Starting /dee2/code/volunteer_pipeline.sh SRR5579219 current disk space = 1522858045440 free memory = 1420620444 SRR5579219 SRAfilesize f0260bc90768eebe6cca5f672a93a229 SRR5579219.sra SRR5579219.sra file validated SRR5579219 is paired end SRR5579219 is conventional basespace SRR5579219 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579219_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.371 34.0 33.0 34.0 32.0 34.0 2 33.27375 34.0 33.0 34.0 32.0 34.0 3 33.38125 34.0 34.0 34.0 32.0 34.0 4 33.4425 34.0 34.0 34.0 33.0 34.0 5 33.41675 34.0 34.0 34.0 33.0 34.0 6 37.259 38.0 38.0 38.0 36.0 38.0 7 37.4065 38.0 38.0 38.0 37.0 38.0 8 37.55925 38.0 38.0 38.0 38.0 38.0 9 37.59575 38.0 38.0 38.0 38.0 38.0 10-14 37.5955 38.0 38.0 38.0 38.0 38.0 15-19 37.590349999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.53995 38.0 38.0 38.0 38.0 38.0 25-29 37.4422 38.0 38.0 38.0 38.0 38.0 30-34 37.42475 38.0 38.0 38.0 38.0 38.0 35-39 37.2655 38.0 38.0 38.0 37.0 38.0 40-44 37.12535 38.0 38.0 38.0 36.8 38.0 45-49 37.1866 38.0 38.0 38.0 37.0 38.0 50-54 37.304050000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.145450000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.1967 38.0 38.0 38.0 37.0 38.0 65-69 37.011700000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.0041 38.0 38.0 38.0 36.0 38.0 75-79 36.810199999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.65775 38.0 38.0 38.0 35.0 38.0 85-89 36.680600000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.4965 38.0 38.0 38.0 34.6 38.0 95-99 36.398649999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.08605 38.0 38.0 38.0 33.6 38.0 105-109 36.067400000000006 38.0 38.0 38.0 33.6 38.0 110-114 35.64215 38.0 37.2 38.0 31.8 38.0 115-119 35.5284 38.0 36.6 38.0 31.2 38.0 120-124 35.517250000000004 38.0 36.8 38.0 31.2 38.0 125-129 35.2221 38.0 36.4 38.0 30.2 38.0 130-134 34.98885 38.0 35.8 38.0 29.4 38.0 135-139 34.50600000000001 38.0 34.8 38.0 27.0 38.0 140-144 33.9868 38.0 34.0 38.0 24.2 38.0 145-149 32.82170000000001 38.0 33.0 38.0 13.4 38.0 150-151 27.0835 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 4.0 9 0.0 10 5.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 4.0 17 1.0 18 13.0 19 9.0 20 4.0 21 3.0 22 9.0 23 8.0 24 15.0 25 17.0 26 25.0 27 28.0 28 27.0 29 23.0 30 33.0 31 52.0 32 65.0 33 87.0 34 137.0 35 238.0 36 690.0 37 2495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.40641158221303 12.719751809720787 9.643226473629783 31.230610134436404 2 24.95 16.0 32.025 27.025 3 22.225 22.675 25.224999999999998 29.875 4 27.075 27.725 20.375 24.825 5 26.35 30.225 21.95 21.475 6 22.900000000000002 31.924999999999997 22.8 22.375 7 19.400000000000002 21.425 37.275000000000006 21.9 8 19.925 21.45 27.3 31.324999999999996 9 21.7 22.05 29.349999999999998 26.900000000000002 10-14 23.78 26.525 23.785 25.91 15-19 23.525 25.215 24.959999999999997 26.3 20-24 24.472341702510754 24.642392717815344 25.14254276282885 25.742722816845053 25-29 23.855 25.115 25.09 25.94 30-34 24.18830356696183 25.008754815148333 24.838661263695034 25.96428035419481 35-39 24.843726558983846 24.4436665499825 24.503675551332698 26.208931339700953 40-44 24.22680412371134 24.707236512861574 24.95245721149034 26.11350215193674 45-49 24.72213878041454 24.48683288274757 24.742164814258537 26.048863522579353 50-54 24.601982577350554 23.635726444377692 25.08761389806749 26.67467708020427 55-59 24.51441730076091 24.09391269523428 24.61453744493392 26.77713255907089 60-64 24.795954133493566 24.27519903860598 