Starting /dee2/code/volunteer_pipeline.sh SRR5579218 current disk space = 1522828726272 free memory = 1565198172 SRR5579218 SRAfilesize c250ac1853eb7507cdd9018b136c2d44 SRR5579218.sra SRR5579218.sra file validated SRR5579218 is paired end SRR5579218 is conventional basespace SRR5579218 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579218_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58775 34.0 33.0 34.0 31.0 34.0 2 32.888 34.0 33.0 34.0 31.0 34.0 3 32.9995 34.0 33.0 34.0 32.0 34.0 4 33.06675 34.0 33.0 34.0 32.0 34.0 5 32.911 34.0 33.0 34.0 32.0 34.0 6 36.85575 38.0 37.0 38.0 35.0 38.0 7 37.1285 38.0 38.0 38.0 36.0 38.0 8 37.2705 38.0 38.0 38.0 37.0 38.0 9 37.35225 38.0 38.0 38.0 37.0 38.0 10-14 37.285599999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.29135 38.0 38.0 38.0 37.0 38.0 20-24 37.2142 38.0 38.0 38.0 36.6 38.0 25-29 37.1092 38.0 38.0 38.0 36.4 38.0 30-34 37.0214 38.0 38.0 38.0 35.8 38.0 35-39 36.75475 38.0 38.0 38.0 35.0 38.0 40-44 36.7364 38.0 38.0 38.0 35.0 38.0 45-49 36.6296 38.0 38.0 38.0 34.6 38.0 50-54 37.00055 38.0 38.0 38.0 36.0 38.0 55-59 36.8638 38.0 38.0 38.0 35.4 38.0 60-64 36.9298 38.0 38.0 38.0 35.6 38.0 65-69 36.30945 38.0 38.0 38.0 33.2 38.0 70-74 36.60510000000001 38.0 38.0 38.0 34.4 38.0 75-79 36.52139999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.196749999999994 38.0 37.8 38.0 33.0 38.0 85-89 36.35455 38.0 38.0 38.0 34.0 38.0 90-94 36.16915 38.0 37.6 38.0 33.6 38.0 95-99 36.1279 38.0 37.6 38.0 33.0 38.0 100-104 35.654849999999996 38.0 36.6 38.0 31.0 38.0 105-109 35.572700000000005 38.0 36.2 38.0 31.0 38.0 110-114 35.3482 38.0 36.0 38.0 30.0 38.0 115-119 35.06075 38.0 35.4 38.0 28.2 38.0 120-124 34.84565 38.0 35.2 38.0 27.2 38.0 125-129 33.7691 38.0 33.8 38.0 22.0 38.0 130-134 34.342349999999996 38.0 34.4 38.0 24.4 38.0 135-139 33.998450000000005 38.0 33.8 38.0 23.4 38.0 140-144 33.89905 38.0 33.4 38.0 23.6 38.0 145-149 32.94955 38.0 32.8 38.0 18.2 38.0 150-151 27.89825 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 3.0 12 3.0 13 0.0 14 2.0 15 2.0 16 3.0 17 5.0 18 5.0 19 5.0 20 8.0 21 6.0 22 8.0 23 12.0 24 19.0 25 13.0 26 25.0 27 24.0 28 39.0 29 47.0 30 68.0 31 75.0 32 107.0 33 171.0 34 199.0 35 331.0 36 747.0 37 2069.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.8421052631579 14.710526315789474 8.421052631578947 30.026315789473685 2 24.45 18.3 34.65 22.6 3 22.2 25.900000000000002 23.799999999999997 28.1 4 27.825 30.075000000000003 20.375 21.725 5 25.23857358111502 33.50075339025616 21.17026619789051 20.09040683073832 6 21.275 32.574999999999996 22.85 23.3 7 17.275 18.925 40.625 23.175 8 20.925 20.4 28.199999999999996 30.475 9 22.575 20.0 28.625 28.799999999999997 10-14 24.08 25.735000000000003 23.735 26.450000000000003 15-19 23.849999999999998 24.89 25.155 26.105 20-24 24.035 24.654999999999998 24.755 26.555 25-29 24.117411741174116 25.13751375137514 24.64246424642464 26.102610261026104 30-34 24.84 24.135 24.505 26.52 35-39 24.23 25.230000000000004 24.395 26.145000000000003 40-44 24.57 24.6 24.865000000000002 25.965 45-49 24.25 25.124999999999996 24.425 26.200000000000003 50-54 24.305 24.4 24.45 26.845000000000002 55-59 24.145 24.815 24.83 26.21 60-64 24.275 24.725 24.759999999999998 26.240000000000002 65-69 24.235 25.31 24.515 25.94 70-74 24.834999999999997 24.8 24.675 25.69 75-79 24.474999999999998 24.705 24.404999999999998 26.415 80-84 