Starting /dee2/code/volunteer_pipeline.sh SRR5579213 current disk space = 1522815508480 free memory = 1393105280 SRR5579213 SRAfilesize 84e62a06bc5aa7ecaf67fe0eed1c9756 SRR5579213.sra SRR5579213.sra file validated SRR5579213 is paired end SRR5579213 is conventional basespace SRR5579213 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579213_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.8385 34.0 33.0 34.0 2.0 34.0 2 32.38325 34.0 33.0 34.0 28.0 34.0 3 32.662 34.0 33.0 34.0 28.0 34.0 4 33.007 34.0 33.0 34.0 32.0 34.0 5 33.08 34.0 33.0 34.0 32.0 34.0 6 36.76725 38.0 37.0 38.0 35.0 38.0 7 37.25125 38.0 38.0 38.0 36.0 38.0 8 37.2565 38.0 38.0 38.0 37.0 38.0 9 37.34275 38.0 38.0 38.0 37.0 38.0 10-14 37.299200000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.29285 38.0 38.0 38.0 37.0 38.0 20-24 37.2414 38.0 38.0 38.0 36.8 38.0 25-29 37.22775 38.0 38.0 38.0 36.4 38.0 30-34 37.15835 38.0 38.0 38.0 36.0 38.0 35-39 37.15 38.0 38.0 38.0 36.2 38.0 40-44 36.8387 38.0 38.0 38.0 35.2 38.0 45-49 36.8556 38.0 38.0 38.0 35.0 38.0 50-54 36.762249999999995 38.0 38.0 38.0 34.8 38.0 55-59 36.71085000000001 38.0 38.0 38.0 34.6 38.0 60-64 36.6668 38.0 38.0 38.0 34.2 38.0 65-69 36.611200000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.4872 38.0 38.0 38.0 34.0 38.0 75-79 36.4442 38.0 38.0 38.0 33.8 38.0 80-84 36.416599999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.2765 38.0 37.8 38.0 33.2 38.0 90-94 36.26845 38.0 37.0 38.0 33.4 38.0 95-99 36.1699 38.0 37.2 38.0 33.0 38.0 100-104 35.873200000000004 38.0 37.0 38.0 31.6 38.0 105-109 35.79695 38.0 37.0 38.0 31.8 38.0 110-114 35.49184999999999 38.0 36.2 38.0 30.2 38.0 115-119 35.290749999999996 38.0 35.6 38.0 29.6 38.0 120-124 35.0818 38.0 35.8 38.0 28.2 38.0 125-129 34.634499999999996 38.0 34.8 38.0 26.4 38.0 130-134 34.60095 38.0 35.0 38.0 26.2 38.0 135-139 34.52075 38.0 35.0 38.0 26.4 38.0 140-144 34.0886 38.0 35.0 38.0 23.4 38.0 145-149 33.2596 38.0 34.0 38.0 18.2 38.0 150-151 29.73275 36.0 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 3.0 18 7.0 19 5.0 20 7.0 21 8.0 22 11.0 23 8.0 24 17.0 25 19.0 26 30.0 27 36.0 28 44.0 29 40.0 30 68.0 31 78.0 32 91.0 33 110.0 34 182.0 35 310.0 36 744.0 37 2178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.943494639235006 14.14082874529122 10.460736018545349 30.454940596928427 2 23.974999999999998 18.75 33.074999999999996 24.2 3 21.7 25.8 23.925 28.575 4 27.700000000000003 32.4 20.625 19.275000000000002 5 26.724999999999998 32.05 21.925 19.3 6 21.45 34.0 22.5 22.05 7 16.425 19.425 42.675000000000004 21.475 8 20.150000000000002 20.150000000000002 27.450000000000003 32.25 9 20.575 18.4 31.724999999999998 29.299999999999997 10-14 23.005 25.97 24.88 26.145000000000003 15-19 23.22 25.31 25.705 25.765 20-24 23.01 25.34 25.840000000000003 25.81 25-29 23.355 25.905 25.245 25.495 30-34 23.165 25.165 25.905 25.765 35-39 23.59 24.990000000000002 25.590000000000003 25.83 40-44 23.400000000000002 24.72 26.07 25.81 45-49 23.52 25.34 25.715 25.424999999999997 50-54 23.265 25.435000000000002 24.95 26.35 55-59 22.905 25.240000000000002 25.569999999999997 26.284999999999997 60-64 23.775 25.014999999999997 25.61 25.6 65-69 23.965 25.124999999999996 25.085 25.825 70-74 23.71 25.21 25.585 