24.66576535977167 26.263081468128785 65-69 24.894810659186536 24.49909837707874 24.49408936084953 26.112001602885194 70-74 24.340425531914896 24.755944931163956 24.335419274092615 26.568210262828533 75-79 24.74108170310702 24.831140241156753 23.85550607895132 26.57227197678491 80-84 25.07128207693462 24.57105697563904 23.740683307488368 26.61697763993797 85-89 24.9262167975589 24.01580711320094 24.636086238807465 26.421889850432695 90-94 24.871166258067746 24.190723970580876 24.500925601641065 26.43718416971031 95-99 25.031314194097902 24.35993787263891 24.389999498972895 26.218748434290294 100-104 25.759623567102167 24.703408920258298 23.787355458777597 25.74961205386194 105-109 25.82758275827583 24.582458245824583 23.237323732373238 26.352635263526352 110-114 25.40884920236781 25.032607605096818 23.271796929868565 26.2867462626668 115-119 25.406351587896975 24.71617904476119 22.95573893473368 26.921730432608154 120-124 25.335 24.42 23.419999999999998 26.825 125-129 25.885 24.560000000000002 23.095 26.46 130-134 25.85 24.115000000000002 23.51 26.525 135-139 25.569999999999997 25.03 23.285 26.115 140-144 26.08 24.68 22.53 26.71 145-149 25.595000000000002 24.099999999999998 22.66 27.644999999999996 150-151 25.887500000000003 24.1625 22.7 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 2.5 25 2.5 26 2.5 27 5.5 28 5.5 29 5.0 30 7.5 31 13.5 32 18.5 33 19.5 34 29.5 35 42.0 36 48.0 37 60.5 38 79.0 39 97.5 40 110.5 41 123.5 42 132.0 43 140.0 44 154.0 45 158.5 46 174.5 47 184.5 48 153.5 49 148.5 50 156.0 51 143.0 52 137.5 53 128.0 54 114.5 55 109.0 56 106.5 57 100.0 58 90.5 59 93.0 60 98.5 61 77.0 62 64.0 63 69.5 64 67.0 65 59.0 66 60.0 67 62.0 68 59.5 69 52.5 70 49.5 71 40.5 72 28.0 73 27.5 74 25.5 75 20.5 76 14.5 77 10.0 78 7.0 79 3.5 80 2.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.055 35-39 0.015 40-44 0.09 45-49 0.13 50-54 0.13 55-59 0.12 60-64 0.145 65-69 0.18 70-74 0.125 75-79 0.065 80-84 0.045 85-89 0.045 90-94 0.065 95-99 0.20500000000000002 100-104 0.11499999999999999 105-109 0.01 110-114 0.33 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.285129255183 96.0 2 1.4589198873816227 2.85 3 0.2047606859482979 0.6 4 0.02559508574353724 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02559508574353724 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 20 (98% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.8875 0.0 0.0 0.0 0.0 104-105 3.2750000000000004 0.0 0.0 0.0 0.0 106-107 3.8 0.0 0.0 0.0 0.0 108-109 4.3125 0.0 0.0 0.0 0.0 110-111 4.9 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 5.8875 0.0 0.0 0.0 0.0 116-117 6.5125 0.0 0.0 0.0 0.0 118-119 7.275 0.0 0.0 0.0 0.0 120-121 7.8625 0.0 0.0 0.0 0.0 122-123 8.525 0.0 0.0 0.0 0.0 124-125 9.0 0.0 0.0 0.0 0.0 126-127 9.45 0.0 0.0 0.0 0.0 128-129 10.0875 0.0 0.0 0.0 0.0 130-131 10.825 0.0 0.0 0.0 0.0 132-133 11.5125 0.0 0.0 0.0 0.0 134-135 12.587499999999999 0.0 0.0 0.0 0.0 136-137 13.274999999999999 0.0 0.0 0.0 0.0 138-139 14.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579219 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579219_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71075 33.0 33.0 34.0 32.0 34.0 2 32.70525 34.0 33.0 34.0 32.0 34.0 3 32.63875 34.0 33.0 34.0 32.0 34.0 4 32.669 34.0 33.0 34.0 32.0 34.0 5 32.63475 34.0 33.0 34.0 32.0 34.0 6 36.56225 38.0 38.0 38.0 36.0 38.0 7 36.79 38.0 38.0 38.0 37.0 38.0 8 36.7765 38.0 38.0 38.0 37.0 38.0 9 36.63575 38.0 38.0 38.0 37.0 38.0 10-14 36.68835 38.0 38.0 38.0 36.8 38.0 15-19 