Starting /dee2/code/volunteer_pipeline.sh SRR5579214 current disk space = 1522832809984 free memory = 1571156524 SRR5579214 SRAfilesize 32980cc017d710acedb385be1f7982eb SRR5579214.sra SRR5579214.sra file validated SRR5579214 is paired end SRR5579214 is conventional basespace SRR5579214 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579214_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.505 34.0 32.0 34.0 2.0 34.0 2 32.2555 34.0 32.0 34.0 27.0 34.0 3 32.473 34.0 32.0 34.0 28.0 34.0 4 32.87825 34.0 33.0 34.0 32.0 34.0 5 32.989 34.0 33.0 34.0 32.0 34.0 6 36.664 38.0 37.0 38.0 34.0 38.0 7 37.036 38.0 38.0 38.0 36.0 38.0 8 37.2085 38.0 38.0 38.0 36.0 38.0 9 37.206 38.0 38.0 38.0 36.0 38.0 10-14 37.198600000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.199 38.0 38.0 38.0 36.6 38.0 20-24 37.152699999999996 38.0 38.0 38.0 36.0 38.0 25-29 37.1501 38.0 38.0 38.0 36.2 38.0 30-34 37.0864 38.0 38.0 38.0 36.0 38.0 35-39 37.02915 38.0 38.0 38.0 35.8 38.0 40-44 36.731399999999994 38.0 38.0 38.0 34.8 38.0 45-49 36.645399999999995 38.0 38.0 38.0 34.2 38.0 50-54 36.62555 38.0 38.0 38.0 34.2 38.0 55-59 36.521049999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.5313 38.0 38.0 38.0 34.0 38.0 65-69 36.384249999999994 38.0 38.0 38.0 33.8 38.0 70-74 36.2827 38.0 37.6 38.0 33.4 38.0 75-79 36.3023 38.0 37.8 38.0 33.6 38.0 80-84 36.2031 38.0 37.4 38.0 33.4 38.0 85-89 36.0869 38.0 37.0 38.0 32.8 38.0 90-94 35.93925 38.0 37.0 38.0 32.2 38.0 95-99 35.8265 38.0 37.0 38.0 32.0 38.0 100-104 35.60245 38.0 36.0 38.0 30.6 38.0 105-109 35.45825000000001 38.0 36.0 38.0 30.0 38.0 110-114 35.2182 38.0 36.0 38.0 29.0 38.0 115-119 35.0947 38.0 35.8 38.0 28.2 38.0 120-124 34.77145 38.0 35.0 38.0 27.2 38.0 125-129 34.327600000000004 38.0 34.8 38.0 24.8 38.0 130-134 34.2928 38.0 34.8 38.0 23.8 38.0 135-139 34.1973 38.0 35.0 38.0 23.6 38.0 140-144 33.596 38.0 34.0 38.0 21.4 38.0 145-149 32.958000000000006 38.0 34.0 38.0 15.6 38.0 150-151 29.2865 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 2.0 15 3.0 16 3.0 17 3.0 18 10.0 19 7.0 20 4.0 21 8.0 22 7.0 23 15.0 24 19.0 25 22.0 26 25.0 27 32.0 28 38.0 29 64.0 30 61.0 31 95.0 32 117.0 33 137.0 34 186.0 35 312.0 36 804.0 37 2018.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.710102489019036 13.704245973645682 9.985358711566619 30.600292825768665 2 25.55 18.075 32.475 23.9 3 22.475 25.374999999999996 24.325 27.825 4 25.8 31.8 20.625 21.775 5 25.124999999999996 33.550000000000004 21.099999999999998 20.225 6 21.875 32.925 22.175 23.025000000000002 7 17.95 20.474999999999998 38.324999999999996 23.25 8 20.275000000000002 20.925 28.349999999999998 30.45 9 22.45 20.175 29.275000000000002 28.1 10-14 23.825 25.645 24.8 25.729999999999997 15-19 24.055 24.93 25.840000000000003 25.174999999999997 20-24 23.855 25.285000000000004 25.374999999999996 25.485000000000003 25-29 23.61 25.46 25.195 25.735000000000003 30-34 23.44 25.95 24.805 25.805 35-39 24.099999999999998 25.2 24.37 26.33 40-44 24.04 25.215 25.61 25.135 45-49 24.13 25.445 24.625 25.8 50-54 23.830000000000002 24.845 25.215 26.11 55-59 24.265 25.4 25.165 25.169999999999998 60-64 24.62 25.080000000000002 24.4 25.900000000000002 65-69 24.205 25.56 24.605 25.629999999999995 70-74 