25.495 75-79 23.775 25.1 25.629999999999995 25.495 80-84 24.065 24.490000000000002 25.545 25.900000000000002 85-89 24.04 24.86 25.575 25.525 90-94 23.82 24.605 25.825 25.75 95-99 23.845 24.685000000000002 25.705 25.765 100-104 23.9 25.005 24.925 26.169999999999998 105-109 24.925 24.635 25.03 25.41 110-114 24.240000000000002 25.045 24.88 25.835 115-119 24.36 24.73 25.255 25.655 120-124 24.09 25.650000000000002 24.62 25.64 125-129 24.095 25.480000000000004 24.565 25.86 130-134 23.885 24.66 25.56 25.895000000000003 135-139 23.685000000000002 25.415 24.645 26.255 140-144 23.810000000000002 24.915000000000003 24.555 26.72 145-149 23.765 25.264999999999997 24.779999999999998 26.19 150-151 23.0125 25.587500000000002 24.2375 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 5.5 29 7.0 30 7.0 31 8.0 32 14.5 33 26.5 34 32.5 35 42.5 36 49.5 37 62.0 38 86.5 39 103.5 40 132.0 41 154.0 42 163.5 43 180.5 44 189.0 45 190.0 46 192.0 47 197.0 48 188.0 49 166.0 50 153.0 51 150.0 52 131.0 53 118.0 54 118.0 55 105.5 56 92.5 57 90.5 58 97.0 59 95.0 60 79.5 61 61.0 62 51.5 63 63.0 64 63.5 65 48.5 66 40.0 67 38.5 68 41.0 69 34.0 70 27.5 71 25.5 72 23.5 73 17.0 74 10.0 75 7.5 76 7.5 77 4.0 78 2.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.725000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.55 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.3375 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.1875 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.6125 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.5 0.0 0.0 0.0 0.0 126-127 7.075 0.0 0.0 0.0 0.0 128-129 7.575 0.0 0.0 0.0 0.0 130-131 8.1875 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.175 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATGC 10 0.0068519996 144.85 6 TGTAATT 10 0.0068519996 144.85 7 >>END_MODULE SRR5579213 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579213_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5225 33.0 33.0 34.0 32.0 34.0 2 32.615 33.0 33.0 34.0 32.0 34.0 3 32.61375 33.0 33.0 34.0 32.0 34.0 4 32.4655 33.0 33.0 34.0 31.0 34.0 5 32.54025 33.0 33.0 34.0 32.0 34.0 6 36.73275 38.0 38.0 38.0 35.0 38.0 7 36.593 38.0 38.0 38.0 35.0 38.0 8 36.74775 38.0 38.0 38.0 35.0 38.0 9 36.643 38.0 38.0 38.0 35.0 38.0 10-14 36.6856 38.0 38.0 38.0 35.0 38.0 15-19 36.6607 38.0 38.0 38.0 35.0 38.0 20-24 36.597699999999996 38.0 38.0 38.0 35.0 38.0 25-29 36.397749999999995 38.0 38.0 38.0 34.0 38.0 30-34 36.61385 38.0 38.0 38.0 35.0 38.0 35-39 36.623400000000004 38.0 38.0 38.0 35.2 38.0 40-44 36.587199999999996 38.0 38.0 38.0 35.2 38.0 45-49 36.44585 38.0 38.0 38.0 34.2 38.0 50-54 36.484950000000005 38.0 38.0 38.0 34.8 38.0 55-59 36.46235 38.0 38.0 38.0 34.6 38.0 60-64 36.315 38.0 38.0 38.0 33.8 38.0 65-69 36.337149999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.2754 38.0 38.0 38.0 34.0 38.0 75-79 36.224450000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.1423 38.0 38.0 38.0 33.6 38.0 85-89 36.10865 38.0 38.0 38.0 33.8 38.0 90-94 35.654 38.0 37.6 38.0 31.4 38.0 95-99 35.83820000000001 38.0 38.0 38.0 32.6 38.0 100-104 35.68955 38.0 37.8 38.0 31.6 38.0 105-109 35.63975 38.0 37.8 38.0 32.0 38.0 110-114 35.4686 38.0 37.4 38.0 31.0 38.0 115-119 35.22945 38.0 37.0 38.0 