Starting /dee2/code/volunteer_pipeline.sh SRR5579220 current disk space = 1522892972032 free memory = 1570830448 SRR5579220 SRAfilesize fe2876ce49a5dab5eb562094463ad370 SRR5579220.sra SRR5579220.sra file validated SRR5579220 is paired end SRR5579220 is conventional basespace SRR5579220 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579220_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5805 34.0 33.0 34.0 32.0 34.0 2 33.1815 34.0 33.0 34.0 32.0 34.0 3 33.3405 34.0 33.0 34.0 32.0 34.0 4 33.46975 34.0 34.0 34.0 33.0 34.0 5 33.48225 34.0 34.0 34.0 33.0 34.0 6 37.35125 38.0 38.0 38.0 37.0 38.0 7 37.50175 38.0 38.0 38.0 37.0 38.0 8 37.6045 38.0 38.0 38.0 38.0 38.0 9 37.54675 38.0 38.0 38.0 38.0 38.0 10-14 37.5992 38.0 38.0 38.0 38.0 38.0 15-19 37.60775 38.0 38.0 38.0 38.0 38.0 20-24 37.59325 38.0 38.0 38.0 38.0 38.0 25-29 37.4327 38.0 38.0 38.0 38.0 38.0 30-34 37.456849999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.21125 38.0 38.0 38.0 37.0 38.0 40-44 37.16545000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.19305 38.0 38.0 38.0 36.8 38.0 50-54 37.39135 38.0 38.0 38.0 37.6 38.0 55-59 37.215849999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.266650000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.091150000000006 38.0 38.0 38.0 36.4 38.0 70-74 37.112249999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.996449999999996 38.0 38.0 38.0 36.2 38.0 80-84 36.8721 38.0 38.0 38.0 35.4 38.0 85-89 36.93055 38.0 38.0 38.0 35.8 38.0 90-94 36.7776 38.0 38.0 38.0 35.2 38.0 95-99 36.657599999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.291700000000006 38.0 38.0 38.0 33.8 38.0 105-109 36.432249999999996 38.0 38.0 38.0 34.0 38.0 110-114 35.937349999999995 38.0 37.4 38.0 32.2 38.0 115-119 35.8152 38.0 37.0 38.0 32.2 38.0 120-124 35.830149999999996 38.0 37.2 38.0 32.0 38.0 125-129 35.601549999999996 38.0 36.6 38.0 31.2 38.0 130-134 35.311 38.0 36.0 38.0 30.6 38.0 135-139 34.85325 38.0 36.0 38.0 28.8 38.0 140-144 34.43580000000001 38.0 35.0 38.0 26.8 38.0 145-149 33.436299999999996 38.0 33.0 38.0 20.4 38.0 150-151 27.975625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 5.0 18 2.0 19 4.0 20 2.0 21 5.0 22 9.0 23 6.0 24 11.0 25 15.0 26 21.0 27 23.0 28 30.0 29 32.0 30 35.0 31 47.0 32 74.0 33 83.0 34 129.0 35 235.0 36 635.0 37 2590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55154091392136 12.194473963868226 10.12221041445271 36.1317747077577 2 23.025000000000002 19.85 35.375 21.75 3 23.175 24.175 23.05 29.599999999999998 4 27.825 31.474999999999998 19.025 21.675 5 25.374999999999996 33.575 21.475 19.575 6 20.4 32.300000000000004 23.925 23.375 7 17.299999999999997 18.875 43.175000000000004 20.65 8 20.5 19.225 26.85 33.425 9 22.75 19.25 29.549999999999997 28.449999999999996 10-14 23.72 25.900000000000002 24.654999999999998 25.724999999999998 15-19 24.425 25.264999999999997 24.625 25.685000000000002 20-24 23.472041612483746 25.127538261478442 25.212563769130742 26.187856356907073 25-29 24.0 25.040000000000003 24.955 26.005 30-34 24.359615769461676 24.22953772263358 25.05503301981189 26.355813488092856 35-39 23.894778955791157 24.70494098819764 25.145029005801163 26.255251050210042 40-44 24.588358940993942 24.41819728742305 25.3891196636805 25.60432410790251 45-49 24.216638302132345 24.411853038342176 24.947442186405045 26.424066473120433 50-54 23.27525783518574 24.747171322719534 25.22278962651447 