,008,229 reads pseudoaligned [quant] estimated average fragment length: 245.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR5579209.ke.tsv 35125 SRR5579209.se.tsv 88098 total ==> SRR5579209.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.971 36.1222 3.44109 PNS24247 1044 799.454 83.9045 6.91833 PNS24249 1928 1683.45 122.792 4.80816 PNS24246 1044 799.454 83.9045 6.91833 PNS24248 1044 799.454 83.9045 6.91833 PNS24244 1471 1226.45 153.372 8.24338 PNS24243 293 106.312 1 0.620049 KQK14069 1603 1358.45 7660.32 371.717 KQK14071 474 249.753 102.314 27.0044 ==> SRR5579209.se.tsv <== BRADI_1g14170v3 8170 BRADI_1g53295v3 72 BRADI_1g59795v3 405 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1202 BRADI_1g74790v3 68 BRADI_1g09890v3 1 BRADI_1g77505v3 163 BRADI_1g48960v3 0 SRR5579209 completed mapping pipeline successfully