Starting /dee2/code/volunteer_pipeline.sh SRR5579210 current disk space = 1522756263936 free memory = 1571411272 SRR5579210 SRAfilesize bc69be44afb54aa3cce27a45c997bb8a SRR5579210.sra SRR5579210.sra file validated SRR5579210 is paired end SRR5579210 is conventional basespace SRR5579210 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579210_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.31 34.0 33.0 34.0 2.0 34.0 2 32.59825 34.0 33.0 34.0 28.0 34.0 3 32.83975 34.0 33.0 34.0 30.0 34.0 4 33.14575 34.0 33.0 34.0 32.0 34.0 5 33.25075 34.0 33.0 34.0 33.0 34.0 6 36.93825 38.0 37.0 38.0 35.0 38.0 7 37.2925 38.0 38.0 38.0 36.0 38.0 8 37.426 38.0 38.0 38.0 37.0 38.0 9 37.43075 38.0 38.0 38.0 38.0 38.0 10-14 37.415000000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.41984999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.43035 38.0 38.0 38.0 37.6 38.0 25-29 37.3883 38.0 38.0 38.0 37.0 38.0 30-34 37.38535 38.0 38.0 38.0 37.2 38.0 35-39 37.27835 38.0 38.0 38.0 37.2 38.0 40-44 36.99455 38.0 38.0 38.0 36.2 38.0 45-49 37.07770000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.89705 38.0 38.0 38.0 35.8 38.0 55-59 36.88435 38.0 38.0 38.0 35.4 38.0 60-64 36.86895 38.0 38.0 38.0 35.2 38.0 65-69 36.78495 38.0 38.0 38.0 35.0 38.0 70-74 36.57020000000001 38.0 38.0 38.0 34.6 38.0 75-79 35.9896 38.0 38.0 38.0 33.8 38.0 80-84 35.93 38.0 38.0 38.0 33.6 38.0 85-89 35.7964 38.0 38.0 38.0 33.0 38.0 90-94 35.7231 38.0 38.0 38.0 32.6 38.0 95-99 35.6465 38.0 38.0 38.0 33.0 38.0 100-104 35.5012 38.0 37.8 38.0 31.6 38.0 105-109 35.252300000000005 38.0 37.0 38.0 30.6 38.0 110-114 35.15935 38.0 37.0 38.0 30.6 38.0 115-119 34.98675 38.0 36.8 38.0 29.0 38.0 120-124 34.78829999999999 38.0 36.0 38.0 28.0 38.0 125-129 34.59255 38.0 36.0 38.0 26.8 38.0 130-134 34.402750000000005 38.0 35.6 38.0 25.4 38.0 135-139 34.19015 38.0 35.0 38.0 23.6 38.0 140-144 33.952749999999995 38.0 35.0 38.0 23.2 38.0 145-149 33.31545 38.0 34.8 38.0 17.4 38.0 150-151 29.930625 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 3.0 9 0.0 10 0.0 11 1.0 12 2.0 13 3.0 14 2.0 15 8.0 16 1.0 17 10.0 18 39.0 19 36.0 20 8.0 21 13.0 22 12.0 23 10.0 24 10.0 25 15.0 26 27.0 27 25.0 28 26.0 29 33.0 30 41.0 31 54.0 32 77.0 33 93.0 34 149.0 35 211.0 36 562.0 37 2528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.27418431597023 12.535775615340583 9.902690326273612 34.28734974241557 2 24.125 16.650000000000002 33.4 25.825 3 22.2 21.3 26.924999999999997 29.575000000000003 4 27.125 27.200000000000003 21.3 24.375 5 27.650000000000002 28.9 22.55 20.9 6 23.799999999999997 32.45 22.775000000000002 20.974999999999998 7 17.625 23.875 38.475 20.025000000000002 8 19.475 24.025 27.500000000000004 28.999999999999996 9 22.05 20.8 30.3 26.85 10-14 23.405 27.355 23.974999999999998 25.264999999999997 15-19 23.305 25.09 25.715 25.89 20-24 23.380000000000003 25.735000000000003 25.205 25.679999999999996 25-29 23.175 25.650000000000002 25.3 25.874999999999996 30-34 23.055 25.509999999999998 24.89 26.545 35-39 23.705000000000002 24.805 25.405 26.085 40-44 23.03 24.905 25.965 26.1 