26.754781215580252 55-59 24.416741764293583 25.042555321918492 24.606989085811552 25.93371382797637 60-64 24.250312891113893 24.685857321652065 24.53566958698373 26.528160200250312 65-69 24.360322467577987 24.765910570326973 24.735867007160383 26.137899954934657 70-74 24.260325406758447 25.221526908635795 24.410513141426783 26.107634543178975 75-79 24.732366183091546 24.447223611805903 24.517258629314657 26.303151575787894 80-84 24.967490247074124 24.392317695308595 24.287286185855756 26.35290587176153 85-89 24.58483393357343 24.869947979191675 24.31972789115646 26.225490196078432 90-94 24.682341170585293 24.8224112056028 24.37718859429715 26.118059029514757 95-99 24.396232087383503 24.65176871430003 25.002505261048203 25.949493937268265 100-104 24.732151797336538 24.962451186542506 24.752177831180536 25.553219184940424 105-109 25.16877531629744 24.35865379806971 24.313647047057056 26.158923838575788 110-114 25.072740042139056 24.902177184709544 23.928965586435236 26.09611718671616 115-119 24.878731809771466 25.08376256438466 23.57353603040456 26.46396959543932 120-124 25.03 24.43 23.96 26.58 125-129 25.290000000000003 25.05 24.15 25.509999999999998 130-134 25.145 24.98 23.77 26.105 135-139 25.255 24.395 24.37 25.979999999999997 140-144 25.480000000000004 24.955 23.544999999999998 26.02 145-149 24.955 24.805 23.86 26.38 150-151 25.124999999999996 24.85 23.425 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 3.5 29 3.5 30 5.0 31 11.0 32 17.0 33 17.5 34 24.5 35 42.5 36 54.5 37 59.5 38 72.5 39 104.0 40 119.5 41 138.5 42 159.5 43 168.5 44 178.5 45 183.0 46 195.0 47 188.0 48 165.0 49 160.0 50 156.0 51 141.5 52 123.0 53 106.5 54 102.5 55 101.0 56 89.0 57 87.0 58 86.0 59 81.5 60 82.5 61 81.0 62 77.0 63 61.5 64 59.0 65 66.5 66 63.5 67 57.0 68 52.0 69 55.0 70 58.0 71 42.0 72 25.0 73 20.5 74 14.0 75 9.5 76 11.0 77 8.5 78 5.0 79 2.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.8999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.06 35-39 0.02 40-44 0.095 45-49 0.11 50-54 0.13 55-59 0.13 60-64 0.125 65-69 0.145 70-74 0.125 75-79 0.05 80-84 0.03 85-89 0.04 90-94 0.05 95-99 0.21 100-104 0.13 105-109 0.015 110-114 0.33 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.4625 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.2 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 3.0125 0.0 0.0 0.0 0.0 102-103 3.5 0.0 0.0 0.0 0.0 104-105 3.9000000000000004 0.0 0.0 0.0 0.0 106-107 4.275 0.0 0.0 0.0 0.0 108-109 4.8375 0.0 0.0 0.0 0.0 110-111 5.2625 0.0 0.0 0.0 0.0 112-113 5.6125 0.0 0.0 0.0 0.0 114-115 5.975 0.0 0.0 0.0 0.0 116-117 6.6375 0.0 0.0 0.0 0.0 118-119 7.3 0.0 0.0 0.0 0.0 120-121 7.7625 0.0 0.0 0.0 0.0 122-123 8.3875 0.0 0.0 0.0 0.0 124-125 9.0125 0.0 0.0 0.0 0.0 126-127 9.7 0.0 0.0 0.0 0.0 128-129 10.375 0.0 0.0 0.0 0.0 130-131 11.1625 0.0 0.0 0.0 0.0 132-133 11.975000000000001 0.0 0.0 0.0 0.0 134-135 12.662500000000001 0.0 0.0 0.0 0.0 136-137 13.3875 0.0 0.0 0.0 0.0 138-139 14.