Starting /dee2/code/volunteer_pipeline.sh SRR5579211 current disk space = 1522774900736 free memory = 1573836652 SRR5579211 SRAfilesize bc1e017daef99bddf94c47ceeb46e390 SRR5579211.sra SRR5579211.sra file validated SRR5579211 is paired end SRR5579211 is conventional basespace SRR5579211 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579211_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.557 34.0 33.0 34.0 2.0 34.0 2 32.586 34.0 33.0 34.0 28.0 34.0 3 32.81275 34.0 33.0 34.0 30.0 34.0 4 33.12875 34.0 33.0 34.0 32.0 34.0 5 33.13125 34.0 33.0 34.0 32.0 34.0 6 36.90975 38.0 37.0 38.0 35.0 38.0 7 37.195 38.0 38.0 38.0 36.0 38.0 8 37.286 38.0 38.0 38.0 37.0 38.0 9 37.404 38.0 38.0 38.0 37.0 38.0 10-14 37.364549999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.3457 38.0 38.0 38.0 37.0 38.0 20-24 37.31585 38.0 38.0 38.0 37.0 38.0 25-29 37.264 38.0 38.0 38.0 37.0 38.0 30-34 37.241 38.0 38.0 38.0 37.0 38.0 35-39 37.2025 38.0 38.0 38.0 36.4 38.0 40-44 37.01315 38.0 38.0 38.0 35.8 38.0 45-49 37.0076 38.0 38.0 38.0 36.0 38.0 50-54 36.9409 38.0 38.0 38.0 35.4 38.0 55-59 36.853899999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.82155 38.0 38.0 38.0 34.8 38.0 65-69 36.755250000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.6961 38.0 38.0 38.0 34.8 38.0 75-79 36.60675 38.0 38.0 38.0 34.2 38.0 80-84 36.57835 38.0 38.0 38.0 34.0 38.0 85-89 36.420449999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.330799999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.2537 38.0 37.8 38.0 33.6 38.0 100-104 36.05965 38.0 37.0 38.0 33.0 38.0 105-109 35.95784999999999 38.0 37.0 38.0 33.0 38.0 110-114 35.738350000000004 38.0 36.6 38.0 31.4 38.0 115-119 35.6917 38.0 36.2 38.0 31.0 38.0 120-124 35.4003 38.0 36.0 38.0 30.0 38.0 125-129 35.0591 38.0 35.0 38.0 28.0 38.0 130-134 34.9995 38.0 35.2 38.0 28.2 38.0 135-139 34.69945 38.0 35.0 38.0 27.8 38.0 140-144 34.4015 38.0 35.0 38.0 27.0 38.0 145-149 34.00275 38.0 35.0 38.0 24.8 38.0 150-151 30.5935 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 0.0 16 2.0 17 2.0 18 4.0 19 6.0 20 6.0 21 2.0 22 4.0 23 6.0 24 15.0 25 18.0 26 21.0 27 26.0 28 32.0 29 43.0 30 46.0 31 49.0 32 80.0 33 129.0 34 155.0 35 307.0 36 752.0 37 2286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.744981622844215 12.581283573649985 10.206389595702573 31.46734520780322 2 25.374999999999996 17.65 31.8 25.174999999999997 3 23.35 23.925 22.900000000000002 29.825000000000003 4 28.299999999999997 29.375 19.6 22.725 5 26.05 33.4 21.05 19.5 6 20.974999999999998 32.15 23.075000000000003 23.799999999999997 7 18.25 19.2 41.349999999999994 21.2 8 21.25 20.349999999999998 27.200000000000003 31.2 9 22.025 19.775000000000002 29.099999999999998 29.099999999999998 10-14 24.310000000000002 25.335 24.005000000000003 26.35 15-19 24.21 24.535 24.959999999999997 26.295 20-24 23.400000000000002 24.595 24.91 27.095000000000002 25-29 24.745 24.560000000000002 24.55 26.145000000000003 30-34 23.799999999999997 24.86 25.15 26.19 35-39 24.48 24.98 24.485 26.055 40-44 24.654999999999998 24.775 24.415 26.155 45-49 24.2 24.990000000000002 24.33 26.479999999999997 50-54 24.525 24.07 24.77 26.634999999999998 55-59 24.505 23.915 24.87 26.71 60-64 24.404999999999998 24.560000000000002 24.46 26.575 65-69 24.355 24.185000000000002 25.259999999999998 26.200000000000003 70-74 24.675 24.445 24.2 26.68 75-79 25.174999999999997 24.575 23.135 