Starting /dee2/code/volunteer_pipeline.sh SRR5579217 current disk space = 1522806841344 free memory = 1600951040 SRR5579217 SRAfilesize 772f9de99e66327c293303d4b3def63d SRR5579217.sra SRR5579217.sra file validated SRR5579217 is paired end SRR5579217 is conventional basespace SRR5579217 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579217_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56925 34.0 33.0 34.0 32.0 34.0 2 32.9265 34.0 33.0 34.0 31.0 34.0 3 32.95975 34.0 33.0 34.0 32.0 34.0 4 33.16125 34.0 33.0 34.0 32.0 34.0 5 33.051 34.0 33.0 34.0 32.0 34.0 6 36.913 38.0 37.0 38.0 35.0 38.0 7 37.22725 38.0 38.0 38.0 36.0 38.0 8 37.393 38.0 38.0 38.0 37.0 38.0 9 37.43925 38.0 38.0 38.0 37.0 38.0 10-14 37.38275 38.0 38.0 38.0 37.0 38.0 15-19 37.36725 38.0 38.0 38.0 37.0 38.0 20-24 37.297850000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.2063 38.0 38.0 38.0 36.6 38.0 30-34 37.075149999999994 38.0 38.0 38.0 36.2 38.0 35-39 36.7798 38.0 38.0 38.0 35.0 38.0 40-44 36.80485 38.0 38.0 38.0 35.0 38.0 45-49 36.725199999999994 38.0 38.0 38.0 34.8 38.0 50-54 37.11665000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.97415 38.0 38.0 38.0 35.8 38.0 60-64 36.96464999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.445299999999996 38.0 38.0 38.0 33.8 38.0 70-74 36.696400000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.66415 38.0 38.0 38.0 34.6 38.0 80-84 36.402849999999994 38.0 38.0 38.0 33.6 38.0 85-89 36.553700000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.24100000000001 38.0 38.0 38.0 33.8 38.0 95-99 36.2692 38.0 38.0 38.0 33.6 38.0 100-104 35.8939 38.0 37.6 38.0 31.8 38.0 105-109 35.71635 38.0 36.6 38.0 31.6 38.0 110-114 35.59725 38.0 36.2 38.0 30.6 38.0 115-119 35.293099999999995 38.0 36.0 38.0 29.6 38.0 120-124 35.124900000000004 38.0 35.6 38.0 28.2 38.0 125-129 34.139399999999995 38.0 34.4 38.0 22.6 38.0 130-134 34.6272 38.0 34.8 38.0 26.0 38.0 135-139 34.338 38.0 34.2 38.0 25.0 38.0 140-144 34.269549999999995 38.0 33.8 38.0 25.2 38.0 145-149 33.3657 38.0 33.0 38.0 21.0 38.0 150-151 28.460625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 5.0 16 4.0 17 3.0 18 5.0 19 5.0 20 7.0 21 2.0 22 6.0 23 5.0 24 15.0 25 16.0 26 22.0 27 33.0 28 33.0 29 51.0 30 62.0 31 72.0 32 82.0 33 147.0 34 195.0 35 361.0 36 690.0 37 2176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.14248090597841 14.195417434816962 8.111667105609692 30.55043455359494 2 23.724999999999998 19.075 33.95 23.25 3 22.375 25.3 24.8 27.525 4 27.85 30.75 20.5 20.9 5 24.66750313676286 34.604767879548305 20.426599749058973 20.30112923462986 6 22.375 33.575 22.1 21.95 7 16.975 19.25 40.625 23.150000000000002 8 20.974999999999998 19.2 27.3 32.525 9 21.75 19.55 29.7 28.999999999999996 10-14 23.815 25.474999999999998 24.945 25.765 15-19 24.01 24.9 25.28 25.81 20-24 23.72 25.77 24.265 26.245 25-29 24.12 24.81 24.73 26.340000000000003 30-34 24.529999999999998 25.21 24.42 25.840000000000003 35-39 