24.585 24.975 24.52 25.919999999999998 85-89 25.06 24.34 24.38 26.22 90-94 25.009999999999998 24.48 23.835 26.674999999999997 95-99 23.96 25.21 24.555 26.275 100-104 25.47 24.58 23.74 26.21 105-109 24.529999999999998 24.925 24.79 25.755 110-114 24.23 25.19 24.26 26.32 115-119 24.552455245524552 24.942494249424943 24.04740474047405 26.45764576457646 120-124 24.92 24.865000000000002 23.935000000000002 26.279999999999998 125-129 24.817481748174817 24.952495249524954 23.912391239123913 26.31763176317632 130-134 25.555 24.825 23.53 26.090000000000003 135-139 24.81496299259852 24.95999199839968 23.159631926385277 27.065413082616523 140-144 24.987498749874987 24.68746874687469 23.587358735873586 26.737673767376734 145-149 24.60361126394238 24.573600760266093 23.89836442754964 26.924423548241883 150-151 25.218804701175294 25.531382845711427 22.755688922230558 26.494123530882717 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 2.5 27 3.0 28 3.5 29 4.0 30 9.5 31 12.5 32 13.0 33 18.5 34 27.5 35 38.0 36 44.0 37 59.0 38 84.0 39 99.5 40 108.5 41 126.5 42 143.5 43 163.5 44 175.5 45 180.5 46 165.0 47 167.0 48 173.0 49 150.5 50 142.0 51 148.0 52 133.0 53 118.5 54 120.5 55 96.5 56 90.0 57 94.0 58 90.0 59 88.5 60 98.5 61 99.5 62 81.0 63 76.0 64 70.5 65 57.5 66 59.0 67 55.0 68 48.0 69 47.0 70 44.5 71 40.5 72 33.5 73 28.0 74 21.0 75 15.0 76 9.5 77 4.0 78 3.5 79 3.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.02 140-144 0.01 145-149 0.034999999999999996 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80922219407144 97.5 2 1.064099315936154 2.1 3 0.10134279199391943 0.3 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 2.0875 0.0 0.0 0.0 0.0 100-101 2.3875 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 3.0375 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 3.9625000000000004 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 5.0625 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.137499999999999 0.0 0.0 0.0 0.0 118-119 6.637499999999999 0.0 0.0 0.0 0.0 120-121 7.1 0.0 0.0 0.0 0.0 122-123 7.725 0.0 0.0 0.0 0.0 124-125 8.412500000000001 0.0 0.0 0.0 0.0 126-127 9.0875 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.712499999999999 0.0 0.0 0.0 0.0 132-133 11.475 0.0 0.0 0.0 0.0 134-135 12.125 0.0 0.0 0.0 0.0 136-137 12.8875 0.0 0.0 0.0 0.0 138-139 13.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579218 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579218_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.365 33.0 33.0 34.0 31.0 34.0 2 32.57625 33.0 33.0 34.0 32.0 34.0 3 32.62375 33.0 33.0 34.0 32.0 34.0 4 32.512 34.0 33.0 34.0 32.0 34.0 5 32.55725 33.0 33.0 34.0 32.0 34.0 6 36.55475 38.0 38.0 38.0 34.0 38.0 7 36.571 38.0 38.0 38.0 35.0 38.0 8 36.466 38.0 38.0 38.0 34.0 38.0 9 36.20925 38.0 38.0 38.0 34.0 38.0 10-14 36.511 38.0 38.0 38.0 34.4 38.0 15-19 36.5438 38.0 38.0 38.0 35.2 38.0 20-24 36.5323 38.0 38.0 38.0 35.0 38.0 25-29 36.313 38.0 38.0 38.0 34.4 38.0 30-34 36.35515 38.0 38.0 38.0 34.6 38.0 35-39 36.4315 38.0 38.0 38.0 34.8 38.0 40-44 36.4717 38.0 38.0 38.0 34.8 38.0 45-49 36.49735 38.0 38.0 38.0 35.0 38.0 50-54 36.3317 38.0 38.0 38.0 34.2 38.0 55-59 36.357600000000005 38.0 38.0 38.0 34.2 38.0 60-64 36.29245 38.0 38.0 38.0 34.0 38.0 65-69 36.1481 38.0 38.0 38.0 33.8 38.0 70-74 35.759699999999995 38.0 38.0 38.0 32.0 38.0 75-79 35.4856 38.0 37.4 38.0 29.8 38.0 80-84 