36.660650000000004 38.0 38.0 38.0 36.8 38.0 20-24 36.700599999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.60315 38.0 38.0 38.0 36.4 38.0 30-34 36.652249999999995 38.0 38.0 38.0 36.8 38.0 35-39 36.6949 38.0 38.0 38.0 37.0 38.0 40-44 36.70095 38.0 38.0 38.0 37.0 38.0 45-49 36.60105000000001 38.0 38.0 38.0 36.4 38.0 50-54 36.55195 38.0 38.0 38.0 36.2 38.0 55-59 36.501 38.0 38.0 38.0 35.8 38.0 60-64 36.51095 38.0 38.0 38.0 36.0 38.0 65-69 36.31415 38.0 38.0 38.0 35.4 38.0 70-74 36.02804999999999 38.0 38.0 38.0 34.2 38.0 75-79 35.8968 38.0 38.0 38.0 33.8 38.0 80-84 35.8549 38.0 38.0 38.0 34.0 38.0 85-89 35.9302 38.0 38.0 38.0 33.8 38.0 90-94 35.89620000000001 38.0 38.0 38.0 34.0 38.0 95-99 35.800850000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.59325 38.0 38.0 38.0 33.0 38.0 105-109 35.36045 38.0 38.0 38.0 31.8 38.0 110-114 35.11875 38.0 37.8 38.0 30.6 38.0 115-119 34.93555 38.0 36.6 38.0 29.4 38.0 120-124 34.333 38.0 35.6 38.0 24.4 38.0 125-129 33.988800000000005 38.0 35.0 38.0 22.8 38.0 130-134 33.607299999999995 38.0 34.4 38.0 21.0 38.0 135-139 33.149 38.0 33.4 38.0 16.6 38.0 140-144 32.4673 38.0 33.0 38.0 12.0 38.0 145-149 31.133699999999997 38.0 32.2 38.0 2.0 38.0 150-151 25.237625 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 8.0 4 9.0 5 4.0 6 2.0 7 2.0 8 1.0 9 3.0 10 4.0 11 3.0 12 4.0 13 8.0 14 9.0 15 8.0 16 12.0 17 13.0 18 5.0 19 12.0 20 7.0 21 10.0 22 11.0 23 13.0 24 11.0 25 15.0 26 17.0 27 27.0 28 29.0 29 33.0 30 38.0 31 55.0 32 77.0 33 105.0 34 145.0 35 252.0 36 598.0 37 2409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.94646896205077 16.461422467956773 12.289519979894447 24.302588590098015 2 28.172907765770294 22.44282483035939 25.483789896959035 23.900477506911283 3 26.113207547169807 22.41509433962264 25.761006289308174 25.710691823899374 4 29.638009049773757 29.160382101558575 18.225238813474107 22.976370035193565 5 27.64513696908771 32.52073385272681 17.441568233224427 22.392560944961044 6 23.70407649723201 31.429290387518872 20.306995470558633 24.559637644690486 7 22.213855421686745 17.74598393574297 33.50903614457831 26.53112449799197 8 23.64457831325301 22.13855421686747 22.113453815261046 32.10341365461847 9 24.86173956762192 20.864756158873806 24.811463046757165 29.46204122674711 10-14 26.518421845196265 24.73145266539504 22.181507880734866 26.56861760867383 15-19 26.836356348331496 24.556568794468383 22.71770718508869 25.889367672111437 20-24 27.000601684717207 24.19273967107902 22.648415563578016 26.158243080625752 25-29 26.95120729385833 25.257990181344553 22.292355475403266 25.498447049393846 30-34 26.854450681635928 24.3785084202085 23.07036888532478 25.696672012830795 35-39 26.449802014936598 24.464939100796954 23.407348002606383 25.677910881660065 40-44 27.53521479773422 23.981151937440472 22.647751767005865 25.83588149781944 45-49 27.322431781701447 23.229333868378813 23.560393258426966 25.887841091492774 50-54 26.94583751253761 23.74122367101304 23.44533600802407 25.86760280842528 55-59 27.213032581453632 24.416040100250626 22.872180451127818 25.49874686716792 60-64 26.903400541679208 24.761761460527637 22.860868692948138 25.473969304845017 65-69 26.461878231190084 24.905887667519952 22.858003312754104 25.774230788535863 70-74 27.17745574888432 24.219024219024217 23.166023166023166 25.437496866068294 75-79 27.433273128637364 24.35781657635962 22.672085089303632 25.536825205699376 80-84 26.91073219658977 24.784353059177533 23.2246740220662 25.080240722166497 85-89 26.4235187879396 