24.490000000000002 24.325 24.695 26.490000000000002 40-44 24.37 24.87 25.155 25.605 45-49 24.58 24.990000000000002 24.89 25.540000000000003 50-54 23.835 24.895 25.215 26.055 55-59 24.19 24.765 24.515 26.529999999999998 60-64 25.145 24.485 24.495 25.874999999999996 65-69 24.745 24.575 24.48 26.200000000000003 70-74 24.72 24.955 24.29 26.035000000000004 75-79 24.735 25.124999999999996 24.535 25.605 80-84 24.605 24.82 24.560000000000002 26.015 85-89 25.11 24.565 24.610000000000003 25.715 90-94 25.27 24.875 24.125 25.729999999999997 95-99 25.380000000000003 24.865000000000002 24.075 25.679999999999996 100-104 25.629999999999995 24.845 23.794999999999998 25.729999999999997 105-109 25.130000000000003 25.240000000000002 23.685000000000002 25.945 110-114 25.424999999999997 24.985 23.455000000000002 26.135 115-119 25.078761814272145 24.493674051107668 23.728559283892583 26.699004850727608 120-124 25.285000000000004 25.135 23.36 26.22 125-129 24.797479747974798 25.13751375137514 23.262326232623263 26.8026802680268 130-134 24.91 24.955 23.54 26.595000000000002 135-139 24.658698804820723 24.5636845526829 23.75356303445517 27.024053608041203 140-144 24.70747074707471 24.912491249124912 23.887388738873888 26.49264926492649 145-149 24.79619904976244 25.03125781445361 23.835958989747436 26.336584146036508 150-151 24.715589448681087 25.315664458057256 24.05300662582823 25.91573946743343 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.0 27 2.5 28 2.5 29 3.0 30 6.5 31 8.0 32 10.5 33 15.5 34 25.5 35 32.5 36 42.0 37 63.5 38 81.0 39 96.0 40 114.5 41 129.0 42 149.5 43 173.0 44 180.5 45 173.5 46 181.5 47 189.0 48 166.5 49 158.5 50 161.0 51 148.0 52 133.0 53 120.5 54 109.0 55 103.5 56 104.5 57 97.5 58 88.5 59 90.0 60 93.5 61 82.0 62 68.5 63 68.0 64 65.5 65 61.5 66 62.0 67 58.0 68 49.5 69 43.5 70 42.5 71 40.5 72 31.5 73 19.0 74 13.5 75 12.5 76 8.5 77 5.5 78 4.0 79 3.0 80 1.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.0 3 0.0 4 0.0 5 0.375 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.015 140-144 0.01 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 0.9625 0.0 0.0 0.0 0.0 82-83 1.1124999999999998 0.0 0.0 0.0 0.0 84-85 1.3125 0.0 0.0 0.0 0.0 86-87 1.675 0.0 0.0 0.0 0.0 88-89 2.0875 0.0 0.0 0.0 0.0 90-91 2.4 0.0 0.0 0.0 0.0 92-93 2.825 0.0 0.0 0.0 0.0 94-95 3.3125 0.0 0.0 0.0 0.0 96-97 4.0875 0.0 0.0 0.0 0.0 98-99 4.949999999999999 0.0 0.0 0.0 0.0 100-101 5.5875 0.0 0.0 0.0 0.0 102-103 6.2125 0.0 0.0 0.0 0.0 104-105 7.225 0.0 0.0 0.0 0.0 106-107 8.0 0.0 0.0 0.0 0.0 108-109 8.8 0.0 0.0 0.0 0.0 110-111 9.725 0.0 0.0 0.0 0.0 112-113 10.5125 0.0 0.0 0.0 0.0 114-115 11.275 0.0 0.0 0.0 0.0 116-117 12.1625 0.0 0.0 0.0 0.0 118-119 12.925 0.0 0.0 0.0 0.0 120-121 13.8625 0.0 0.0 0.0 0.0 122-123 14.5125 0.0 0.0 0.0 0.0 124-125 15.3 0.0 0.0 0.0 0.0 126-127 16.299999999999997 0.0 0.0 0.0 0.0 128-129 17.0 0.0 0.0 0.0 0.0 130-131 17.775 0.0 0.0 0.0 0.0 132-133 18.625 0.0 0.0 0.0 0.0 134-135 19.5875 0.0 0.0 0.0 0.0 136-137 20.7125 0.0 0.0 0.0 0.0 138-139 21.