29.4 38.0 120-124 35.024950000000004 38.0 36.0 38.0 28.2 38.0 125-129 34.856199999999994 38.0 36.0 38.0 28.0 38.0 130-134 34.47109999999999 38.0 35.0 38.0 24.2 38.0 135-139 34.2192 38.0 35.0 38.0 23.8 38.0 140-144 33.810950000000005 38.0 35.0 38.0 21.8 38.0 145-149 32.95185 38.0 34.2 38.0 12.8 38.0 150-151 28.913125 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 7.0 4 3.0 5 1.0 6 1.0 7 3.0 8 3.0 9 4.0 10 0.0 11 1.0 12 3.0 13 3.0 14 2.0 15 9.0 16 7.0 17 5.0 18 6.0 19 7.0 20 12.0 21 6.0 22 13.0 23 17.0 24 23.0 25 21.0 26 29.0 27 37.0 28 50.0 29 36.0 30 55.0 31 88.0 32 63.0 33 92.0 34 138.0 35 256.0 36 504.0 37 2480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.65 15.225 11.575000000000001 28.549999999999997 2 29.025000000000002 20.849999999999998 28.525 21.6 3 24.3 25.074999999999996 26.1 24.525 4 26.875 31.95 18.35 22.825 5 27.725 32.6 19.325 20.349999999999998 6 22.05 35.25 18.525 24.175 7 20.5 15.2 37.475 26.825 8 22.925 20.275000000000002 23.7 33.1 9 24.675 20.825 25.025 29.475 10-14 25.6 25.345000000000002 23.294999999999998 25.759999999999998 15-19 26.085 24.555 23.605 25.755 20-24 25.77 25.16 24.44 24.63 25-29 26.115 25.374999999999996 23.98 24.529999999999998 30-34 25.865 24.985 24.165 24.985 35-39 25.740000000000002 24.93 23.825 25.505 40-44 26.174999999999997 24.995 23.549999999999997 25.28 45-49 26.169999999999998 24.58 23.87 25.380000000000003 50-54 25.985000000000003 25.06 24.395 24.560000000000002 55-59 26.58 25.230000000000004 23.605 24.585 60-64 26.229999999999997 24.98 24.525 24.265 65-69 26.700000000000003 25.205 24.125 23.97 70-74 26.295 24.685000000000002 23.905 25.115 75-79 26.095000000000002 24.935 23.775 25.195 80-84 26.355 24.545 24.16 24.94 85-89 26.619999999999997 25.169999999999998 24.455 23.755000000000003 90-94 25.705 24.595 24.79 24.91 95-99 26.834999999999997 25.619999999999997 24.02 23.525 100-104 26.515 24.97 24.224999999999998 24.29 105-109 26.22 25.27 24.709999999999997 23.799999999999997 110-114 26.484999999999996 25.845000000000002 23.724999999999998 23.945 115-119 26.57 25.590000000000003 23.935000000000002 23.905 120-124 26.995 24.895 24.18 23.93 125-129 26.995 25.805 23.419999999999998 23.78 130-134 27.52 25.735000000000003 23.925 22.82 135-139 27.655 25.75 23.9 22.695 140-144 27.279999999999998 26.435 23.69 22.595000000000002 145-149 27.455000000000002 26.255 24.18 22.11 150-151 27.6375 27.05 22.9625 22.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 3.0 28 3.5 29 4.0 30 7.0 31 9.5 32 9.0 33 10.5 34 16.5 35 30.0 36 38.5 37 43.0 38 63.5 39 88.5 40 112.5 41 125.5 42 142.0 43 163.5 44 169.0 45 174.0 46 178.0 47 177.5 48 172.0 49 162.5 50 144.0 51 127.0 52 138.0 53 142.0 54 125.5 55 106.0 56 93.0 57 93.5 58 102.0 59 113.0 60 100.5 61 87.5 62 87.0 63 77.5 64 73.0 65 67.5 66 68.5 67 69.0 68 56.0 69 42.5 70 41.0 71 40.0 72 30.5 73 23.5 74 15.5 75 11.5 76 9.0 77 7.0 78 4.