27.115000000000002 80-84 24.58 24.785 24.335 26.3 85-89 25.230000000000004 23.925 24.285 26.56 90-94 25.380000000000003 24.365000000000002 24.09 26.165 95-99 25.235000000000003 24.58 24.240000000000002 25.945 100-104 25.290000000000003 24.59 23.805 26.314999999999998 105-109 25.045 24.5 24.085 26.369999999999997 110-114 25.22 24.425 23.400000000000002 26.955000000000002 115-119 25.264999999999997 24.165 23.835 26.735 120-124 25.505 24.83 23.215 26.450000000000003 125-129 24.87 24.709999999999997 23.400000000000002 27.02 130-134 24.8 25.230000000000004 23.305 26.665 135-139 24.81 25.345000000000002 22.93 26.915 140-144 24.224999999999998 24.9 23.465 27.41 145-149 24.685000000000002 25.130000000000003 23.715 26.47 150-151 24.9875 25.4375 22.875 26.700000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 3.0 29 2.0 30 4.0 31 7.0 32 9.0 33 16.0 34 23.0 35 37.5 36 51.5 37 57.5 38 76.5 39 91.0 40 102.0 41 126.5 42 147.5 43 165.0 44 166.0 45 168.5 46 174.5 47 155.5 48 172.0 49 182.5 50 154.5 51 144.0 52 132.5 53 119.5 54 106.0 55 94.0 56 95.5 57 98.5 58 95.5 59 94.5 60 99.0 61 91.0 62 72.5 63 71.5 64 81.5 65 67.0 66 60.0 67 69.5 68 68.0 69 57.0 70 42.0 71 35.5 72 29.0 73 23.0 74 21.0 75 13.0 76 7.5 77 6.5 78 2.0 79 0.5 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.575000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93697798025816 97.725 2 0.961781827385472 1.9 3 0.05062009617818274 0.15 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACAAAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.025 100-101 2.2 0.0 0.0 0.0 0.025 102-103 2.4000000000000004 0.0 0.0 0.0 0.025 104-105 2.6875 0.0 0.0 0.0 0.025 106-107 3.025 0.0 0.0 0.0 0.025 108-109 3.3125 0.0 0.0 0.0 0.025 110-111 3.775 0.0 0.0 0.0 0.025 112-113 4.2875 0.0 0.0 0.0 0.025 114-115 4.7375 0.0 0.0 0.0 0.025 116-117 5.1 0.0 0.0 0.0 0.025 118-119 5.65 0.0 0.0 0.0 0.025 120-121 6.1625 0.0 0.0 0.0 0.025 122-123 6.7 0.0 0.0 0.0 0.025 124-125 7.35 0.0 0.0 0.0 0.025 126-127 7.975 0.0 0.0 0.0 0.025 128-129 8.625 0.0 0.0 0.0 0.025 130-131 9.175 0.0 0.0 0.0 0.025 132-133 9.825 0.0 0.0 0.0 0.025 134-135 10.3 0.0 0.0 0.0 0.025 136-137 10.7625 0.0 0.0 0.0 0.025 138-139 11.412500000000001 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTCA 10 0.006846698 144.88751 4 TGAAGAT 10 0.006846698 144.88751 7 TCGCATC 10 0.006846698 144.88751 2 >>END_MODULE SRR5579211 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579211_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6095 33.0 33.0 34.0 32.0 34.0 2 32.71925 33.0 33.0 34.0 32.0 34.0 3 32.7505 34.0 33.0 34.0 32.0 34.0 4 32.67725 34.0 33.0 34.0 32.0 34.0 5 32.7075 34.0 33.0 34.0 32.0 34.0 6 36.711 38.0 38.0 38.0 35.0 38.0 7 36.79475 38.0 38.0 38.0 36.0 38.0 8 36.77 38.0 38.0 38.0 36.0 38.0 9 36.78075 38.0 38.0 38.0 36.0 38.0 10-14 36.745999999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.6718 38.0 38.0 38.0 36.0 38.0 20-24 36.67530000000001 38.0 38.0 38.0 35.8 38.0 25-29 36.59340000000001 38.0 38.0 38.0 35.6 38.0 30-34 36.6146 38.0 38.0 38.0 35.0 38.0 35-39 36.602199999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.592949999999995 38.0 38.0 38.0 35.6 38.0 45-49 36.53125 38.0 38.0 38.0 35.0 38.0 50-54 36.4099 38.0 38.0 38.0 35.0 38.0 55-59 36.46915 38.0 38.0 38.0 35.2 38.0 60-64 36.40255 38.0 38.0 38.0 35.0 38.0 65-69 36.303399999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.22195 38.0 38.0 38.0 34.0 38.0 75-79 