45-49 24.65 25.124999999999996 25.180000000000003 25.045 50-54 24.03 24.33 24.46 27.18 55-59 23.62 25.115 25.490000000000002 25.775 60-64 23.48 25.405 25.06 26.055 65-69 23.265 26.590000000000003 24.55 25.595000000000002 70-74 23.315 26.619999999999997 24.16 25.905 75-79 23.95 25.405 24.775 25.869999999999997 80-84 24.64 25.64 24.48 25.240000000000002 85-89 24.255 24.82 24.69 26.235000000000003 90-94 24.135 24.725 25.580000000000002 25.56 95-99 23.775 25.174999999999997 25.3 25.75 100-104 24.73 24.72 24.525 26.025 105-109 24.545 25.865 23.98 25.61 110-114 23.405 25.795 24.545 26.255 115-119 23.64 25.81 24.104999999999997 26.445 120-124 24.615000000000002 25.509999999999998 23.68 26.195 125-129 24.275 25.535000000000004 24.14 26.05 130-134 24.32 25.445 24.14 26.095000000000002 135-139 24.37 25.145 24.275 26.21 140-144 23.945 25.465 23.895 26.695 145-149 24.26 25.865 23.635 26.240000000000002 150-151 23.7375 25.112499999999997 24.2 26.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 3.0 28 3.0 29 6.0 30 13.0 31 17.5 32 25.0 33 38.5 34 48.0 35 56.0 36 66.5 37 81.0 38 102.5 39 105.0 40 118.0 41 128.0 42 119.5 43 138.5 44 160.5 45 172.0 46 181.0 47 176.0 48 152.0 49 148.5 50 142.0 51 134.5 52 151.0 53 150.5 54 133.0 55 126.5 56 114.0 57 101.5 58 95.0 59 78.0 60 70.0 61 67.5 62 66.5 63 58.5 64 49.0 65 47.5 66 46.5 67 39.5 68 33.5 69 34.0 70 33.5 71 31.0 72 28.0 73 20.5 74 16.0 75 17.5 76 15.5 77 10.5 78 7.0 79 5.5 80 4.5 81 2.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.3607812087622 92.225 2 1.979414093428345 3.75 3 0.422275006598047 1.2 4 0.052784375824755876 0.2 5 0.0791765637371338 0.375 6 0.026392187912377938 0.15 7 0.026392187912377938 0.17500000000000002 8 0.0 0.0 9 0.026392187912377938 0.22499999999999998 >10 0.0 0.0 >50 0.026392187912377938 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGCTGATCTCGTATGC 68 1.7000000000000002 TruSeq Adapter, Index 7 (97% over 36bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGCTGATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 12 (97% over 35bp) GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 7 0.17500000000000002 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 6 0.15 No Hit CGGCTGTCGAGTTGTACGGCCGTTCAGCCACGAGTCACGGGGTCTAACGC 5 0.125 No Hit GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 5 0.125 No Hit GTCGAGACTGAAAAGCTATAACCCGCAGACCCGAGCGAAAGCGGCGGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.4875 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9875 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 4.125 0.0 0.0 0.0 0.0 108-109 4.6 0.0 0.0 0.0 0.0 110-111 5.15 0.0 0.0 0.0 0.0 112-113 5.85 0.0 0.0 0.0 0.0 114-115 6.512499999999999 0.0 0.0 0.0 0.0 116-117 7.1375 0.0 0.0 0.0 0.0 118-119 7.7125 0.0 0.0 0.0 0.0 120-121 8.25 0.0 0.0 0.0 0.0 122-123 9.0 0.0 0.0 0.0 0.0 124-125 9.8 0.0 0.0 0.0 0.0 126-127 10.4875 0.0 0.0 0.0 0.0 128-129 11.1625 0.0 0.0 0.0 0.0 130-131 12.075 0.0 0.0 0.0 0.0 132-133 13.0 0.0 0.0 0.0 0.0 134-135 14.075 0.0 0.0 0.0 0.0 136-137 14.9875 0.0 0.0 0.0 0.0 138-139 