24.315 25.56 24.16 25.965 75-79 24.37 24.88 24.855 25.895000000000003 80-84 23.655 24.8 25.679999999999996 25.865 85-89 24.42 25.119999999999997 24.365000000000002 26.095000000000002 90-94 24.165 25.28 24.735 25.82 95-99 24.455 24.725 25.0 25.82 100-104 24.959999999999997 24.85 25.115 25.074999999999996 105-109 24.82 24.665 24.68 25.835 110-114 24.43 24.48 24.79 26.3 115-119 24.585 25.15 24.84 25.424999999999997 120-124 24.875 25.290000000000003 24.060000000000002 25.775 125-129 24.69 24.595 24.84 25.874999999999996 130-134 25.215 25.040000000000003 24.245 25.5 135-139 24.715 24.97 24.19 26.125 140-144 25.330000000000002 25.014999999999997 24.05 25.605 145-149 24.675 25.255 24.015 26.055 150-151 25.7625 24.8125 23.4625 25.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 1.0 28 2.5 29 2.5 30 5.5 31 10.5 32 12.5 33 17.0 34 27.5 35 42.5 36 57.5 37 61.0 38 78.5 39 103.5 40 116.0 41 140.5 42 156.5 43 153.5 44 163.0 45 176.0 46 174.5 47 183.0 48 195.5 49 184.5 50 155.0 51 151.0 52 153.0 53 143.0 54 126.5 55 110.0 56 110.5 57 101.0 58 94.5 59 85.5 60 78.0 61 76.5 62 69.5 63 65.5 64 63.5 65 58.5 66 51.0 67 45.0 68 40.0 69 33.5 70 25.0 71 24.5 72 20.0 73 12.0 74 10.5 75 9.0 76 9.0 77 5.0 78 1.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0125 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.1 0.0 0.0 0.0 0.025 82-83 0.1375 0.0 0.0 0.0 0.025 84-85 0.21250000000000002 0.0 0.0 0.0 0.025 86-87 0.3375 0.0 0.0 0.0 0.025 88-89 0.3625 0.0 0.0 0.0 0.025 90-91 0.45 0.0 0.0 0.0 0.025 92-93 0.6 0.0 0.0 0.0 0.025 94-95 0.6625 0.0 0.0 0.0 0.025 96-97 0.8500000000000001 0.0 0.0 0.0 0.025 98-99 1.05 0.0 0.0 0.0 0.025 100-101 1.1375000000000002 0.0 0.0 0.0 0.025 102-103 1.2999999999999998 0.0 0.0 0.0 0.025 104-105 1.575 0.0 0.0 0.0 0.025 106-107 1.7625000000000002 0.0 0.0 0.0 0.025 108-109 1.9625 0.0 0.0 0.0 0.025 110-111 2.2625 0.0 0.0 0.0 0.025 112-113 2.55 0.0 0.0 0.0 0.025 114-115 2.825 0.0 0.0 0.0 0.025 116-117 2.975 0.0 0.0 0.0 0.025 118-119 3.2125 0.0 0.0 0.0 0.025 120-121 3.675 0.0 0.0 0.0 0.025 122-123 4.3125 0.0 0.0 0.0 0.025 124-125 4.7875 0.0 0.0 0.0 0.025 126-127 5.3375 0.0 0.0 0.0 0.025 128-129 5.862500000000001 0.0 0.0 0.0 0.025 130-131 6.625 0.0 0.0 0.0 0.025 132-133 7.3375 0.0 0.0 0.0 0.025 134-135 8.05 0.0 0.0 0.0 0.025 136-137 8.6375 0.0 0.0 0.0 0.025 138-139 9.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACACT 10 0.0068484643 144.875 9 >>END_MODULE SRR5579214 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579214_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.472 33.0 33.0 34.0 32.0 34.0 2 32.55425 33.0 33.0 34.0 31.0 34.0 3 32.53825 33.0 33.0 34.0 31.0 34.0 4 32.32325 33.0 33.0 34.0 31.0 34.0 5 32.36975 33.0 33.0 34.0 31.0 34.0 6 36.55825 38.0 38.0 38.0 34.0 38.0 7 36.431 38.0 38.0 38.0 34.0 38.0 8 36.48675 38.0 38.0 38.0 34.0 38.0 9 36.382 38.0 38.0 38.0 34.0 38.0 10-14 36.476800000000004 38.0 38.0 38.0 34.2 38.0 15-19 36.43814999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.392649999999996 38.0 38.0 38.0 34.2 38.0 25-29 36.12265 38.0 38.0 38.0 33.0 38.0 30-34 36.392450000000004 38.0 38.0 38.0 34.6 38.0 35-39 36.3113 38.0 38.0 38.0 34.2 38.0 40-44 36.2846 38.0 38.0 38.0 34.2 38.0 45-49 36.216150000000006 38.0 38.0 38.0 