35.57215 38.0 37.4 38.0 30.8 38.0 85-89 35.67815 38.0 37.6 38.0 32.4 38.0 90-94 35.6108 38.0 37.8 38.0 31.8 38.0 95-99 35.49705 38.0 37.0 38.0 31.0 38.0 100-104 35.290800000000004 38.0 37.0 38.0 30.0 38.0 105-109 35.122400000000006 38.0 36.4 38.0 29.2 38.0 110-114 34.68235 38.0 36.0 38.0 26.8 38.0 115-119 34.30755 38.0 35.0 38.0 23.8 38.0 120-124 33.52795 38.0 34.6 38.0 18.6 38.0 125-129 32.910700000000006 38.0 33.2 38.0 15.0 38.0 130-134 32.799400000000006 38.0 33.0 38.0 14.2 38.0 135-139 32.12579999999999 38.0 31.6 38.0 13.0 38.0 140-144 31.47455 38.0 31.0 38.0 10.4 38.0 145-149 30.039950000000005 37.8 29.0 38.0 2.0 38.0 150-151 24.497125 31.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 12.0 4 4.0 5 5.0 6 3.0 7 1.0 8 1.0 9 4.0 10 5.0 11 2.0 12 3.0 13 6.0 14 1.0 15 8.0 16 6.0 17 5.0 18 7.0 19 12.0 20 10.0 21 15.0 22 15.0 23 26.0 24 21.0 25 22.0 26 30.0 27 49.0 28 43.0 29 46.0 30 77.0 31 91.0 32 130.0 33 169.0 34 238.0 35 313.0 36 678.0 37 1920.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.375 15.6 9.8 28.225 2 26.325 22.400000000000002 29.125 22.15 3 25.974999999999998 23.7 24.925 25.4 4 28.325 31.2 16.85 23.625 5 26.525 33.475 19.35 20.65 6 22.625 33.800000000000004 19.7 23.875 7 22.525000000000002 15.575 36.175000000000004 25.724999999999998 8 22.25 19.025 23.724999999999998 35.0 9 23.549999999999997 22.175 24.775 29.5 10-14 26.215 24.425 23.005 26.355 15-19 26.565 24.224999999999998 23.630000000000003 25.580000000000002 20-24 26.015 24.834999999999997 23.635 25.515 25-29 25.765 25.27 23.474999999999998 25.490000000000002 30-34 25.635 24.815 23.84 25.71 35-39 26.22 24.04 23.9 25.840000000000003 40-44 26.07 24.255 23.89 25.785000000000004 45-49 26.115 24.63 23.53 25.724999999999998 50-54 26.200000000000003 24.39 23.580000000000002 25.83 55-59 26.525 24.325 23.185 25.965 60-64 26.055 24.535 23.76 25.650000000000002 65-69 26.135 23.89 24.235 25.740000000000002 70-74 26.784999999999997 23.875 24.11 25.230000000000004 75-79 26.790000000000003 24.185000000000002 23.59 25.435000000000002 80-84 26.39 24.7 24.02 24.89 85-89 27.425 24.02 23.715 24.84 90-94 26.284999999999997 24.515 24.01 25.19 95-99 27.22 24.705 23.73 24.345 100-104 26.755000000000003 25.290000000000003 23.294999999999998 24.66 105-109 26.345000000000002 24.735 23.875 25.045 110-114 27.015 24.46 23.84 24.685000000000002 115-119 27.52 25.11 23.0 24.37 120-124 27.994999999999997 25.069999999999997 23.175 23.76 125-129 27.77 25.03 23.24 23.96 130-134 28.275 25.490000000000002 23.315 22.919999999999998 135-139 28.82 25.415 23.145 22.62 140-144 28.68 25.040000000000003 23.35 22.93 145-149 28.599999999999998 25.575 23.200000000000003 22.625 150-151 28.299999999999997 25.687500000000004 23.925 22.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 0.0 25 1.5 26 2.0 27 3.0 28 3.5 29 3.5 30 7.5 31 11.0 32 12.0 33 16.5 34 26.0 35 32.0 36 38.0 37 51.0 38 59.0 39 81.0 40 110.0 41 107.5 42 123.5 43 152.0 44 156.5 45 156.5 46 141.5 47 138.0 48 154.5 49 153.0 50 143.5 51 134.5 52 121.0 53 117.5 54 118.0 55 110.0 56 104.5 57 101.5 58 102.5 59 110.5 60 100.0 61 91.0 62 91.0 63 96.0 64 103.0 65 85.0 66 75.0 67 86.5 68 76.0 69 56.0 70 51.5 71 46.5 72 37.5 73 29.5 74 21.5 75 14.0 76 10.0 77 6.0 78 2.5 79 2.5 80 3.