16.049999999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579210 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579210_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.647 33.0 33.0 34.0 32.0 34.0 2 32.74025 34.0 33.0 34.0 32.0 34.0 3 32.6325 34.0 33.0 34.0 32.0 34.0 4 32.61475 34.0 33.0 34.0 32.0 34.0 5 32.622 34.0 33.0 34.0 32.0 34.0 6 36.71725 38.0 38.0 38.0 36.0 38.0 7 36.654 38.0 38.0 38.0 36.0 38.0 8 36.7215 38.0 38.0 38.0 36.0 38.0 9 36.6675 38.0 38.0 38.0 36.0 38.0 10-14 36.65005 38.0 38.0 38.0 36.0 38.0 15-19 36.5613 38.0 38.0 38.0 35.6 38.0 20-24 36.49985 38.0 38.0 38.0 35.4 38.0 25-29 36.543299999999995 38.0 38.0 38.0 35.8 38.0 30-34 36.452349999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.38995 38.0 38.0 38.0 35.2 38.0 40-44 36.371500000000005 38.0 38.0 38.0 35.2 38.0 45-49 36.16635 38.0 38.0 38.0 34.0 38.0 50-54 36.1716 38.0 38.0 38.0 34.4 38.0 55-59 36.20435 38.0 38.0 38.0 34.4 38.0 60-64 36.20215 38.0 38.0 38.0 34.6 38.0 65-69 35.923550000000006 38.0 38.0 38.0 34.0 38.0 70-74 35.45725 38.0 38.0 38.0 32.2 38.0 75-79 35.48235 38.0 38.0 38.0 33.0 38.0 80-84 35.4188 38.0 38.0 38.0 32.0 38.0 85-89 35.40025 38.0 38.0 38.0 33.0 38.0 90-94 35.25085 38.0 38.0 38.0 31.2 38.0 95-99 35.0971 38.0 38.0 38.0 30.0 38.0 100-104 35.05989999999999 38.0 38.0 38.0 30.2 38.0 105-109 34.8408 38.0 38.0 38.0 28.4 38.0 110-114 34.727000000000004 38.0 37.6 38.0 27.4 38.0 115-119 34.6152 38.0 37.2 38.0 27.0 38.0 120-124 34.325 38.0 36.2 38.0 23.6 38.0 125-129 34.05465 38.0 36.0 38.0 22.2 38.0 130-134 33.731899999999996 38.0 35.6 38.0 19.6 38.0 135-139 33.2697 38.0 35.0 38.0 15.6 38.0 140-144 32.8018 38.0 34.8 38.0 13.2 38.0 145-149 31.911449999999995 38.0 33.8 38.0 4.2 38.0 150-151 27.882375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 6.0 4 11.0 5 8.0 6 3.0 7 7.0 8 4.0 9 2.0 10 8.0 11 6.0 12 5.0 13 8.0 14 15.0 15 15.0 16 30.0 17 24.0 18 8.0 19 10.0 20 5.0 21 10.0 22 12.0 23 14.0 24 15.0 25 16.0 26 25.0 27 22.0 28 30.0 29 46.0 30 56.0 31 48.0 32 67.0 33 87.0 34 120.0 35 206.0 36 442.0 37 2580.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.824999999999996 16.525000000000002 11.725 25.924999999999997 2 26.625 24.224999999999998 26.924999999999997 22.225 3 25.424999999999997 24.025 26.0 24.55 4 28.65 30.2 17.599999999999998 23.549999999999997 5 28.075 32.25 18.224999999999998 21.45 6 24.675 33.4 20.225 21.7 7 23.5 18.85 33.425 24.224999999999998 8 23.375 22.375 21.675 32.574999999999996 9 26.075 22.775000000000002 24.725 26.424999999999997 10-14 26.645000000000003 25.380000000000003 22.145 25.83 15-19 26.575 25.195 23.400000000000002 24.83 20-24 27.675 25.27 22.45 24.605 25-29 27.500000000000004 26.02 22.545 23.935000000000002 30-34 27.089999999999996 24.725 23.575 24.610000000000003 35-39 26.47 23.84 23.59 26.1 40-44 28.28 24.48 23.474999999999998 23.765 45-49 27.05 23.525 23.935000000000002 25.490000000000002 50-54 26.36 23.94 24.5 25.2 55-59 26.135 25.395 24.455 24.015 60-64 25.840000000000003 25.790000000000003 23.990000000000002 24.38 65-69 25.36 26.55 24.104999999999997 23.985 70-74 25.885 26.484999999999996 23.29 24.34 