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007700867 18.10625 140-144 CACGGTA 40 0.007700867 18.10625 135-139 >>END_MODULE SRR5579220 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579220_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.817 33.0 33.0 34.0 32.0 34.0 2 32.823 34.0 33.0 34.0 32.0 34.0 3 32.9005 34.0 33.0 34.0 32.0 34.0 4 32.89875 34.0 33.0 34.0 32.0 34.0 5 32.8275 34.0 33.0 34.0 33.0 34.0 6 36.95525 38.0 38.0 38.0 37.0 38.0 7 37.12725 38.0 38.0 38.0 37.0 38.0 8 37.108 38.0 38.0 38.0 37.0 38.0 9 36.94775 38.0 38.0 38.0 37.0 38.0 10-14 36.98915 38.0 38.0 38.0 37.0 38.0 15-19 36.9836 38.0 38.0 38.0 37.0 38.0 20-24 37.031400000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.9268 38.0 38.0 38.0 37.0 38.0 30-34 36.993700000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.053799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.04684999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.97005 38.0 38.0 38.0 37.0 38.0 50-54 36.93985 38.0 38.0 38.0 37.0 38.0 55-59 36.807849999999995 38.0 38.0 38.0 36.4 38.0 60-64 36.899699999999996 38.0 38.0 38.0 36.8 38.0 65-69 36.73845 38.0 38.0 38.0 36.0 38.0 70-74 36.415549999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.33885 38.0 38.0 38.0 34.4 38.0 80-84 36.357600000000005 38.0 38.0 38.0 34.6 38.0 85-89 36.366550000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.460899999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.330349999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.0598 38.0 38.0 38.0 33.8 38.0 105-109 35.82195 38.0 38.0 38.0 33.2 38.0 110-114 35.58115 38.0 38.0 38.0 32.0 38.0 115-119 35.261100000000006 38.0 36.8 38.0 30.6 38.0 120-124 34.6913 38.0 35.8 38.0 26.4 38.0 125-129 34.372400000000006 38.0 35.4 38.0 25.6 38.0 130-134 33.99875000000001 38.0 35.0 38.0 23.0 38.0 135-139 33.621849999999995 38.0 34.2 38.0 20.8 38.0 140-144 32.97605 38.0 33.2 38.0 15.2 38.0 145-149 31.4339 38.0 32.6 38.0 5.8 38.0 150-151 25.45025 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 4.0 4 5.0 5 2.0 6 1.0 7 1.0 8 2.0 9 2.0 10 2.0 11 4.0 12 1.0 13 3.0 14 6.0 15 5.0 16 10.0 17 4.0 18 5.0 19 9.0 20 8.0 21 9.0 22 6.0 23 10.0 24 17.0 25 17.0 26 19.0 27 23.0 28 27.0 29 37.0 30 49.0 31 50.0 32 91.0 33 102.0 34 166.0 35 286.0 36 616.0 37 2381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.89087251697259 13.376917274327383 11.516218254966056 33.21599195373397 2 26.57782247925572 22.177520744279608 30.09806386723661 21.146592909228062 3 23.678912934071462 24.484146955208857 26.597886260694516 25.23905385002516 4 26.502388735227562 32.763389489565 17.57606235856173 23.158159416645713 5 26.04978627105859 32.38622076942419 19.51219512195122 22.051797837566003 6 22.06844489179668 34.77604428787116 19.552088575742324 23.603422244589833 7 20.291310899045705 14.213962832747363 38.849824208940234 26.644902059266702 8 22.389558232931726 19.377510040160644 23.268072289156628 34.964859437751 9 23.88735227558461 20.920291677143577 25.546894644204176 29.645461403067642 10-14 25.80110497237569 25.3088900050226 22.476142641888497 26.41386238071321 15-19 25.86690719583083 24.378632992583686 23.75225496091401 26.00220485067148 20-24 26.35884567126725 24.77289836888331 23.357590966122963 25.510664993726472 25-29 25.864315061629423 24.321074255937468 23.57951698566991 26.2350936967632 30-34 27.12280701754386 24.461152882205514 23.17794486215539 25.238095238095237 35-39 25.735625845907062 24.51250689257607 24.24682941500827 25.5050378465086 40-44 26.228932584269664 23.70585874799358 24.56360353130016 25.501605136436595 45-49 26.76805701952517 24.429051849621043 23.641017918988105 25.161873211865682 50-54 26.245797159632662 24.153159030461183 24.193305565313395 25.407738244592764 55-59 26.395226395226395 24.575038860753146 23.857995286566716 25.171739457453747 60-64 26.241027957636902 