Starting /dee2/code/volunteer_pipeline.sh SRR5579216 current disk space = 1522821894144 free memory = 1597790940 SRR5579216 SRAfilesize 5796b7297d39b5dbd8b84b48bf560fa4 SRR5579216.sra SRR5579216.sra file validated SRR5579216 is paired end SRR5579216 is conventional basespace SRR5579216 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579216_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.375 34.0 33.0 34.0 32.0 34.0 2 33.06975 34.0 33.0 34.0 31.0 34.0 3 33.24125 34.0 33.0 34.0 32.0 34.0 4 33.40375 34.0 33.0 34.0 33.0 34.0 5 33.409 34.0 33.0 34.0 33.0 34.0 6 37.1955 38.0 38.0 38.0 36.0 38.0 7 37.47925 38.0 38.0 38.0 37.0 38.0 8 37.5715 38.0 38.0 38.0 38.0 38.0 9 37.63375 38.0 38.0 38.0 38.0 38.0 10-14 37.585 38.0 38.0 38.0 38.0 38.0 15-19 37.530150000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.41029999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.3348 38.0 38.0 38.0 37.0 38.0 30-34 37.3138 38.0 38.0 38.0 37.0 38.0 35-39 37.1489 38.0 38.0 38.0 36.8 38.0 40-44 36.9677 38.0 38.0 38.0 36.4 38.0 45-49 37.10435 38.0 38.0 38.0 36.2 38.0 50-54 37.347449999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2234 38.0 38.0 38.0 36.8 38.0 60-64 37.254200000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.992549999999994 38.0 38.0 38.0 35.8 38.0 70-74 37.06615 38.0 38.0 38.0 36.0 38.0 75-79 36.943200000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.7149 38.0 38.0 38.0 34.6 38.0 85-89 36.841100000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.6847 38.0 38.0 38.0 34.6 38.0 95-99 36.7204 38.0 38.0 38.0 35.0 38.0 100-104 36.158550000000005 38.0 37.6 38.0 33.0 38.0 105-109 36.18495 38.0 37.8 38.0 33.4 38.0 110-114 35.89575 38.0 37.2 38.0 32.4 38.0 115-119 35.81225 38.0 36.8 38.0 31.8 38.0 120-124 35.7423 38.0 36.2 38.0 31.8 38.0 125-129 35.6567 38.0 36.2 38.0 31.2 38.0 130-134 35.406400000000005 38.0 36.0 38.0 31.0 38.0 135-139 35.38545 38.0 36.0 38.0 31.0 38.0 140-144 35.0529 38.0 35.6 38.0 29.8 38.0 145-149 34.34505 38.0 34.4 38.0 27.4 38.0 150-151 29.92 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 3.0 19 1.0 20 4.0 21 4.0 22 5.0 23 1.0 24 11.0 25 16.0 26 23.0 27 21.0 28 36.0 29 39.0 30 46.0 31 45.0 32 73.0 33 86.0 34 166.0 35 216.0 36 604.0 37 2595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.049211018989034 15.431933672104842 9.414281893554426 31.104573415351698 2 23.674999999999997 19.375 34.375 22.575 3 22.775000000000002 26.05 22.825 28.349999999999998 4 27.075 31.924999999999997 19.45 21.55 5 24.375 34.449999999999996 21.9 19.275000000000002 6 20.45 33.225 24.45 21.875 7 17.65 19.650000000000002 41.825 20.875 8 21.125 20.25 26.35 32.275 9 20.349999999999998 20.0 29.45 30.2 10-14 23.225 25.91 24.79 26.075 15-19 23.52 25.905 24.915000000000003 25.66 20-24 23.40436174469788 25.275110044017605 25.325130052020807 25.995398159263704 25-29 23.319327731092436 25.660264105642256 25.10504201680672 25.915366146458584 30-34 23.57 25.895000000000003 24.94 25.595000000000002 35-39 23.58617930896545 25.18125906295315 25.076253812690634 26.156307815390768 40-44 23.59617980899045 25.5612780639032 25.011250562528126 25.83129156457823 45-49 23.344668933786757 25.600120024004802 24.8999799959992 26.15523104620924 50-54 23.42117105855293 25.186259312965646 25.191259562978146 26.201310065503275 55-59 23.790947736934235 25.291322830707674 25.23130782695674 25.68642160540135 60-64 23.729491796718687 25.575230092036815 24.65986394557823 26.035414165666264 65-69 22.9034355153273 24.973746061909285 25.433815072260842 26.689003350502578 70-74 24.40866129919488 25.218782817422614 24.67870180527079 25.693854078111716 75-79 23.87 25.515 25.124999999999996 25.490000000000002 80-84 23.396169808490423 25.636281814090705 25.241262063103154 25.726286314315715 85-89 24.265 24.955 24.67 26.11 90-94 23.455000000000002 25.369999999999997 