36.184000000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.15605000000001 38.0 38.0 38.0 33.8 38.0 85-89 35.94045 38.0 38.0 38.0 33.4 38.0 90-94 35.443 38.0 37.4 38.0 30.0 38.0 95-99 35.667649999999995 38.0 38.0 38.0 32.4 38.0 100-104 35.483999999999995 38.0 37.6 38.0 31.2 38.0 105-109 35.428000000000004 38.0 37.4 38.0 30.8 38.0 110-114 35.320949999999996 38.0 37.0 38.0 31.2 38.0 115-119 35.17575 38.0 37.0 38.0 30.6 38.0 120-124 34.91480000000001 38.0 36.4 38.0 28.6 38.0 125-129 34.69879999999999 38.0 36.0 38.0 27.6 38.0 130-134 34.43295 38.0 35.6 38.0 25.0 38.0 135-139 34.0525 38.0 35.0 38.0 23.2 38.0 140-144 33.69175 38.0 35.0 38.0 21.4 38.0 145-149 32.87669999999999 38.0 33.6 38.0 11.2 38.0 150-151 28.394 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 10.0 4 6.0 5 4.0 6 4.0 7 1.0 8 2.0 9 2.0 10 4.0 11 3.0 12 3.0 13 9.0 14 8.0 15 8.0 16 3.0 17 5.0 18 6.0 19 6.0 20 10.0 21 6.0 22 13.0 23 15.0 24 14.0 25 18.0 26 19.0 27 31.0 28 40.0 29 52.0 30 46.0 31 74.0 32 73.0 33 83.0 34 162.0 35 207.0 36 556.0 37 2480.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.800000000000004 13.825000000000001 12.725 28.65 2 28.849999999999998 21.325 26.55 23.275000000000002 3 25.0 23.549999999999997 25.525 25.924999999999997 4 27.800000000000004 30.95 17.0 24.25 5 27.1 33.95 17.849999999999998 21.099999999999998 6 21.875 33.975 19.6 24.55 7 20.974999999999998 17.150000000000002 35.675000000000004 26.200000000000003 8 24.75 19.325 22.25 33.675 9 24.4 21.075 24.15 30.375000000000004 10-14 26.27 24.865000000000002 22.62 26.245 15-19 26.305 23.79 23.445 26.46 20-24 26.39 24.245 23.3 26.064999999999998 25-29 26.965 24.404999999999998 22.88 25.75 30-34 26.474999999999998 24.535 23.135 25.855 35-39 26.255 24.765 23.01 25.97 40-44 27.295 24.275 22.884999999999998 25.545 45-49 27.205000000000002 23.965 22.98 25.85 50-54 27.034999999999997 24.355 22.99 25.619999999999997 55-59 27.139999999999997 24.095 23.13 25.635 60-64 26.900000000000002 23.799999999999997 23.235 26.064999999999998 65-69 26.490000000000002 23.71 23.880000000000003 25.919999999999998 70-74 26.93 23.52 23.705000000000002 25.845000000000002 75-79 26.884999999999998 23.95 23.195 25.97 80-84 26.695 23.57 23.735 26.0 85-89 27.065 23.395 23.485 26.055 90-94 26.490000000000002 24.375 23.52 25.615 95-99 26.625 23.915 23.935000000000002 25.525 100-104 27.060000000000002 24.435000000000002 23.05 25.455 105-109 27.67 24.215 23.330000000000002 24.785 110-114 27.534999999999997 24.255 23.615 24.595 115-119 27.189999999999998 24.635 23.365 24.81 120-124 28.060000000000002 24.855 22.86 24.224999999999998 125-129 28.065 24.67 23.135 24.13 130-134 27.515 25.224999999999998 23.115 24.145 135-139 27.76 25.169999999999998 23.625 23.445 140-144 28.910000000000004 24.705 23.150000000000002 23.235 145-149 28.17 25.44 23.52 22.869999999999997 150-151 29.1875 25.7375 23.4375 21.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 2.5 28 2.5 29 1.5 30 1.5 31 5.0 32 7.5 33 11.0 34 15.0 35 25.5 36 30.0 37 36.0 38 55.5 39 70.5 40 90.0 41 116.5 42 130.5 43 130.0 44 137.0 45 155.0 46 162.0 47 148.0 48 151.0 49 156.0 50 153.5 51 141.5 52 129.5 53 118.0 54 100.0 55 96.0 56 101.0 57 102.5 58 109.5 59 126.5 60 108.0 61 93.5 62 115.0 63 116.0 64 100.0 65 92.0 66 83.5 67 82.5 68 82.5 69 61.5 70 48.0 71 48.5 72 44.5 73 35.0 74 18.5 75 12.5 76 10.5 77 9.0 78 7.0 79 3.5 80 1.