75-79 25.755 25.814999999999998 23.435 24.995 80-84 26.334999999999997 25.490000000000002 23.935000000000002 24.240000000000002 85-89 26.875 25.53 23.380000000000003 24.215 90-94 26.39 26.229999999999997 23.849999999999998 23.53 95-99 26.724999999999998 25.735000000000003 23.445 24.095 100-104 26.575 25.91 23.7 23.815 105-109 26.57 26.35 23.665 23.415 110-114 26.665 26.085 23.35 23.9 115-119 27.52 26.340000000000003 23.16 22.98 120-124 26.915 26.26 23.69 23.135 125-129 27.29 26.400000000000002 23.195 23.115 130-134 28.084999999999997 25.965 24.275 21.675 135-139 28.349999999999998 26.365 23.285 22.0 140-144 28.194999999999997 26.68 23.535 21.59 145-149 28.73 26.455000000000002 23.415 21.4 150-151 29.312500000000004 26.375 22.95 21.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 2.0 27 2.0 28 1.5 29 1.5 30 6.0 31 10.0 32 10.0 33 16.0 34 22.5 35 30.5 36 37.5 37 58.0 38 88.5 39 97.5 40 111.5 41 116.0 42 108.5 43 122.5 44 142.0 45 153.5 46 166.5 47 168.0 48 155.0 49 148.0 50 155.0 51 149.5 52 142.0 53 160.5 54 158.0 55 137.5 56 124.5 57 114.0 58 98.0 59 101.0 60 95.0 61 75.5 62 80.0 63 71.5 64 70.5 65 72.0 66 53.0 67 54.5 68 55.5 69 42.0 70 38.5 71 39.0 72 32.5 73 20.0 74 14.0 75 15.0 76 13.5 77 11.0 78 9.5 79 5.0 80 4.0 81 4.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 96.77158999192898 89.925 2 2.2329835889157925 4.15 3 0.45735808447672854 1.275 4 0.18832391713747645 0.7000000000000001 5 0.08071025020177562 0.375 6 0.026903416733925208 0.15 7 0.053806833467850416 0.35000000000000003 8 0.08071025020177562 0.6 9 0.0 0.0 >10 0.08071025020177562 0.8999999999999999 >50 0.026903416733925208 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 63 1.575 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 13 0.325 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 12 0.3 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 11 0.27499999999999997 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 8 0.2 No Hit AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 8 0.2 No Hit CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 8 0.2 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 7 0.17500000000000002 No Hit GCCACAGGCGTCATACTTCCCAAGAAGCGGCCATAGCCCAGATGCGAGGT 7 0.17500000000000002 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 6 0.15 No Hit TCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACC 5 0.125 No Hit GGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGT 5 0.125 No Hit GGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.4249999999999998 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.375 0.0 0.0 0.0 0.0 100-101 2.725 0.0 0.0 0.0 0.0 102-103 3.15 0.0 0.0 0.0 0.0 104-105 3.6125 0.0 0.0 0.0 0.0 106-107 4.2375 0.0 0.0 0.0 0.0 108-109 4.725 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.9 0.0 0.0 0.0 0.0 114-115 6.5375 0.0 0.0 0.0 0.0 116-117 7.2 0.0 0.0 0.0 0.0 118-119 7.775 0.0 0.0 0.0 0.0 120-121 8.3125 0.0 0.0 0.0 0.0 122-123 9.100000000000001 0.0 0.0 0.0 0.0 124-125 9.95 0.0 0.0 0.0 0.0 126-127 10.6625 0.0 0.0 0.0 0.0 128-129 11.399999999999999 0.0 0.0 0.0 0.0 130-131 12.35 0.0 0.0 0.0 0.0 132-133 13.3 0.0 0.0 0.0 0.0 134-135 14.375 0.0 0.0 0.0 0.0 136-137 15.3125 0.0 0.0 0.0 0.0 138-139 16.