24.243336846860412 23.96225468052 25.55338051498268 65-69 26.431297709923662 24.46263559662515 23.23222177581358 25.873844917637605 70-74 25.952321204516938 24.471769134253453 23.89460476787955 25.681304893350067 75-79 25.496888175065248 24.628588636819913 24.24212005621361 25.632403131901228 80-84 26.45730912009632 25.032607605096818 23.201565165044645 25.30851810976222 85-89 25.97409118296847 24.598312914239806 24.030929905603536 25.39666599718819 90-94 26.472800200551518 24.87340185510153 23.634996239659063 25.018801704687892 95-99 26.406665662801785 25.27731767304121 23.2344526426743 25.08156402148271 100-104 26.85677057231633 24.74691791119575 23.7045203969129 24.691791119575022 105-109 26.71644783000902 24.47128395309211 23.87491229828606 24.93735591861281 110-114 27.39134798755395 24.826859379704906 23.426678711231556 24.355113921509584 115-119 27.086779966912317 25.632927257231664 23.191457362009324 24.08883541384669 120-124 27.5751503006012 24.97995991983968 24.05811623246493 23.38677354709419 125-129 27.785585223850635 25.552097972294717 23.418992170246938 23.24332463360771 130-134 28.374310085298543 24.33517310587055 24.029101856497743 23.261414952333165 135-139 28.00622583722448 25.320078325048957 23.81884822011347 22.854847617613096 140-144 28.21414222579349 25.632784250703093 23.563680192848533 22.58939333065488 145-149 28.459608630205718 25.775213246362267 23.447064726542898 22.31811339688911 150-151 29.06261764336805 26.42740619902121 22.411845902873637 22.098130254737107 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 1.5 6 2.5 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 1.0 29 3.5 30 5.0 31 7.0 32 12.5 33 13.5 34 16.5 35 27.5 36 39.5 37 48.0 38 69.0 39 99.0 40 108.5 41 108.5 42 117.5 43 135.5 44 165.0 45 179.0 46 179.5 47 175.5 48 161.5 49 153.0 50 146.5 51 133.0 52 125.0 53 116.0 54 111.5 55 110.0 56 93.0 57 92.0 58 95.5 59 91.0 60 91.0 61 82.5 62 82.0 63 89.0 64 89.0 65 75.5 66 72.5 67 81.5 68 74.5 69 66.5 70 52.0 71 44.5 72 42.5 73 30.0 74 20.5 75 14.0 76 10.0 77 9.0 78 7.0 79 4.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.575 3 0.65 4 0.575 5 0.575 6 0.65 7 0.44999999999999996 8 0.4 9 0.575 10-14 0.44999999999999996 15-19 0.22 20-24 0.375 25-29 0.21 30-34 0.25 35-39 0.255 40-44 0.32 45-49 0.385 50-54 0.365 55-59 0.28500000000000003 60-64 0.385 65-69 0.44 70-74 0.375 75-79 0.38 80-84 0.33 85-89 0.42 90-94 0.27499999999999997 95-99 0.385 100-104 0.22999999999999998 105-109 0.22999999999999998 110-114 0.37 115-119 0.265 120-124 0.2 125-129 0.38 130-134 0.35000000000000003 135-139 0.415 140-144 0.44 145-149 0.35000000000000003 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9367088607595 97.7 2 0.8607594936708861 1.7000000000000002 3 0.20253164556962028 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.9750000000000001 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.5125 0.0 0.0 0.0 0.0 94-95 1.875 0.0 0.0 0.0 0.0 96-97 2.275 0.0 0.0 0.0 0.0 98-99 2.5250000000000004 0.0 0.0 0.0 0.0 100-101 3.0375 0.0 0.0 0.0 0.0 102-103 3.5625 0.0 0.0 0.0 0.0 104-105 4.0 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.325 0.0 0.0 0.0 0.0 112-113 5.675 0.0 0.0 0.0 0.0 114-115 6.0375 0.0 0.0 0.0 0.0 116-117 6.6625 0.0 0.0 0.0 0.0 118-119 7.35 0.0 0.0 0.0 0.0 120-121 7.85 0.0 0.0 0.0 0.0 122-123 8.4375 0.0 0.0 0.0 0.0 124-125 9.0375 0.0 0.0 0.0 0.0 126-127 9.712499999999999 0.0 0.0 0.0 0.0 128-129 10.375 0.0 0.0 0.0 0.0 130-131 11.075 0.0 0.0 0.0 0.0 132-133 11.8625 0.0 0.0 0.0 0.0 134-135 12.5625 0.0 0.0 0.0 0.0 136-137 13.287500000000001 0.0 0.0 0.0 0.0 138-139 14.