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83278355747272 97.375 2 0.9388480081197667 1.8499999999999999 3 0.1522456229383405 0.44999999999999996 4 0.050748540979446845 0.2 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.4000000000000004 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.05 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.8 0.0 0.0 0.0 0.0 112-113 4.325 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.125 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.2 0.0 0.0 0.0 0.0 122-123 6.75 0.0 0.0 0.0 0.0 124-125 7.375 0.0 0.0 0.0 0.0 126-127 8.0 0.0 0.0 0.0 0.0 128-129 8.625 0.0 0.0 0.0 0.0 130-131 9.162500000000001 0.0 0.0 0.0 0.0 132-133 9.85 0.0 0.0 0.0 0.0 134-135 10.325 0.0 0.0 0.0 0.0 136-137 10.7625 0.0 0.0 0.0 0.0 138-139 11.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447498 spots for SRR5579211.sra Written 1447498 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra Read 1447479 spots for SRR5579211.sra Written 1447479 spots for SRR5579211.sra SRR ids: ['SRR5579211.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_efqk57bx SRR5579211.sra spots: 28949599 blocks: [[1, 1447479], [1447480, 2894958], [2894959, 4342437], [4342438, 5789916], [5789917, 7237395], [7237396, 8684874], [8684875, 10132353], [10132354, 11579832], [11579833, 13027311], [13027312, 14474790], [14474791, 15922269], [15922270, 17369748], [17369749, 18817227], [18817228, 20264706], [20264707, 21712185], [21712186, 23159664], [23159665, 24607143], [24607144, 26054622], [26054623, 27502101], [27502102, 28949599]] SRR5579211 file size 9788368 SRR5579211 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579211 SRR5579211_1.fastq SRR5579211_2.fastq Input file: SRR5579211_1.fastq Paired file: SRR5579211_2.fastq trimmed: SRR5579211-trimmed-pair1.fastq, SRR5579211-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:23:05 2024 >> started Mon Dec 9 22:23:41 2024 >> done (35.689s) 28949599 read pairs processed; of these: 59501 ( 0.21%) short read pairs filtered out after trimming by size control 65377 ( 0.23%) empty read pairs filtered out after trimming by size control 28824721 (99.57%) read pairs available; of these: 12945220 (44.91%) trimmed read pairs available after processing 15879501 (55.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 22 0.00% 20 16 0.00% 21 14 0.00% 22 15 0.00% 23 32 0.00% 24 24 0.00% 25 21 0.00% 26 24 0.00% 27 33 0.00% 28 26 0.00% 29 25 0.00% 30 39 0.00% 31 32 0.00% 32 34 0.00% 33 41 0.00% 34 36 0.00% 35 60 0.00% 36 48 0.00% 37 67 0.00% 38 67 0.00% 39 86 0.00% 40 78 0.00% 41 103 0.00% 42 104 0.00% 43 106 0.00% 44 125 0.00% 45 156 0.00% 46 187 0.00% 47 174 0.00% 48 221 0.00% 49 262 0.00% 50 290 0.00% 51 330 0.00% 52 340 0.00% 53 426 0.00% 54 452 0.00% 55 517 0.00% 56 556 0.00% 57 658 0.00% 58 778 0.00% 59 883 0.00% 60 1028 0.00% 61 1185 0.00% 62 1290 0.00% 63 1459 0.01% 64 1538 0.01% 65 1654 0.01% 66 2022 0.01% 67 2301 0.01% 68 2637 0.01% 69 3182 0.01% 70 3958 0.01% 71 4566 0.02% 72 4874 0.02% 73 5271 0.02% 74 5713 0.02% 75 6304 0.02% 76 6759 0.02% 77 7521 0.03% 78 8532 0.03% 79 9506 0.03% 80 10543 0.04% 81 12326 0.04% 82 13902 0.05% 83 15042 0.05% 84 18809 0.07% 85 21163 0.07% 86 21320 0.07% 87 22753 0.08% 88 24343 0.08% 89 25452 0.09% 90 27371 0.09% 91 29612 0.10% 92 31067 0.11% 93 34391 0.12% 94 35867 0.12% 95 37424 0.13% 96 38322 0.13% 97 39575 0.14% 98 40765 0.14% 99 43307 0.15% 100 45252 0.16% 101 48143 0.17% 102 