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTGC 10 0.006836113 144.9625 9 >>END_MODULE SRR5579217 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579217_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56325 33.0 33.0 34.0 32.0 34.0 2 32.65925 33.0 33.0 34.0 32.0 34.0 3 32.689 33.0 33.0 34.0 32.0 34.0 4 32.6795 34.0 33.0 34.0 32.0 34.0 5 32.72725 33.0 33.0 34.0 32.0 34.0 6 36.7485 38.0 38.0 38.0 35.0 38.0 7 36.86875 38.0 38.0 38.0 36.0 38.0 8 36.776 38.0 38.0 38.0 35.0 38.0 9 36.46 38.0 38.0 38.0 34.0 38.0 10-14 36.689 38.0 38.0 38.0 35.2 38.0 15-19 36.822799999999994 38.0 38.0 38.0 35.8 38.0 20-24 36.73185 38.0 38.0 38.0 35.8 38.0 25-29 36.5381 38.0 38.0 38.0 34.8 38.0 30-34 36.647499999999994 38.0 38.0 38.0 35.0 38.0 35-39 36.68365 38.0 38.0 38.0 35.2 38.0 40-44 36.69955 38.0 38.0 38.0 35.6 38.0 45-49 36.687599999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.5514 38.0 38.0 38.0 35.0 38.0 55-59 36.527249999999995 38.0 38.0 38.0 35.0 38.0 60-64 36.50595 38.0 38.0 38.0 34.8 38.0 65-69 36.249050000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.016999999999996 38.0 38.0 38.0 33.4 38.0 75-79 35.64865 38.0 37.4 38.0 31.0 38.0 80-84 35.70985 38.0 37.6 38.0 31.8 38.0 85-89 35.87755 38.0 38.0 38.0 33.0 38.0 90-94 35.75365 38.0 38.0 38.0 32.4 38.0 95-99 35.63985 38.0 37.6 38.0 32.2 38.0 100-104 35.4039 38.0 36.8 38.0 31.0 38.0 105-109 35.189099999999996 38.0 36.2 38.0 29.4 38.0 110-114 34.647650000000006 38.0 35.4 38.0 25.6 38.0 115-119 34.222500000000004 38.0 35.0 38.0 23.0 38.0 120-124 33.32195 38.0 34.2 38.0 17.4 38.0 125-129 32.37185 38.0 32.6 38.0 13.4 38.0 130-134 32.169000000000004 38.0 32.0 38.0 13.0 38.0 135-139 31.233150000000002 38.0 31.0 38.0 10.8 38.0 140-144 30.044900000000002 37.4 29.4 38.0 2.0 38.0 145-149 28.34715 36.0 22.4 38.0 2.0 38.0 150-151 22.63975 29.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 6.0 5 2.0 6 5.0 7 3.0 8 4.0 9 1.0 10 2.0 11 3.0 12 2.0 13 5.0 14 3.0 15 11.0 16 4.0 17 4.0 18 5.0 19 18.0 20 6.0 21 12.0 22 18.0 23 17.0 24 16.0 25 34.0 26 38.0 27 59.0 28 64.0 29 57.0 30 94.0 31 95.0 32 133.0 33 179.0 34 275.0 35 359.0 36 704.0 37 1745.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.55 15.950000000000001 9.975000000000001 26.525 2 28.1 20.825 27.450000000000003 23.625 3 26.424999999999997 22.775000000000002 25.575 25.224999999999998 4 30.349999999999998 30.525000000000002 16.675 22.45 5 27.400000000000002 34.35 16.950000000000003 21.3 6 21.15 35.075 19.025 24.75 7 20.875 16.400000000000002 37.15 25.575 8 22.900000000000002 20.175 23.400000000000002 33.525 9 24.099999999999998 22.175 23.674999999999997 30.049999999999997 10-14 25.825 25.755 22.15 26.27 15-19 25.83 24.535 23.445 26.19 20-24 25.825 24.959999999999997 23.61 25.605 25-29 25.924999999999997 24.779999999999998 23.585 25.71 30-34 26.25 24.33 23.525 25.895000000000003 35-39 25.669999999999998 24.490000000000002 