24.575 26.6 95-99 24.21 24.795 24.52 26.474999999999998 100-104 24.683575966781728 24.91870528790835 25.023763069688325 25.37395567562159 105-109 24.235294117647058 25.16145181476846 24.851063829787236 25.752190237797244 110-114 24.445889828388452 24.836143493270626 24.585980887576923 26.131985790763995 115-119 24.13982796559312 25.045009001800363 24.889977995599118 25.925185037007402 120-124 24.240000000000002 25.245 24.495 26.02 125-129 24.73 26.090000000000003 24.14 25.040000000000003 130-134 24.785 25.55 24.32 25.345000000000002 135-139 24.255 25.185000000000002 24.36 26.200000000000003 140-144 24.555 25.215 24.72 25.509999999999998 145-149 24.16 25.335 24.365000000000002 26.14 150-151 23.875 25.374999999999996 24.349999999999998 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 0.5 27 0.5 28 3.0 29 4.5 30 6.0 31 12.5 32 17.5 33 22.5 34 35.0 35 44.0 36 53.0 37 70.0 38 81.5 39 102.5 40 135.5 41 149.5 42 162.5 43 180.0 44 187.5 45 193.0 46 188.5 47 179.0 48 172.0 49 157.5 50 147.0 51 140.5 52 116.5 53 108.0 54 110.0 55 105.0 56 100.0 57 89.0 58 86.5 59 95.0 60 92.0 61 77.5 62 71.0 63 59.5 64 57.0 65 63.0 66 52.0 67 49.0 68 45.5 69 36.0 70 31.5 71 25.0 72 23.5 73 19.0 74 13.5 75 9.5 76 5.5 77 4.0 78 4.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.04 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.02 50-54 0.005 55-59 0.025 60-64 0.04 65-69 0.015 70-74 0.015 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.125 110-114 0.065 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6303580433686334 1.25 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.9500000000000002 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.575 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.0999999999999996 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.075 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.175 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.699999999999999 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 7.8125 0.0 0.0 0.0 0.0 130-131 8.4875 0.0 0.0 0.0 0.0 132-133 9.287500000000001 0.0 0.0 0.0 0.0 134-135 10.125 0.0 0.0 0.0 0.0 136-137 10.925 0.0 0.0 0.0 0.0 138-139 11.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTCTT 10 0.0068484643 144.875 145 >>END_MODULE SRR5579216 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579216_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57275 33.0 33.0 34.0 32.0 34.0 2 32.7705 34.0 33.0 34.0 32.0 34.0 3 32.73175 34.0 33.0 34.0 32.0 34.0 4 32.73275 34.0 33.0 34.0 32.0 34.0 5 32.56275 34.0 33.0 34.0 32.0 34.0 6 36.78375 38.0 38.0 38.0 36.0 38.0 7 36.88575 38.0 38.0 38.0 36.0 38.0 8 36.806 38.0 38.0 38.0 36.0 38.0 9 36.73175 38.0 38.0 38.0 36.0 38.0 10-14 36.7057 38.0 38.0 38.0 35.8 38.0 15-19 36.79365 38.0 38.0 38.0 36.2 38.0 20-24 36.8053 38.0 38.0 38.0 36.6 38.0 25-29 36.7792 38.0 38.0 38.0 36.0 38.0 30-34 36.73115 38.0 38.0 38.0 36.0 38.0 35-39 36.894 38.0 38.0 38.0 36.8 38.0 40-44 36.8814 38.0 38.0 38.0 37.0 38.0 45-49 36.77645 38.0 38.0 38.0 36.6 38.0 50-54 36.71725 38.0 38.0 38.0 36.2 38.0 55-59 36.6503 38.0 38.0 38.0 36.0 38.0 60-64 36.637350000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.49175 38.0 38.0 38.0 35.2 38.0 70-74 36.22005000000001 38.0 38.0 38.0 34.4 38.0 75-79 35.885000000000005 38.0 38.0 38.0 32.0 38.0 80-84 35.95115 38.0 38.0 38.0 33.4 38.0 85-89 36.0554 38.0 38.0 38.0 33.8 38.0 90-94 36.196200000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.1479 38.0 38.0 38.0 34.0 38.0 100-104 35.91685 38.0 38.0 38.0 33.6 38.0 105-109 35.716899999999995 38.0 38.0 38.0 32.8 38.0 110-114 35.617000000000004 38.0 38.0 38.0 32.8 38.0 115-119 35.261700000000005 38.0 37.0 38.0 30.6 38.0 120-124 34.68455 38.0 36.0 38.0 26.0 38.0 125-129 34.34304999999999 38.0 35.0 38.0 23.6 38.0 130-134 34.3018 38.0 35.0 38.0 24.4 38.0 135-139 33.96235 38.0 34.4 38.0 23.8 38.0 140-144 33.34535000000001 38.0 33.0 38.0 19.8 38.0 145-149 32.358050000000006 38.0 33.0 38.0 10.4 38.0 150-151 27.743499999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 9.0 4 3.0 5 2.0 6 4.0 7 4.0 8 3.0 9 5.0 10 3.0 11 3.0 12 3.0 13 4.0 14 5.0 15 5.0 16 2.0 17 4.0 18 3.0 19 9.0 20 6.0 21 5.0 22 18.0 23 15.0 24 17.0 25 18.0 26 22.0 27 21.0 28 30.0 29 45.0 30 37.0 31 50.0 32 71.0 33 118.0 34 155.0 35 271.0 36 546.0 37 2462.