34.0 38.0 50-54 36.19775 38.0 38.0 38.0 34.0 38.0 55-59 36.1988 38.0 38.0 38.0 34.0 38.0 60-64 36.1284 38.0 38.0 38.0 33.8 38.0 65-69 36.005 38.0 38.0 38.0 33.2 38.0 70-74 35.9272 38.0 38.0 38.0 33.0 38.0 75-79 35.88955 38.0 38.0 38.0 33.2 38.0 80-84 35.78065 38.0 38.0 38.0 32.2 38.0 85-89 35.656850000000006 38.0 38.0 38.0 31.4 38.0 90-94 35.16745 38.0 36.8 38.0 28.4 38.0 95-99 35.43725 38.0 37.4 38.0 31.0 38.0 100-104 35.25135 38.0 37.0 38.0 29.8 38.0 105-109 35.05405 38.0 37.0 38.0 28.8 38.0 110-114 34.97 38.0 36.0 38.0 28.2 38.0 115-119 34.81155 38.0 36.0 38.0 27.6 38.0 120-124 34.5172 38.0 35.8 38.0 25.8 38.0 125-129 34.35025 38.0 35.4 38.0 24.0 38.0 130-134 33.9528 38.0 35.0 38.0 22.2 38.0 135-139 33.651799999999994 38.0 35.0 38.0 18.6 38.0 140-144 33.326550000000005 38.0 34.8 38.0 15.4 38.0 145-149 32.43395 38.0 33.6 38.0 9.0 38.0 150-151 28.462625 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 13.0 4 8.0 5 7.0 6 2.0 7 4.0 8 2.0 9 1.0 10 3.0 11 8.0 12 5.0 13 7.0 14 5.0 15 14.0 16 8.0 17 9.0 18 3.0 19 11.0 20 9.0 21 7.0 22 10.0 23 12.0 24 24.0 25 25.0 26 33.0 27 27.0 28 38.0 29 50.0 30 64.0 31 90.0 32 81.0 33 119.0 34 157.0 35 272.0 36 551.0 37 2307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.9 15.5 12.0 26.6 2 28.1 21.875 27.450000000000003 22.575 3 23.799999999999997 24.525 26.775 24.9 4 28.175 30.225 18.325 23.275000000000002 5 26.125 34.125 18.075 21.675 6 22.575 32.65 20.4 24.375 7 21.425 15.85 36.5 26.224999999999998 8 23.05 19.675 23.674999999999997 33.6 9 23.9 22.875 23.45 29.775000000000002 10-14 24.88 25.224999999999998 23.405 26.490000000000002 15-19 25.66 24.985 24.075 25.28 20-24 25.55 24.755 23.830000000000002 25.865 25-29 25.729999999999997 24.7 23.935000000000002 25.635 30-34 25.5 24.665 24.165 25.669999999999998 35-39 25.305 24.81 24.33 25.555 40-44 25.485000000000003 24.69 24.240000000000002 25.585 45-49 25.71 25.185000000000002 23.93 25.174999999999997 50-54 25.545 25.35 23.810000000000002 25.295 55-59 25.8 24.715 24.125 25.36 60-64 25.75 24.23 24.404999999999998 25.615 65-69 25.0 25.34 24.654999999999998 25.005 70-74 25.845000000000002 24.610000000000003 24.205 25.34 75-79 25.785000000000004 24.490000000000002 24.345 25.380000000000003 80-84 26.939999999999998 24.75 23.65 24.66 85-89 26.405 25.040000000000003 23.79 24.765 90-94 25.945 25.069999999999997 24.224999999999998 24.759999999999998 95-99 26.145000000000003 24.279999999999998 24.84 24.735 100-104 26.26 24.495 24.57 24.675 105-109 25.790000000000003 24.92 24.11 25.180000000000003 110-114 26.35 25.3 24.115000000000002 24.235 115-119 26.295 25.41 23.849999999999998 24.445 120-124 26.415 25.135 24.505 23.945 125-129 26.355 25.005 24.645 23.995 130-134 27.315 25.629999999999995 23.45 23.605 135-139 27.155 25.595000000000002 23.98 23.27 140-144 27.295 25.2 23.855 23.65 145-149 27.625 25.424999999999997 23.94 23.01 150-151 26.7125 25.75 23.75 23.