23.44 26.400000000000002 40-44 26.314999999999998 23.794999999999998 24.345 25.545 45-49 25.865 24.315 23.84 25.979999999999997 50-54 26.31 24.335 23.815 25.540000000000003 55-59 26.61 24.605 23.09 25.695 60-64 26.224999999999998 24.305 23.625 25.845000000000002 65-69 25.869999999999997 24.834999999999997 23.65 25.645 70-74 26.355 23.935000000000002 23.835 25.874999999999996 75-79 26.3 24.255 23.76 25.685000000000002 80-84 26.105 24.765 23.93 25.2 85-89 26.584999999999997 24.66 23.535 25.22 90-94 26.979999999999997 24.68 23.51 24.83 95-99 26.590000000000003 25.245 23.455000000000002 24.709999999999997 100-104 27.565 24.715 23.27 24.45 105-109 27.35 24.84 23.425 24.385 110-114 27.83 25.380000000000003 23.07 23.72 115-119 28.665000000000003 25.019999999999996 23.044999999999998 23.27 120-124 28.84 25.155 23.29 22.715 125-129 28.449999999999996 25.674999999999997 22.685 23.189999999999998 130-134 29.275000000000002 25.645 22.55 22.53 135-139 29.235 25.629999999999995 22.994999999999997 22.14 140-144 29.470000000000002 25.825 23.26 21.445 145-149 28.92 26.525 22.66 21.895 150-151 29.9875 26.200000000000003 22.3625 21.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 3.0 29 7.0 30 10.0 31 10.0 32 9.5 33 10.5 34 17.5 35 26.5 36 33.0 37 46.0 38 56.5 39 69.0 40 95.5 41 118.5 42 139.0 43 161.0 44 169.0 45 165.0 46 161.0 47 152.5 48 153.5 49 152.5 50 146.5 51 149.5 52 140.0 53 123.0 54 112.0 55 109.5 56 105.5 57 93.5 58 88.0 59 96.0 60 99.5 61 84.5 62 93.0 63 101.0 64 77.5 65 75.5 66 80.5 67 69.5 68 67.5 69 63.0 70 54.0 71 49.5 72 35.5 73 33.0 74 28.0 75 15.0 76 13.5 77 10.5 78 5.5 79 3.0 80 2.0 81 1.0 82 1.0 83 2.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16624557857504 98.125 2 0.6821627084386054 1.35 3 0.1010611419909045 0.3 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.5875 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.2875 0.0 0.0 0.0 0.0 86-87 1.675 0.0 0.0 0.0 0.0 88-89 2.0875 0.0 0.0 0.0 0.0 90-91 2.4124999999999996 0.0 0.0 0.0 0.0 92-93 2.8625 0.0 0.0 0.0 0.0 94-95 3.375 0.0 0.0 0.0 0.0 96-97 4.2125 0.0 0.0 0.0 0.0 98-99 5.1 0.0 0.0 0.0 0.0 100-101 5.75 0.0 0.0 0.0 0.0 102-103 6.362500000000001 0.0 0.0 0.0 0.0 104-105 7.325 0.0 0.0 0.0 0.0 106-107 8.1 0.0 0.0 0.0 0.0 108-109 8.899999999999999 0.0 0.0 0.0 0.0 110-111 9.8625 0.0 0.0 0.0 0.0 112-113 10.6875 0.0 0.0 0.0 0.0 114-115 11.5125 0.0 0.0 0.0 0.0 116-117 12.4625 0.0 0.0 0.0 0.0 118-119 13.2875 0.0 0.0 0.0 0.0 120-121 14.2375 0.0 0.0 0.0 0.0 122-123 14.9125 0.0 0.0 0.0 0.0 124-125 15.7375 0.0 0.0 0.0 0.0 126-127 16.725 0.0 0.0 0.0 0.0 128-129 17.450000000000003 0.0 0.0 0.0 0.0 130-131 18.225 0.0 0.0 0.0 0.0 132-133 19.0625 0.0 0.0 0.0 0.0 134-135 20.0125 0.0 0.0 0.0 0.0 136-137 21.137500000000003 0.0 0.0 0.0 0.0 138-139 22.