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85902636916836 97.475 2 0.8874239350912779 1.7500000000000002 3 0.2281947261663286 0.675 4 0.02535496957403651 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.5875 0.0 0.0 0.0 0.0 96-97 1.95 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.8375000000000004 0.0 0.0 0.0 0.0 104-105 3.2249999999999996 0.0 0.0 0.0 0.0 106-107 3.675 0.0 0.0 0.0 0.0 108-109 4.1125 0.0 0.0 0.0 0.0 110-111 4.65 0.0 0.0 0.0 0.0 112-113 5.2375 0.0 0.0 0.0 0.0 114-115 5.9875 0.0 0.0 0.0 0.0 116-117 6.375 0.0 0.0 0.0 0.0 118-119 6.862500000000001 0.0 0.0 0.0 0.0 120-121 7.324999999999999 0.0 0.0 0.0 0.0 122-123 7.975 0.0 0.0 0.0 0.0 124-125 8.675 0.0 0.0 0.0 0.0 126-127 9.3375 0.0 0.0 0.0 0.0 128-129 9.9625 0.0 0.0 0.0 0.0 130-131 10.975 0.0 0.0 0.0 0.0 132-133 11.7625 0.0 0.0 0.0 0.0 134-135 12.3625 0.0 0.0 0.0 0.0 136-137 13.175 0.0 0.0 0.0 0.0 138-139 13.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCAC 10 0.006830828 145.0 9 GGAAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206382 spots for SRR5579218.sra Written 1206382 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra Read 1206367 spots for SRR5579218.sra Written 1206367 spots for SRR5579218.sra SRR ids: ['SRR5579218.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6p27gbs SRR5579218.sra spots: 24127355 blocks: [[1, 1206367], [1206368, 2412734], [2412735, 3619101], [3619102, 4825468], [4825469, 6031835], [6031836, 7238202], [7238203, 8444569], [8444570, 9650936], [9650937, 10857303], [10857304, 12063670], [12063671, 13270037], [13270038, 14476404], [14476405, 15682771], [15682772, 16889138], [16889139, 18095505], [18095506, 19301872], [19301873, 20508239], [20508240, 21714606], [21714607, 22920973], [22920974, 24127355]] SRR5579218 file size 8154268 SRR5579218 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579218 SRR5579218_1.fastq SRR5579218_2.fastq Input file: SRR5579218_1.fastq Paired file: SRR5579218_2.fastq trimmed: SRR5579218-trimmed-pair1.fastq, SRR5579218-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:35:59 2024 >> started Mon Dec 9 22:36:28 2024 >> done (28.815s) 24127355 read pairs processed; of these: 57719 ( 0.24%) short read pairs filtered out after trimming by size control 70020 ( 0.29%) empty read pairs filtered out after trimming by size control 23999616 (99.47%) read pairs available; of these: 14596637 (60.82%) trimmed read pairs available after processing 9402979 (39.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 24 0.00% 20 15 0.00% 21 26 0.00% 22 23 0.00% 23 14 0.00% 24 23 0.00% 25 34 0.00% 26 32 0.00% 27 41 0.00% 28 35 0.00% 29 48 0.00% 30 39 0.00% 31 46 0.00% 32 55 0.00% 33 39 0.00% 34 64 0.00% 35 55 0.00% 36 76 0.00% 37 85 0.00% 38 85 0.00% 39 116 0.00% 40 111 0.00% 41 147 0.00% 42 146 0.00% 43 161 0.00% 44 180 0.00% 45 216 0.00% 46 239 0.00% 47 264 0.00% 48 298 0.00% 49 350 0.00% 50 433 0.00% 51 455 0.00% 52 519 0.00% 53 575 0.00% 54 627 0.00% 55 701 0.00% 56 795 0.00% 57 950 0.00% 58 1124 0.00% 59 1231 0.01% 60 1419 0.01% 61 1605 0.01% 62 1796 0.01% 63 2114 0.01% 64 2189 0.01% 65 2511 0.01% 66 2766 0.01% 67 3354 0.01% 68 3920 0.02% 69 4910 0.02% 70 5259 0.02% 71 5397 0.02% 72 6329 0.03% 73 6849 0.03% 74 7403 0.03% 75 8291 0.03% 76 9021 0.04% 77 10047 0.04% 78 11221 0.05% 79 12785 0.05% 80 14069 0.06% 81 15781 0.07% 82 17620 0.07% 83 19480 0.08% 84 23371 0.10% 85 25394 0.11% 86 26656 0.11% 87 27614 0.12% 88 29206 0.12% 89 30553 0.13% 90 33370 0.14% 91 36020 0.15% 92 38217 0.16% 93 40476 0.17% 94 