50827 0.18% 103 54120 0.19% 104 55307 0.19% 105 57460 0.20% 106 59355 0.21% 107 59288 0.21% 108 62096 0.22% 109 63149 0.22% 110 64710 0.22% 111 68012 0.24% 112 71833 0.25% 113 74786 0.26% 114 77845 0.27% 115 80367 0.28% 116 81084 0.28% 117 82797 0.29% 118 82947 0.29% 119 84894 0.29% 120 87715 0.30% 121 90499 0.31% 122 92975 0.32% 123 97604 0.34% 124 102304 0.35% 125 103558 0.36% 126 106511 0.37% 127 105984 0.37% 128 107534 0.37% 129 110447 0.38% 130 111268 0.39% 131 114552 0.40% 132 120680 0.42% 133 124810 0.43% 134 129241 0.45% 135 135149 0.47% 136 137689 0.48% 137 141672 0.49% 138 145652 0.51% 139 150022 0.52% 140 155918 0.54% 141 165160 0.57% 142 176059 0.61% 143 190463 0.66% 144 211968 0.74% 145 240349 0.83% 146 285150 0.99% 147 360476 1.25% 148 507898 1.76% 149 948380 3.29% 150 5431087 18.84% 151 15879501 55.09% 28824721 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=18 prefix-density=1.02 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=32 fanout-score=27.44 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=9.9 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=9 prefix-density=0.83 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=21.75 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=AAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR5579211 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:24:31 Started mapping on | Dec 09 22:24:31 Finished on | Dec 09 22:29:59 Mapping speed, Million of reads per hour | 316.37 Number of input reads | 28824721 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 26382465 Uniquely mapped reads % | 91.53% Average mapped length | 290.56 Number of splices: Total | 27190459 Number of splices: Annotated (sjdb) | 25710363 Number of splices: GT/AG | 26842366 Number of splices: GC/AG | 320010 Number of splices: AT/AC | 12012 Number of splices: Non-canonical | 16071 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451997 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 89097 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.84% % of reads unmapped: other | 1.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2025925 2025925 2025925 N_multimapping 451997 451997 451997 N_noFeature 857248 25598100 1096758 N_ambiguous 640272 3535 96119 UnstrandedReadsAssigned:24884945 PositiveStrandReadsAssigned:780830 NegativeStrandReadsAssigned:25189588 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579211 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579211-trimmed-pair1.fastq SRR5579211-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,824,721 reads, 25,354,484 reads pseudoaligned [quant] estimated average fragment length: 247.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR5579211.ke.tsv 35125 SRR5579211.se.tsv 88098 total ==> SRR5579211.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.434 0 0 PNS24247 1044 797.943 63.3441 4.1707 PNS24249 1928 1681.94 108.22 3.38041 PNS24246 1044 797.943 63.3441 4.1707 PNS24248 1044 797.943 63.3441 4.1707 PNS24244 1471 1224.94 85.7483 3.67777 PNS24243 293 104.972 0 0 KQK14069 1603 1356.94 4265.1 165.136 KQK14071 474 247.588 151.383 32.1233 ==> SRR5579211.se.tsv <== BRADI_1g14170v3 4831 BRADI_1g53295v3 57 BRADI_1g59795v3 740 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 4304 BRADI_1g74790v3 112 BRADI_1g09890v3 11 BRADI_1g77505v3 364 BRADI_1g48960v3 0 SRR5579211 completed mapping pipeline successfully