24.135855114634026 23.338182912757738 26.10244318466864 90-94 26.837092731829575 24.43107769423559 23.604010025062657 25.127819548872182 95-99 26.708136851610316 24.701514999498343 23.10625062706933 25.484097521822015 100-104 27.09606330762296 24.601823099268756 23.274566763497948 25.027546829610337 105-109 27.205329860241445 24.390121725191605 23.428342433501978 24.976205981064968 110-114 27.48884096494308 24.584984201815537 23.04528812879282 24.880886704448567 115-119 27.352440124260944 25.313157631025152 22.802886060727527 24.531516183986373 120-124 27.641136101788312 24.896057706757503 22.92240645193608 24.540399739518108 125-129 28.147107520947266 24.81561386784406 23.260247855100094 23.777030756108573 130-134 28.32990518236091 25.189384437866853 22.946872021271258 23.533838358500976 135-139 29.122754190504867 25.07276924621098 23.18578741342969 22.61868914985446 140-144 29.29008936640225 25.303745355959435 22.74826789838337 22.657897379254948 145-149 28.746300105352933 25.61079616715999 22.98700647168013 22.655897255806952 150-151 29.87583092938668 23.86805468456039 23.44161545215101 22.81449893390192 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 2.0 3 2.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 0.5 23 0.0 24 0.5 25 1.5 26 3.0 27 3.0 28 3.0 29 2.5 30 3.0 31 7.0 32 9.5 33 10.5 34 17.0 35 24.0 36 31.5 37 41.0 38 56.0 39 72.5 40 86.0 41 102.0 42 119.5 43 124.5 44 135.5 45 151.0 46 155.0 47 161.5 48 156.0 49 145.0 50 134.5 51 131.5 52 143.0 53 137.0 54 124.0 55 124.5 56 122.0 57 109.5 58 93.0 59 110.0 60 117.0 61 96.0 62 95.0 63 95.0 64 88.5 65 86.5 66 77.0 67 75.0 68 76.0 69 63.5 70 55.0 71 47.5 72 43.0 73 34.0 74 23.0 75 15.5 76 11.5 77 10.5 78 7.0 79 5.5 80 3.0 81 1.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.525 3 0.625 4 0.5499999999999999 5 0.525 6 0.65 7 0.4 8 0.4 9 0.5499999999999999 10-14 0.38999999999999996 15-19 0.21 20-24 0.27999999999999997 25-29 0.19 30-34 0.24 35-39 0.245 40-44 0.255 45-49 0.32 50-54 0.3 55-59 0.25 60-64 0.31 65-69 0.385 70-74 0.28500000000000003 75-79 0.33999999999999997 80-84 0.3 85-89 0.335 90-94 0.25 95-99 0.33 100-104 0.16999999999999998 105-109 0.185 110-114 0.305 115-119 0.21 120-124 0.185 125-129 0.345 130-134 0.335 135-139 0.37 140-144 0.41000000000000003 145-149 0.335 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11904148415357 95.19999999999999 2 1.4686936356609122 2.85 3 0.2061324400927596 0.6 4 0.1030662200463798 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0515331100231899 0.35000000000000003 8 0.02576655501159495 0.2 9 0.0 0.0 >10 0.02576655501159495 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 16 0.4 Illumina Single End PCR Primer 1 (100% over 50bp) GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 8 0.2 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 7 0.17500000000000002 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9375 0.0 0.0 0.0 0.0 104-105 3.3 0.0 0.0 0.0 0.0 106-107 3.8 0.0 0.0 0.0 0.0 108-109 4.275 0.0 0.0 0.0 0.0 110-111 4.8875 0.0 0.0 0.0 0.0 112-113 5.4 0.0 0.0 0.0 0.0 114-115 5.85 0.0 0.0 0.0 0.0 116-117 6.45 0.0 0.0 0.0 0.0 118-119 7.1625 0.0 0.0 0.0 0.0 120-121 7.825 0.0 0.0 0.0 0.0 122-123 8.412500000000001 0.0 0.0 0.0 0.0 124-125 8.95 0.0 0.0 0.0 0.0 126-127 9.4375 0.0 0.0 0.0 0.0 128-129 10.1125 0.0 0.0 0.0 0.0 130-131 10.85 0.0 0.0 0.0 0.0 132-133 11.462499999999999 0.0 0.0 0.0 0.0 134-135 12.55 0.0 0.0 0.0 0.0 136-137 13.3 0.0 0.0 0.0 0.0 138-139 14.