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGCCC 10 0.006830828 145.0 4 CAGCTTT 10 0.006830828 145.0 8 >>END_MODULE Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276702 spots for SRR5579217.sra Written 1276702 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra Read 1276700 spots for SRR5579217.sra Written 1276700 spots for SRR5579217.sra SRR ids: ['SRR5579217.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z4t1_cbr SRR5579217.sra spots: 25534002 blocks: [[1, 1276700], [1276701, 2553400], [2553401, 3830100], [3830101, 5106800], [5106801, 6383500], [6383501, 7660200], [7660201, 8936900], [8936901, 10213600], [10213601, 11490300], [11490301, 12767000], [12767001, 14043700], [14043701, 15320400], [15320401, 16597100], [16597101, 17873800], [17873801, 19150500], [19150501, 20427200], [20427201, 21703900], [21703901, 22980600], [22980601, 24257300], [24257301, 25534002]] SRR5579217 file size 8630935 SRR5579217 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579217 SRR5579217_1.fastq SRR5579217_2.fastq Input file: SRR5579217_1.fastq Paired file: SRR5579217_2.fastq trimmed: SRR5579217-trimmed-pair1.fastq, SRR5579217-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:36:03 2024 >> started Mon Dec 9 22:36:32 2024 >> done (29.655s) 25534002 read pairs processed; of these: 46337 ( 0.18%) short read pairs filtered out after trimming by size control 72753 ( 0.28%) empty read pairs filtered out after trimming by size control 25414912 (99.53%) read pairs available; of these: 16381547 (64.46%) trimmed read pairs available after processing 9033365 (35.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 40 0.00% 20 22 0.00% 21 41 0.00% 22 33 0.00% 23 40 0.00% 24 40 0.00% 25 37 0.00% 26 42 0.00% 27 34 0.00% 28 61 0.00% 29 74 0.00% 30 68 0.00% 31 69 0.00% 32 83 0.00% 33 87 0.00% 34 114 0.00% 35 118 0.00% 36 125 0.00% 37 152 0.00% 38 160 0.00% 39 178 0.00% 40 198 0.00% 41 245 0.00% 42 256 0.00% 43 303 0.00% 44 319 0.00% 45 374 0.00% 46 430 0.00% 47 503 0.00% 48 610 0.00% 49 729 0.00% 50 848 0.00% 51 957 0.00% 52 1066 0.00% 53 1082 0.00% 54 1230 0.00% 55 1446 0.01% 56 1701 0.01% 57 1890 0.01% 58 2296 0.01% 59 2729 0.01% 60 3145 0.01% 61 3652 0.01% 62 4052 0.02% 63 4423 0.02% 64 4802 0.02% 65 5386 0.02% 66 6000 0.02% 67 6877 0.03% 68 8072 0.03% 69 10034 0.04% 70 11347 0.04% 71 12390 0.05% 72 14287 0.06% 73 15243 0.06% 74 16775 0.07% 75 17987 0.07% 76 19614 0.08% 77 21523 0.08% 78 24066 0.09% 79 27013 0.11% 80 30000 0.12% 81 33950 0.13% 82 37858 0.15% 83 41403 0.16% 84 46506 0.18% 85 48826 0.19% 86 50832 0.20% 87 53371 0.21% 88 56550 0.22% 89 59621 0.23% 90 64677 0.25% 91 69169 0.27% 92 74217 0.29% 93 79153 0.31% 94 82659 0.33% 95 84219 0.33% 96 85180 0.34% 97 87009 0.34% 98 88352 0.35% 99 92778 0.37% 100 96701 0.38% 101 100632 0.40% 102 104988 0.41% 103 108775 0.43% 104 111524 0.44% 105 112050 0.44% 106 114250 0.45% 107 112743 0.44% 108 113858 0.45% 109 114354 0.45% 110 116707 0.46% 111 122168 0.48% 112 124032 0.49% 113 128073 0.50% 114 131982 0.52% 115 132992 0.52% 116 132169 0.52% 117 132493 0.52% 118 129606 0.51% 119 129929 0.51% 120 133205 0.52% 121 134339 0.53% 