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 4.0 28 4.5 29 4.0 30 5.5 31 5.5 32 9.0 33 14.0 34 17.0 35 22.5 36 33.5 37 41.5 38 54.5 39 79.0 40 94.0 41 113.0 42 132.0 43 146.5 44 161.5 45 172.0 46 179.5 47 178.0 48 188.5 49 188.5 50 176.0 51 161.0 52 143.5 53 142.5 54 128.5 55 114.0 56 107.0 57 99.0 58 105.5 59 102.0 60 89.0 61 81.5 62 78.5 63 71.0 64 65.5 65 70.0 66 73.0 67 71.0 68 54.5 69 44.0 70 39.0 71 30.5 72 24.5 73 19.0 74 16.0 75 13.0 76 11.5 77 8.0 78 3.5 79 2.0 80 3.0 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.85 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.762499999999999 0.0 0.0 0.0 0.0 130-131 6.4875 0.0 0.0 0.0 0.0 132-133 7.1625 0.0 0.0 0.0 0.0 134-135 7.8375 0.0 0.0 0.0 0.0 136-137 8.4625 0.0 0.0 0.0 0.0 138-139 9.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAGC 10 0.006830828 145.0 1 GTGAACT 10 0.006830828 145.0 1 >>END_MODULE Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra Read 1510089 spots for SRR5579214.sra Written 1510089 spots for SRR5579214.sra SRR ids: ['SRR5579214.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dl__wi3p SRR5579214.sra spots: 30201780 blocks: [[1, 1510089], [1510090, 3020178], [3020179, 4530267], [4530268, 6040356], [6040357, 7550445], [7550446, 9060534], [9060535, 10570623], [10570624, 12080712], [12080713, 13590801], [13590802, 15100890], [15100891, 16610979], [16610980, 18121068], [18121069, 19631157], [19631158, 21141246], [21141247, 22651335], [22651336, 24161424], [24161425, 25671513], [25671514, 27181602], [27181603, 28691691], [28691692, 30201780]] SRR5579214 file size 10212691 SRR5579214 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579214 SRR5579214_1.fastq SRR5579214_2.fastq Input file: SRR5579214_1.fastq Paired file: SRR5579214_2.fastq trimmed: SRR5579214-trimmed-pair1.fastq, SRR5579214-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:30:19 2024 >> started Mon Dec 9 22:30:52 2024 >> done (33.095s) 30201780 read pairs processed; of these: 91623 ( 0.30%) short read pairs filtered out after trimming by size control 83136 ( 0.28%) empty read pairs filtered out after trimming by size control 30027021 (99.42%) read pairs available; of these: 13906749 (46.31%) trimmed read pairs available after processing 16120272 (53.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 9 0.00% 21 11 0.00% 22 16 0.00% 23 11 0.00% 24 18 0.00% 25 14 0.00% 26 15 0.00% 27 28 0.00% 28 17 0.00% 29 18 0.00% 30 29 0.00% 31 30 0.00% 32 24 0.00% 33 25 0.00% 34 34 0.00% 35 48 0.00% 36 37 0.00% 37 46 0.00% 38 63 0.00% 39 61 0.00% 40 68 0.00% 41 63 0.00% 42 86 0.00% 43 99 0.00% 44 95 0.00% 45 105 0.00% 46 136 0.00% 47 150 0.00% 48 173 0.00% 49 169 0.00% 50 218 0.00% 51 256 0.00% 52 275 0.00% 53 291 0.00% 54 292 0.00% 55 345 0.00% 56 430 0.00% 57 461 0.00% 58 560 0.00% 59 583 0.00% 60 684 0.00% 61 813 0.00% 62 914 0.00% 63 1006 0.00% 64 1101 0.00% 65 1279 0.00% 66 1367 0.00% 67 1621 0.01% 68 2108 0.01% 69 2532 0.01% 70 2864 0.01% 71 2745 0.01% 72 3149 0.01% 73 3560 0.01% 74 3968 0.01% 75 4380 0.01% 76 4752 0.02% 77 5410 0.02% 78 6062 0.02% 79 6903 0.02% 80 7770 0.03% 81 8741 0.03% 82 10116 0.03% 83 11294 0.04% 84 15683 0.05% 85 18075 0.06% 86 18702 0.06% 87 19628 0.07% 88 20219 0.07% 89 21530 0.07% 90 23062 0.08% 91 24732 0.08% 92 26198 0.09% 93 28522 0.09% 94 29917 0.10% 95 31713 0.11% 96 32772 0.11% 97 33966 0.11% 98 35063 0.12% 99 37424 0.12% 100 39352 0.13% 101 41695 0.14% 102 44761 0.15% 103 47272 0.16% 104 49994 0.17% 105 51971 0.17% 106 53151 0.18% 107 54035 0.18% 108 55653 0.19% 109 57905 0.19% 110 60015 