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGAGG 10 0.006830828 145.0 1 >>END_MODULE Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193097 spots for SRR5579210.sra Written 1193097 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra Read 1193085 spots for SRR5579210.sra Written 1193085 spots for SRR5579210.sra SRR ids: ['SRR5579210.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oug34oqw SRR5579210.sra spots: 23861712 blocks: [[1, 1193085], [1193086, 2386170], [2386171, 3579255], [3579256, 4772340], [4772341, 5965425], [5965426, 7158510], [7158511, 8351595], [8351596, 9544680], [9544681, 10737765], [10737766, 11930850], [11930851, 13123935], [13123936, 14317020], [14317021, 15510105], [15510106, 16703190], [16703191, 17896275], [17896276, 19089360], [19089361, 20282445], [20282446, 21475530], [21475531, 22668615], [22668616, 23861712]] SRR5579210 file size 8064250 SRR5579210 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579210 SRR5579210_1.fastq SRR5579210_2.fastq Input file: SRR5579210_1.fastq Paired file: SRR5579210_2.fastq trimmed: SRR5579210-trimmed-pair1.fastq, SRR5579210-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:46:35 2024 >> started Mon Dec 9 22:47:23 2024 >> done (48.196s) 23861712 read pairs processed; of these: 71801 ( 0.30%) short read pairs filtered out after trimming by size control 549395 ( 2.30%) empty read pairs filtered out after trimming by size control 23240516 (97.40%) read pairs available; of these: 11442769 (49.24%) trimmed read pairs available after processing 11797747 (50.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 24 0.00% 20 21 0.00% 21 29 0.00% 22 32 0.00% 23 25 0.00% 24 34 0.00% 25 28 0.00% 26 33 0.00% 27 37 0.00% 28 47 0.00% 29 50 0.00% 30 42 0.00% 31 57 0.00% 32 43 0.00% 33 69 0.00% 34 61 0.00% 35 77 0.00% 36 93 0.00% 37 111 0.00% 38 95 0.00% 39 125 0.00% 40 108 0.00% 41 134 0.00% 42 170 0.00% 43 185 0.00% 44 252 0.00% 45 269 0.00% 46 358 0.00% 47 337 0.00% 48 398 0.00% 49 433 0.00% 50 501 0.00% 51 552 0.00% 52 615 0.00% 53 683 0.00% 54 670 0.00% 55 777 0.00% 56 853 0.00% 57 986 0.00% 58 1161 0.00% 59 1288 0.01% 60 1532 0.01% 61 1810 0.01% 62 2012 0.01% 63 2042 0.01% 64 2341 0.01% 65 2627 0.01% 66 3663 0.02% 67 5263 0.02% 68 6070 0.03% 69 10299 0.04% 70 12161 0.05% 71 6885 0.03% 72 6393 0.03% 73 6883 0.03% 74 7390 0.03% 75 8152 0.04% 76 8918 0.04% 77 10273 0.04% 78 10906 0.05% 79 12385 0.05% 80 13838 0.06% 81 15543 0.07% 82 17436 0.08% 83 19603 0.08% 84 23718 0.10% 85 26555 0.11% 86 27994 0.12% 87 30256 0.13% 88 32384 0.14% 89 34466 0.15% 90 37082 0.16% 91 39162 0.17% 92 41883 0.18% 93 43242 0.19% 94 46179 0.20% 95 49196 0.21% 96 51226 0.22% 97 52827 0.23% 98 54711 0.24% 99 57435 0.25% 100 60320 0.26% 101 63285 0.27% 102 65311 0.28% 103 68733 0.30% 104 71500 0.31% 105 73705 0.32% 106 77352 0.33% 107 77890 0.34% 108 79663 0.34% 109 81115 0.35% 110 82001 0.35% 111 86255 0.37% 112 89789 0.39% 113 94557 0.41% 