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATGTT 10 0.006830828 145.0 6 GACATGT 10 0.006830828 145.0 5 >>END_MODULE Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648126 spots for SRR5579219.sra Written 648126 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra Read 648116 spots for SRR5579219.sra Written 648116 spots for SRR5579219.sra SRR ids: ['SRR5579219.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g1d3mib9 SRR5579219.sra spots: 12962330 blocks: [[1, 648116], [648117, 1296232], [1296233, 1944348], [1944349, 2592464], [2592465, 3240580], [3240581, 3888696], [3888697, 4536812], [4536813, 5184928], [5184929, 5833044], [5833045, 6481160], [6481161, 7129276], [7129277, 7777392], [7777393, 8425508], [8425509, 9073624], [9073625, 9721740], [9721741, 10369856], [10369857, 11017972], [11017973, 11666088], [11666089, 12314204], [12314205, 12962330]] SRR5579219 file size 4370807 SRR5579219 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579219 SRR5579219_1.fastq SRR5579219_2.fastq Input file: SRR5579219_1.fastq Paired file: SRR5579219_2.fastq trimmed: SRR5579219-trimmed-pair1.fastq, SRR5579219-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:36:30 2024 >> started Mon Dec 9 22:36:46 2024 >> done (16.392s) 12962330 read pairs processed; of these: 36734 ( 0.28%) short read pairs filtered out after trimming by size control 127332 ( 0.98%) empty read pairs filtered out after trimming by size control 12798264 (98.73%) read pairs available; of these: 7778930 (60.78%) trimmed read pairs available after processing 5019334 (39.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 25 0.00% 20 15 0.00% 21 29 0.00% 22 12 0.00% 23 22 0.00% 24 25 0.00% 25 17 0.00% 26 25 0.00% 27 26 0.00% 28 24 0.00% 29 35 0.00% 30 31 0.00% 31 31 0.00% 32 33 0.00% 33 33 0.00% 34 29 0.00% 35 50 0.00% 36 38 0.00% 37 57 0.00% 38 52 0.00% 39 56 0.00% 40 73 0.00% 41 57 0.00% 42 70 0.00% 43 65 0.00% 44 113 0.00% 45 123 0.00% 46 116 0.00% 47 157 0.00% 48 154 0.00% 49 183 0.00% 50 184 0.00% 51 194 0.00% 52 256 0.00% 53 244 0.00% 54 286 0.00% 55 317 0.00% 56 383 0.00% 57 440 0.00% 58 471 0.00% 59 534 0.00% 60 603 0.00% 61 674 0.01% 62 797 0.01% 63 882 0.01% 64 965 0.01% 65 1147 0.01% 66 1341 0.01% 67 1735 0.01% 68 2529 0.02% 69 5910 0.05% 70 4938 0.04% 71 2989 0.02% 72 2919 0.02% 73 3090 0.02% 74 3304 0.03% 75 3609 0.03% 76 4102 0.03% 77 4324 0.03% 78 4836 0.04% 79 5564 0.04% 80 6164 0.05% 81 7126 0.06% 82 7950 0.06% 83 8822 0.07% 84 11016 0.09% 85 12350 0.10% 86 13017 0.10% 87 13789 0.11% 88 14806 0.12% 89 15707 0.12% 90 17924 0.14% 91 18202 0.14% 92 19166 0.15% 93 20643 0.16% 94 22057 0.17% 95 22798 0.18% 96 23624 0.18% 97 24230 0.19% 98 25156 0.20% 99 26725 0.21% 100 27758 0.22% 101 29866 0.23% 102 31661 0.25% 103 33337 0.26% 104 34657 0.27% 105 36957 0.29% 106 37696 0.29% 107 37606 0.29% 108 38781 0.30% 109 39507 0.31% 110 40392 0.32% 111 42996 0.34% 112 44776 0.35% 113 47849 0.37% 114 48927 0.38% 115 50708 0.40% 116 51364 0.40% 117 51562 0.40% 118 51211 0.40% 119 52668 0.41% 120 53585 0.42% 121 55107 0.43% 122 56721 0.44% 123 60452 0.47% 124 62697 0.49% 125 64590 0.50% 126 65956 0.52% 127 65972 0.52% 128 65952 0.52% 129 67025 0.52% 130 66999 0.52% 131 69157 0.54% 132 73424 0.57% 133 75853 0.59% 134 77975 0.61% 135 82413 0.64% 136 85348 0.67% 137 86940 0.68% 138 89307 0.70% 139 92347 0.72% 140 94367 0.74% 141 100022 0.78% 142 107237 0.84% 143 114737 0.90% 144 128568 1.00% 145 147751 1.15% 146 174610 1.36% 147 224275 1.75% 148 325962 2.55% 149 631965 4.94% 150 3088717 24.13% 151 5019334 39.22% 