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29310780106034 98.32499999999999 2 0.555415299166877 1.0999999999999999 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025246149962130777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5249999999999999 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.6 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3499999999999996 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.2375 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.3125 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.175 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.274999999999999 0.0 0.0 0.0 0.0 132-133 8.7625 0.0 0.0 0.0 0.0 134-135 9.2375 0.0 0.0 0.0 0.0 136-137 10.0125 0.0 0.0 0.0 0.0 138-139 10.587499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTC 10 0.006830828 145.0 7 GATGAAG 10 0.006830828 145.0 5 AGATGAA 10 0.006830828 145.0 4 ACTATGC 10 0.006830828 145.0 5 >>END_MODULE Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra Read 1520253 spots for SRR5579213.sra Written 1520253 spots for SRR5579213.sra SRR ids: ['SRR5579213.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4xsvka8u SRR5579213.sra spots: 30405060 blocks: [[1, 1520253], [1520254, 3040506], [3040507, 4560759], [4560760, 6081012], [6081013, 7601265], [7601266, 9121518], [9121519, 10641771], [10641772, 12162024], [12162025, 13682277], [13682278, 15202530], [15202531, 16722783], [16722784, 18243036], [18243037, 19763289], [19763290, 21283542], [21283543, 22803795], [22803796, 24324048], [24324049, 25844301], [25844302, 27364554], [27364555, 28884807], [28884808, 30405060]] SRR5579213 file size 10281576 SRR5579213 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579213 SRR5579213_1.fastq SRR5579213_2.fastq Input file: SRR5579213_1.fastq Paired file: SRR5579213_2.fastq trimmed: SRR5579213-trimmed-pair1.fastq, SRR5579213-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:27:12 2024 >> started Mon Dec 9 22:28:05 2024 >> done (52.460s) 30405060 read pairs processed; of these: 60504 ( 0.20%) short read pairs filtered out after trimming by size control 58662 ( 0.19%) empty read pairs filtered out after trimming by size control 30285894 (99.61%) read pairs available; of these: 13632668 (45.01%) trimmed read pairs available after processing 16653226 (54.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 19 0.00% 20 15 0.00% 21 19 0.00% 22 12 0.00% 23 19 0.00% 24 17 0.00% 25 22 0.00% 26 15 0.00% 27 35 0.00% 28 29 0.00% 29 14 0.00% 30 30 0.00% 31 25 0.00% 32 33 0.00% 33 31 0.00% 34 28 0.00% 35 39 0.00% 36 46 0.00% 37 43 0.00% 38 51 0.00% 39 72 0.00% 40 69 0.00% 41 71 0.00% 42 97 0.00% 43 88 0.00% 44 83 0.00% 45 132 0.00% 46 127 0.00% 47 166 0.00% 48 179 0.00% 49 197 0.00% 50 229 0.00% 51 266 0.00% 52 280 0.00% 53 337 0.00% 54 363 0.00% 55 388 0.00% 56 455 0.00% 57 537 0.00% 58 594 0.00% 59 680 0.00% 60 794 0.00% 61 950 0.00% 62 1014 0.00% 63 1174 0.00% 64 1285 0.00% 65 1395 0.00% 66 1583 0.01% 67 1863 0.01% 68 2078 0.01% 69 2568 0.01% 70 2969 0.01% 71 3296 0.01% 72 3839 0.01% 73 4265 0.01% 74 4609 0.02% 75 5105 0.02% 76 5560 0.02% 77 6403 0.02% 78 7246 0.02% 79 8126 0.03% 80 9144 0.03% 81 10520 0.03% 82 11842 0.04% 83 13179 0.04% 84 16554 0.05% 85 18659 0.06% 86 19296 0.06% 87 20548 0.07% 88 21620 0.07% 89 22911 0.08% 90 25266 0.08% 91 27299 0.09% 92 29005 0.10% 93 31040 0.10% 94 33212 0.11% 95 34627 0.11% 96 36167 0.12% 97 37761 0.12% 98 38677 0.13% 99 41425 0.14% 100 43485 0.14% 101 46276 0.15% 102 48768 0.16% 103 51661 0.17% 104 53480 0.18% 105 55612 0.18% 106 57259 0.19% 107 58747 0.19% 108 60372 