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.60080442433384 14.93212669683258 11.211664152840624 28.25540472599296 2 27.921588338778587 21.638602663985925 29.47976878612717 20.960040211108318 3 22.54901960784314 24.157868275515334 28.40623428858723 24.8868778280543 4 28.15485168426345 32.05128205128205 16.918049270990448 22.875816993464053 5 26.747109100050277 34.38914027149321 18.275515334338863 20.588235294117645 6 21.43394334419654 34.09375783404362 19.503634996239658 24.968663825520178 7 20.276381909547737 15.326633165829145 37.814070351758794 26.58291457286432 8 22.06879236756214 19.83429575696711 24.45392919909616 33.642982676374594 9 23.375971908703285 21.670428893905193 25.70855279658891 29.24504640080261 10-14 25.578244945060458 25.397621795193416 23.114745873262756 25.909387386483367 15-19 25.84156925701099 25.08403150554357 23.754577835749764 25.31982140169568 20-24 25.80628981291067 24.74795606159402 24.005617695741584 25.440136429753725 25-29 25.77117921452576 25.189346441290063 24.141044289511964 24.898430054672218 30-34 25.79124241360285 24.813161458594575 24.110949490896324 25.284646636906256 35-39 25.68591061844811 24.908461654210765 24.02568089481868 25.379946832522442 40-44 26.020664058581605 24.400641990169525 24.621326110943926 24.957367840304943 45-49 26.35087719298246 24.43107769423559 23.86466165413534 25.35338345864662 50-54 25.94803370786517 24.61376404494382 24.388041733547354 25.05016051364366 55-59 27.012244078683263 24.17201926936973 24.17201926936973 24.64371738257728 60-64 26.208523668490535 24.72767431353848 23.849204357210986 25.214597660760003 65-69 26.292540909547235 24.736472241742796 24.500552153398253 24.470434695311717 70-74 26.668340446899325 23.936731107205624 24.42380115490836 24.971127290986693 75-79 25.796562468589805 24.942205246758466 24.726103125942306 24.535129158709417 80-84 26.55983120667135 25.15824374560434 24.329347935295893 23.952577112428415 85-89 25.98282873926796 24.84309886027012 24.255660993121452 24.918411407340464 90-94 26.379474820505095 24.797911332027915 24.330973540191795 24.49164030727519 95-99 25.766624843161857 24.90338770388959 24.86323713927227 24.466750313676286 100-104 26.998143595404144 24.3540213737394 24.228588630776176 24.419246400080276 105-109 26.83000301235064 25.62506275730495 23.91304347826087 23.631890752083542 110-114 26.970016573753202 24.44879714730551 24.65471347496359 23.9264728039777 115-119 27.371695178849144 25.068981086640246 24.271308884763958 23.288014849746652 120-124 26.562970396387353 25.313597591570495 24.60110386352233 23.52232814851982 125-129 27.015622645300645 25.719596121967147 23.97146732305219 23.29331390968001 130-134 27.692384970865984 25.236085995579664 23.633715089411293 23.437813944143056 135-139 27.36128546321868 25.669093648004015 24.45392919909616 22.515691689681145 140-144 27.465354488853183 26.340630648724645 23.674432616991364 22.519582245430808 145-149 28.26294380555416 25.741977602571186 23.657911916838245 22.337166675036407 150-151 27.587939698492463 25.326633165829143 25.05025125628141 22.035175879396984 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.5 2 2.0 3 2.0 4 1.