0.20% 111 63940 0.21% 112 66625 0.22% 113 70050 0.23% 114 73586 0.25% 115 75952 0.25% 116 78118 0.26% 117 79870 0.27% 118 80985 0.27% 119 83172 0.28% 120 86519 0.29% 121 89508 0.30% 122 93264 0.31% 123 98018 0.33% 124 102460 0.34% 125 105364 0.35% 126 116749 0.39% 127 101560 0.34% 128 111991 0.37% 129 114813 0.38% 130 117366 0.39% 131 121571 0.40% 132 128103 0.43% 133 132719 0.44% 134 139276 0.46% 135 146688 0.49% 136 151485 0.50% 137 158739 0.53% 138 165698 0.55% 139 160481 0.53% 140 168821 0.56% 141 183301 0.61% 142 199052 0.66% 143 216914 0.72% 144 245486 0.82% 145 282118 0.94% 146 340964 1.14% 147 431157 1.44% 148 617385 2.06% 149 1137036 3.79% 150 5896266 19.64% 151 16120272 53.69% 30027021 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.09 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=3.0 sequence=CGCTGCTGGTCCGGGGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=805.34 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=27.5 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=812.25 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=20.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579214 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:31:56 Started mapping on | Dec 09 22:31:56 Finished on | Dec 09 22:48:01 Mapping speed, Million of reads per hour | 112.02 Number of input reads | 30027021 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 24623373 Uniquely mapped reads % | 82.00% Average mapped length | 291.40 Number of splices: Total | 25736058 Number of splices: Annotated (sjdb) | 24352870 Number of splices: GT/AG | 25392181 Number of splices: GC/AG | 303848 Number of splices: AT/AC | 19056 Number of splices: Non-canonical | 20973 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288607 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 11755 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.67% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5162770 5162770 5162770 N_multimapping 288607 288607 288607 N_noFeature 631175 23947485 870382 N_ambiguous 490204 3139 55433 UnstrandedReadsAssigned:23501994 PositiveStrandReadsAssigned:672749 NegativeStrandReadsAssigned:23697558 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579214 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579214-trimmed-pair1.fastq SRR5579214-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,027,021 reads, 24,054,362 reads pseudoaligned [quant] estimated average fragment length: 253.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR5579214.ke.tsv 35125 SRR5579214.se.tsv 88098 total ==> SRR5579214.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.953 29.9195 2.56156 PNS24247 1044 791.562 76.6732 5.67199 PNS24249 1928 1675.56 197.917 6.91672 PNS24246 1044 791.562 76.6732 5.67199 PNS24248 1044 791.562 76.6732 5.67199 PNS24244 1471 1218.56 236.144 11.3476 PNS24243 293 100.32 0 0 KQK14069 1603 1350.56 7615.13 330.171 KQK14071 474 241.646 63.9745 15.5026 ==> SRR5579214.se.tsv <== BRADI_1g14170v3 7898 BRADI_1g53295v3 91 BRADI_1g59795v3 392 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 1212 BRADI_1g74790v3 58 BRADI_1g09890v3 2 BRADI_1g77505v3 234 BRADI_1g48960v3 1 SRR5579214 completed mapping pipeline successfully