0.20% 109 62347 0.21% 110 64710 0.21% 111 67708 0.22% 112 71445 0.24% 113 74097 0.24% 114 77810 0.26% 115 80334 0.27% 116 81055 0.27% 117 82898 0.27% 118 83818 0.28% 119 85913 0.28% 120 88480 0.29% 121 91657 0.30% 122 95414 0.32% 123 99453 0.33% 124 103870 0.34% 125 106152 0.35% 126 118362 0.39% 127 100650 0.33% 128 110758 0.37% 129 113835 0.38% 130 116131 0.38% 131 119545 0.39% 132 126022 0.42% 133 130845 0.43% 134 135894 0.45% 135 143648 0.47% 136 147973 0.49% 137 153221 0.51% 138 159891 0.53% 139 155908 0.51% 140 163661 0.54% 141 175089 0.58% 142 190100 0.63% 143 206791 0.68% 144 232773 0.77% 145 265149 0.88% 146 315828 1.04% 147 401808 1.33% 148 571373 1.89% 149 1054943 3.48% 150 5758806 19.01% 151 16653226 54.99% 30285894 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=25 fanout-score=12.83 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=2.0 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGCTTGGTCTGATCTGGATTAAGATTTTTCAGATGATCAAGT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=20 prefix-density=0.70 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=97.72 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579213 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:29:07 Started mapping on | Dec 09 22:29:08 Finished on | Dec 09 22:33:13 Mapping speed, Million of reads per hour | 445.02 Number of input reads | 30285894 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 28463426 Uniquely mapped reads % | 93.98% Average mapped length | 291.17 Number of splices: Total | 31306067 Number of splices: Annotated (sjdb) | 29453464 Number of splices: GT/AG | 30889015 Number of splices: GC/AG | 381389 Number of splices: AT/AC | 15485 Number of splices: Non-canonical | 20178 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442795 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 48133 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 1.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1417031 1417031 1417031 N_multimapping 442795 442795 442795 N_noFeature 1136976 27604846 1466029 N_ambiguous 639796 4824 110820 UnstrandedReadsAssigned:26686654 PositiveStrandReadsAssigned:853756 NegativeStrandReadsAssigned:26886577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579213 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579213-trimmed-pair1.fastq SRR5579213-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,285,894 reads, 27,133,860 reads pseudoaligned [quant] estimated average fragment length: 259.186 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR5579213.ke.tsv 35125 SRR5579213.se.tsv 88098 total ==> SRR5579213.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.503 0 0 PNS24247 1044 785.814 80.3061 5.42483 PNS24249 1928 1669.81 93.3591 2.96788 PNS24246 1044 785.814 80.3061 5.42483 PNS24248 1044 785.814 80.3061 5.42483 PNS24244 1471 1212.81 168.723 7.38478 PNS24243 293 102.316 0 0 KQK14069 1603 1344.81 8254.93 325.844 KQK14071 474 241.096 217.008 47.7797 ==> SRR5579213.se.tsv <== BRADI_1g14170v3 9465 BRADI_1g53295v3 224 BRADI_1g59795v3 588 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 3500 BRADI_1g74790v3 242 BRADI_1g09890v3 3 BRADI_1g77505v3 481 BRADI_1g48960v3 1 SRR5579213 completed mapping pipeline successfully