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 2.0 29 1.0 30 4.5 31 10.5 32 12.5 33 12.0 34 18.0 35 34.5 36 46.5 37 55.0 38 77.0 39 94.5 40 116.0 41 136.5 42 147.5 43 153.0 44 161.0 45 175.0 46 177.5 47 173.0 48 164.5 49 152.5 50 141.5 51 124.0 52 112.5 53 106.5 54 94.5 55 86.5 56 84.5 57 94.0 58 106.0 59 108.0 60 98.0 61 99.0 62 111.0 63 95.5 64 79.5 65 72.5 66 61.5 67 60.0 68 64.0 69 63.5 70 52.0 71 38.5 72 28.5 73 24.0 74 17.0 75 9.5 76 6.0 77 5.0 78 4.0 79 3.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.525 3 0.5499999999999999 4 0.5499999999999999 5 0.5499999999999999 6 0.27499999999999997 7 0.5 8 0.42500000000000004 9 0.325 10-14 0.345 15-19 0.335 20-24 0.315 25-29 0.315 30-34 0.315 35-39 0.315 40-44 0.31 45-49 0.25 50-54 0.32 55-59 0.36 60-64 0.395 65-69 0.38999999999999996 70-74 0.42500000000000004 75-79 0.51 80-84 0.47000000000000003 85-89 0.415 90-94 0.415 95-99 0.375 100-104 0.345 105-109 0.41000000000000003 110-114 0.445 115-119 0.335 120-124 0.35000000000000003 125-129 0.46499999999999997 130-134 0.45999999999999996 135-139 0.42500000000000004 140-144 0.42 145-149 0.43499999999999994 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9873417721519 97.75 2 0.8860759493670887 1.7500000000000002 3 0.05063291139240507 0.15 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.1375 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 2.0 0.0 0.0 0.0 0.0 102-103 2.325 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.3875 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.175000000000001 0.0 0.0 0.0 0.0 120-121 5.6625 0.0 0.0 0.0 0.0 122-123 6.074999999999999 0.0 0.0 0.0 0.0 124-125 6.574999999999999 0.0 0.0 0.0 0.0 126-127 7.1875 0.0 0.0 0.0 0.0 128-129 7.675000000000001 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 9.1125 0.0 0.0 0.0 0.0 134-135 9.925 0.0 0.0 0.0 0.0 136-137 10.7125 0.0 0.0 0.0 0.0 138-139 11.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010601 spots for SRR5579216.sra Written 1010601 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra Read 1010592 spots for SRR5579216.sra Written 1010592 spots for SRR5579216.sra SRR ids: ['SRR5579216.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i76s0neb SRR5579216.sra spots: 20211849 blocks: [[1, 1010592], [1010593, 2021184], [2021185, 3031776], [3031777, 4042368], [4042369, 5052960], [5052961, 6063552], [6063553, 7074144], [7074145, 8084736], [8084737, 9095328], [9095329, 10105920], [10105921, 11116512], [11116513, 12127104], [12127105, 13137696], [13137697, 14148288], [14148289, 15158880], [15158881, 16169472], [16169473, 17180064], [17180065, 18190656], [18190657, 19201248], [19201249, 20211849]] SRR5579216 file size 6827432 SRR5579216 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579216 SRR5579216_1.fastq SRR5579216_2.fastq Input file: SRR5579216_1.fastq Paired file: SRR5579216_2.fastq trimmed: SRR5579216-trimmed-pair1.fastq, SRR5579216-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:33:47 2024 >> started Mon Dec 9 22:34:12 2024 >> done (24.587s) 20211849 read pairs processed; of these: 42084 ( 0.21%) short read pairs filtered out after trimming by size control 87143 ( 0.43%) empty read pairs filtered out after trimming by size control 20082622 (99.36%) read pairs available; of these: 10872136 (54.14%) trimmed read pairs available after processing 9210486 (45.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 23 0.00% 20 26 0.00% 21 16 0.00% 22 10 0.00% 23 22 0.00% 24 24 0.00% 25 20 0.00% 26 18 0.00% 27 34 0.00% 28 29 0.00% 29 23 0.00% 30 26 0.00% 31 24 0.00% 32 36 0.00% 33 36 0.00% 34 28 0.00% 35 46 0.00% 36 41 0.00% 37 40 0.00% 38 74 0.00% 39 43 0.00% 40 54 0.00% 41 74 0.00% 42 78 0.00% 43 83 0.00% 44 87 0.00% 45 121 0.00% 46 133 0.00% 47 130 0.00% 48 165 0.00% 49 184 0.00% 50 231 0.00% 51 210 0.00% 52 244 0.00% 53 326 0.00% 54 335 0.00% 55 340 0.00% 56 418 0.00% 57 484 0.00% 58 566 0.00% 59 625 0.00% 60 771 0.00% 61 839 0.00% 62 957 0.00% 63 1009 0.01% 64 1122 0.01% 65 1290 0.01% 66 1536 0.01% 67 