12798264 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=13 prefix-density=1.02 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=24.23 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=TTTTTTTTTCGCATATAACCACATTCAAATTGACCTCCCTCAGGAAGCTAAGAAATACTATCTCGGCAATAGGATTGTAGCCCAGGATGAGTCCCTCAGCGTGACGCAGTAAACTAGTAGCATCCCGATCTTTTCCCTATCTAATTCACCTCCTATTAGGAGCCGATCGTGCTTGTGCGCCGGCAAAACTTTTCAGGCGAATTTCCGCCCCTGGCGCTCTAGGCTACTACGTGCGCGATATGACAAGTTAACAAGACGGCGCAGGTTGATGCTTCCAATAAACATGATCTTTCTGCTCCGCTGAGAAGTACACCTTTTTGCTAGCATCTCGCACGGCAAGAGCGATTGCCGAGCTTAGAGCGTATCTTCCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCATGTGTAGTGCGCCATATCATATCCAAGATAGTGTAGGACTCGTCGCATTGGATGACGATGCCTAGTACTGTGCGCCAATTAGGTCGTCATTGC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=25 prefix-density=0.77 prefix-fanout=2.2 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=17.46 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.9 sequence=CTGCTGGGTGCCAACGGCGGCGTGCTGGTGTTCGAGCCGAACGAGTTCAGCGTCAAGGCCGGGGAGACGATCACGTTCAAGAACAACGCCGGGTTCCCCCACAACATCGTGTTCGACGAGGACGCCGTGCCCAGCGGCGTCGACGTCTCCAAGATCTCCCAGGAGGAGTACCTCAACGCCCCCGGCGAGACTTTCTCCGTCACGCTCACTGTCCCTGGCACCTACGGCTTCTACTGCGAGCCACATGCCGGGGCCGGCATGGTCGGCAAGGTCACCGTCAACTGATTGATGCATCGCCCGGCCCGCCTTAATTTCTCCGTTTCAAGGGTGTCAATATATGATGATGTGTTGTTATAATGTACGCGCCTGCAAACTATATACATGCAGGATCATTGATGAGCCAGCTGATACTATATATTTCTCCATCTCTGTGAGTCATAT SRR5579219 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:37:45 Started mapping on | Dec 09 22:37:45 Finished on | Dec 09 22:43:36 Mapping speed, Million of reads per hour | 131.26 Number of input reads | 12798264 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 10785619 Uniquely mapped reads % | 84.27% Average mapped length | 286.23 Number of splices: Total | 10600582 Number of splices: Annotated (sjdb) | 9936116 Number of splices: GT/AG | 10467200 Number of splices: GC/AG | 120175 Number of splices: AT/AC | 5460 Number of splices: Non-canonical | 7747 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186422 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 38044 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.23% % of reads unmapped: other | 1.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1848086 1848086 1848086 N_multimapping 186422 186422 186422 N_noFeature 336588 10432741 452782 N_ambiguous 289896 1576 53614 UnstrandedReadsAssigned:10159135 PositiveStrandReadsAssigned:351302 NegativeStrandReadsAssigned:10279223 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR5579219 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579219-trimmed-pair1.fastq SRR5579219-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,798,264 reads, 10,367,015 reads pseudoaligned [quant] estimated average fragment length: 218.637 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR5579219.ke.tsv 35125 SRR5579219.se.tsv 88098 total ==> SRR5579219.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.652 14.991 2.40138 PNS24247 1044 826.363 25.5736 3.56262 PNS24249 1928 1710.36 59.8814 4.03044 PNS24246 1044 826.363 25.5736 3.56262 PNS24248 1044 826.363 25.5736 3.56262 PNS24244 1471 1253.36 19.4067 1.78247 PNS24243 293 111.9 0 0 KQK14069 1603 1385.36 1841.81 153.049 KQK14071 474 266.024 53.579 23.1858 ==> SRR5579219.se.tsv <== BRADI_1g14170v3 1997 BRADI_1g53295v3 16 BRADI_1g59795v3 77 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 1214 BRADI_1g74790v3 95 BRADI_1g09890v3 5 BRADI_1g77505v3 295 BRADI_1g48960v3 0 SRR5579219 completed mapping pipeline successfully