122 137114 0.54% 123 142289 0.56% 124 145817 0.57% 125 146493 0.58% 126 148322 0.58% 127 146176 0.58% 128 145067 0.57% 129 146577 0.58% 130 146040 0.57% 131 148854 0.59% 132 155194 0.61% 133 158330 0.62% 134 163752 0.64% 135 170091 0.67% 136 173056 0.68% 137 177013 0.70% 138 181420 0.71% 139 188095 0.74% 140 196024 0.77% 141 209666 0.82% 142 228610 0.90% 143 238920 0.94% 144 269470 1.06% 145 306858 1.21% 146 360603 1.42% 147 476282 1.87% 148 643425 2.53% 149 1194919 4.70% 150 5275623 20.76% 151 9033365 35.54% 25414912 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=24 prefix-density=0.59 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=11.11 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.2 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=13 prefix-density=0.66 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=92.83 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579217 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:37:18 Started mapping on | Dec 09 22:37:18 Finished on | Dec 09 22:40:17 Mapping speed, Million of reads per hour | 511.14 Number of input reads | 25414912 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 23924977 Uniquely mapped reads % | 94.14% Average mapped length | 279.43 Number of splices: Total | 23154554 Number of splices: Annotated (sjdb) | 21742011 Number of splices: GT/AG | 22856615 Number of splices: GC/AG | 269992 Number of splices: AT/AC | 10675 Number of splices: Non-canonical | 17272 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337371 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 59963 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1183748 1183748 1183748 N_multimapping 337371 337371 337371 N_noFeature 904283 23108141 1269070 N_ambiguous 537047 3712 85860 UnstrandedReadsAssigned:22483647 PositiveStrandReadsAssigned:813124 NegativeStrandReadsAssigned:22570047 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=130 echo kmer=125 SRR5579217 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579217-trimmed-pair1.fastq SRR5579217-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,414,912 reads, 22,705,907 reads pseudoaligned [quant] estimated average fragment length: 223.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR5579217.ke.tsv 35125 SRR5579217.se.tsv 88098 total ==> SRR5579217.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.694 0 0 PNS24247 1044 821.183 67.4932 5.24126 PNS24249 1928 1705.18 101.326 3.78935 PNS24246 1044 821.183 67.4932 5.24126 PNS24248 1044 821.183 67.4932 5.24126 PNS24244 1471 1248.18 100.195 5.11898 PNS24243 293 122.031 0 0 KQK14069 1603 1380.18 2630.47 121.538 KQK14071 474 269.135 130.239 30.8594 ==> SRR5579217.se.tsv <== BRADI_1g14170v3 3127 BRADI_1g53295v3 201 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 2111 BRADI_1g74790v3 154 BRADI_1g09890v3 6 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR5579217 completed mapping pipeline successfully