114 95664 0.41% 115 98953 0.43% 116 102748 0.44% 117 100672 0.43% 118 101879 0.44% 119 102518 0.44% 120 105318 0.45% 121 107413 0.46% 122 110779 0.48% 123 115871 0.50% 124 117684 0.51% 125 118797 0.51% 126 121007 0.52% 127 120555 0.52% 128 120001 0.52% 129 123136 0.53% 130 123957 0.53% 131 126592 0.54% 132 133076 0.57% 133 133680 0.58% 134 136561 0.59% 135 138941 0.60% 136 143454 0.62% 137 143260 0.62% 138 146691 0.63% 139 152398 0.66% 140 152971 0.66% 141 158428 0.68% 142 168146 0.72% 143 174460 0.75% 144 187742 0.81% 145 207147 0.89% 146 232493 1.00% 147 278564 1.20% 148 378985 1.63% 149 668802 2.88% 150 3767335 16.21% 151 11797747 50.76% 23240516 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.68 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=31.59 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.77 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=16.33 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT SRR5579210 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:49:29 Started mapping on | Dec 09 22:49:29 Finished on | Dec 09 23:11:04 Mapping speed, Million of reads per hour | 64.61 Number of input reads | 23240516 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 17595994 Uniquely mapped reads % | 75.71% Average mapped length | 285.00 Number of splices: Total | 16333977 Number of splices: Annotated (sjdb) | 15195617 Number of splices: GT/AG | 16120147 Number of splices: GC/AG | 194016 Number of splices: AT/AC | 8637 Number of splices: Non-canonical | 11177 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336949 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 50741 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.51% % of reads unmapped: other | 1.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5335480 5335480 5335480 N_multimapping 336949 336949 336949 N_noFeature 552286 16998875 729647 N_ambiguous 520952 2481 101787 UnstrandedReadsAssigned:16522756 PositiveStrandReadsAssigned:594638 NegativeStrandReadsAssigned:16764560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR5579210 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579210-trimmed-pair1.fastq SRR5579210-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,240,516 reads, 16,933,254 reads pseudoaligned [quant] estimated average fragment length: 212.148 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR5579210.ke.tsv 35125 SRR5579210.se.tsv 88098 total ==> SRR5579210.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 725.041 15.6457 1.42594 PNS24247 1044 832.852 14.131 1.12118 PNS24249 1928 1716.85 41.6686 1.60379 PNS24246 1044 832.852 14.131 1.12118 PNS24248 1044 832.852 14.131 1.12118 PNS24244 1471 1259.85 168.293 8.82706 PNS24243 293 115.018 0 0 KQK14069 1603 1391.85 5768.69 273.876 KQK14071 474 270.776 101.091 24.6701 ==> SRR5579210.se.tsv <== BRADI_1g14170v3 6084 BRADI_1g53295v3 64 BRADI_1g59795v3 291 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1814 BRADI_1g74790v3 278 BRADI_1g09890v3 12 BRADI_1g77505v3 599 BRADI_1g48960v3 0 SRR5579210 completed mapping pipeline successfully