1715 0.01% 68 2058 0.01% 69 2812 0.01% 70 2914 0.01% 71 2962 0.01% 72 3410 0.02% 73 3716 0.02% 74 4098 0.02% 75 4540 0.02% 76 4853 0.02% 77 5512 0.03% 78 6154 0.03% 79 6794 0.03% 80 7934 0.04% 81 8865 0.04% 82 9887 0.05% 83 11124 0.06% 84 13443 0.07% 85 14750 0.07% 86 15654 0.08% 87 16827 0.08% 88 17748 0.09% 89 19350 0.10% 90 20389 0.10% 91 21711 0.11% 92 23479 0.12% 93 24557 0.12% 94 25921 0.13% 95 26874 0.13% 96 28010 0.14% 97 29421 0.15% 98 30263 0.15% 99 32300 0.16% 100 34432 0.17% 101 37548 0.19% 102 37762 0.19% 103 38885 0.19% 104 40708 0.20% 105 42296 0.21% 106 43448 0.22% 107 43239 0.22% 108 44969 0.22% 109 46407 0.23% 110 47978 0.24% 111 50227 0.25% 112 52634 0.26% 113 54713 0.27% 114 56889 0.28% 115 59289 0.30% 116 59457 0.30% 117 60373 0.30% 118 60389 0.30% 119 62223 0.31% 120 64779 0.32% 121 66104 0.33% 122 68446 0.34% 123 72029 0.36% 124 75467 0.38% 125 76189 0.38% 126 78274 0.39% 127 79179 0.39% 128 79933 0.40% 129 82056 0.41% 130 83396 0.42% 131 85973 0.43% 132 90491 0.45% 133 93815 0.47% 134 97630 0.49% 135 102572 0.51% 136 106191 0.53% 137 109179 0.54% 138 114407 0.57% 139 118845 0.59% 140 124143 0.62% 141 133029 0.66% 142 146025 0.73% 143 157426 0.78% 144 178615 0.89% 145 209676 1.04% 146 256392 1.28% 147 324846 1.62% 148 482333 2.40% 149 933106 4.65% 150 4744614 23.63% 151 9210486 45.86% 20082622 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=25 prefix-density=0.82 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.22 sequence-density-rank=26 fanout-score=11.80 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=12 prefix-density=0.84 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=110.30 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR5579216 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:35:03 Started mapping on | Dec 09 22:35:03 Finished on | Dec 09 22:38:00 Mapping speed, Million of reads per hour | 408.46 Number of input reads | 20082622 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 19135035 Uniquely mapped reads % | 95.28% Average mapped length | 289.61 Number of splices: Total | 20222078 Number of splices: Annotated (sjdb) | 19154538 Number of splices: GT/AG | 19962401 Number of splices: GC/AG | 236309 Number of splices: AT/AC | 9176 Number of splices: Non-canonical | 14192 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.01% Deletion average length | 1.29 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186264 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 9372 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 789401 789401 789401 N_multimapping 186264 186264 186264 N_noFeature 616253 18563095 806224 N_ambiguous 446454 2474 65276 UnstrandedReadsAssigned:18072328 PositiveStrandReadsAssigned:569466 NegativeStrandReadsAssigned:18263535 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579216 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579216-trimmed-pair1.fastq SRR5579216-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,082,622 reads, 18,335,758 reads pseudoaligned [quant] estimated average fragment length: 250.075 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52973 SRR5579216.ke.tsv 35125 SRR5579216.se.tsv 88098 total ==> SRR5579216.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.538 0 0 PNS24247 1044 794.925 37.744 3.69546 PNS24249 1928 1678.92 55.5593 2.57556 PNS24246 1044 794.925 37.744 3.69546 PNS24248 1044 794.925 37.744 3.69546 PNS24244 1471 1221.92 103.209 6.57382 PNS24243 293 105.435 0 0 KQK14069 1603 1353.92 3126.23 179.71 KQK14071 474 247.555 108.385 34.0756 ==> SRR5579216.se.tsv <== BRADI_1g14170v3 3796 BRADI_1g53295v3 77 BRADI_1g59795v3 583 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 2619 BRADI_1g74790v3 51 BRADI_1g09890v3 1 BRADI_1g77505v3 249 BRADI_1g48960v3 1 SRR5579216 completed mapping pipeline successfully