42733 0.18% 95 44301 0.18% 96 45668 0.19% 97 47245 0.20% 98 48536 0.20% 99 52074 0.22% 100 54249 0.23% 101 57039 0.24% 102 59437 0.25% 103 62137 0.26% 104 64299 0.27% 105 65589 0.27% 106 68107 0.28% 107 68449 0.29% 108 71036 0.30% 109 72005 0.30% 110 74664 0.31% 111 78175 0.33% 112 80955 0.34% 113 83042 0.35% 114 86516 0.36% 115 88662 0.37% 116 89471 0.37% 117 90819 0.38% 118 90519 0.38% 119 93041 0.39% 120 95920 0.40% 121 97704 0.41% 122 100315 0.42% 123 105507 0.44% 124 108509 0.45% 125 110767 0.46% 126 113975 0.47% 127 114066 0.48% 128 115614 0.48% 129 119402 0.50% 130 120112 0.50% 131 124024 0.52% 132 130341 0.54% 133 134960 0.56% 134 139564 0.58% 135 147039 0.61% 136 152381 0.63% 137 157242 0.66% 138 163484 0.68% 139 173486 0.72% 140 184227 0.77% 141 198728 0.83% 142 222444 0.93% 143 232746 0.97% 144 266284 1.11% 145 307151 1.28% 146 368451 1.54% 147 493886 2.06% 148 682178 2.84% 149 1277473 5.32% 150 5562360 23.18% 151 9402979 39.18% 23999616 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=18 prefix-density=0.87 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=34 fanout-score=28.47 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.0 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=9 prefix-density=0.69 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=84.42 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579218 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:37:16 Started mapping on | Dec 09 22:37:16 Finished on | Dec 09 22:40:58 Mapping speed, Million of reads per hour | 389.18 Number of input reads | 23999616 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 22003737 Uniquely mapped reads % | 91.68% Average mapped length | 286.09 Number of splices: Total | 21820708 Number of splices: Annotated (sjdb) | 20641565 Number of splices: GT/AG | 21530524 Number of splices: GC/AG | 261717 Number of splices: AT/AC | 10415 Number of splices: Non-canonical | 18052 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396490 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 91551 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1638242 1638242 1638242 N_multimapping 396490 396490 396490 N_noFeature 852967 21320204 1106835 N_ambiguous 503734 2873 75008 UnstrandedReadsAssigned:20647036 PositiveStrandReadsAssigned:680660 NegativeStrandReadsAssigned:20821894 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5579218 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579218-trimmed-pair1.fastq SRR5579218-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,999,616 reads, 20,963,620 reads pseudoaligned [quant] estimated average fragment length: 237.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR5579218.ke.tsv 35125 SRR5579218.se.tsv 88098 total ==> SRR5579218.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.964 0 0 PNS24247 1044 807.368 53.2926 4.40844 PNS24249 1928 1691.37 74.2251 2.9309 PNS24246 1044 807.368 53.2926 4.40844 PNS24248 1044 807.368 53.2926 4.40844 PNS24244 1471 1234.37 96.8971 5.2427 PNS24243 293 111.307 0 0 KQK14069 1603 1366.37 950.109 46.4403 KQK14071 474 256.73 47.1974 12.2781 ==> SRR5579218.se.tsv <== BRADI_1g14170v3 1153 BRADI_1g53295v3 89 BRADI_1g59795v3 722 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2357 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 311 BRADI_1g48960v3 0 SRR5579218 completed mapping pipeline successfully