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCGGT 40 0.0076550315 18.125 140-144 >>END_MODULE Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973651 spots for SRR5579220.sra Written 973651 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra Read 973632 spots for SRR5579220.sra Written 973632 spots for SRR5579220.sra SRR ids: ['SRR5579220.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vagghhlo SRR5579220.sra spots: 19472659 blocks: [[1, 973632], [973633, 1947264], [1947265, 2920896], [2920897, 3894528], [3894529, 4868160], [4868161, 5841792], [5841793, 6815424], [6815425, 7789056], [7789057, 8762688], [8762689, 9736320], [9736321, 10709952], [10709953, 11683584], [11683585, 12657216], [12657217, 13630848], [13630849, 14604480], [14604481, 15578112], [15578113, 16551744], [16551745, 17525376], [17525377, 18499008], [18499009, 19472659]] SRR5579220 file size 6576944 SRR5579220 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579220 SRR5579220_1.fastq SRR5579220_2.fastq Input file: SRR5579220_1.fastq Paired file: SRR5579220_2.fastq trimmed: SRR5579220-trimmed-pair1.fastq, SRR5579220-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:38:58 2024 >> started Mon Dec 9 22:39:21 2024 >> done (22.811s) 19472659 read pairs processed; of these: 20292 ( 0.10%) short read pairs filtered out after trimming by size control 87552 ( 0.45%) empty read pairs filtered out after trimming by size control 19364815 (99.45%) read pairs available; of these: 11426840 (59.01%) trimmed read pairs available after processing 7937975 (40.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 13 0.00% 20 22 0.00% 21 17 0.00% 22 19 0.00% 23 23 0.00% 24 23 0.00% 25 20 0.00% 26 22 0.00% 27 29 0.00% 28 21 0.00% 29 28 0.00% 30 38 0.00% 31 32 0.00% 32 43 0.00% 33 40 0.00% 34 50 0.00% 35 63 0.00% 36 67 0.00% 37 58 0.00% 38 64 0.00% 39 77 0.00% 40 90 0.00% 41 99 0.00% 42 119 0.00% 43 132 0.00% 44 147 0.00% 45 165 0.00% 46 177 0.00% 47 198 0.00% 48 247 0.00% 49 275 0.00% 50 314 0.00% 51 373 0.00% 52 371 0.00% 53 456 0.00% 54 505 0.00% 55 581 0.00% 56 664 0.00% 57 789 0.00% 58 898 0.00% 59 1095 0.01% 60 1283 0.01% 61 1288 0.01% 62 1534 0.01% 63 1724 0.01% 64 1803 0.01% 65 2005 0.01% 66 2250 0.01% 67 2640 0.01% 68 3195 0.02% 69 4077 0.02% 70 4440 0.02% 71 4544 0.02% 72 5126 0.03% 73 5539 0.03% 74 6147 0.03% 75 6757 0.03% 76 7478 0.04% 77 8081 0.04% 78 8999 0.05% 79 10340 0.05% 80 11325 0.06% 81 12519 0.06% 82 14006 0.07% 83 15400 0.08% 84 17375 0.09% 85 18849 0.10% 86 20221 0.10% 87 21955 0.11% 88 22690 0.12% 89 24643 0.13% 90 27698 0.14% 91 27814 0.14% 92 29304 0.15% 93 31670 0.16% 94 32628 0.17% 95 33446 0.17% 96 34903 0.18% 97 36812 0.19% 98 37639 0.19% 99 40104 0.21% 100 41268 0.21% 101 43498 0.22% 102 45903 0.24% 103 48065 0.25% 104 48850 0.25% 105 50712 0.26% 106 52430 0.27% 107 52633 0.27% 108 54258 0.28% 109 56054 0.29% 110 57150 0.30% 111 58691 0.30% 112 61547 0.32% 113 63481 0.33% 114 66036 0.34% 115 67238 0.35% 116 68053 0.35% 117 69433 0.36% 118 69517 0.36% 119 71075 0.37% 120 73380 0.38% 121 74656 0.39% 122 77064 0.40% 123 79941 0.41% 124 83391 0.43% 125 83966 0.43% 126 86678 0.45% 127 87882 0.45% 128 88264 0.46% 129 90932 0.47% 130 91178 0.47% 131 94040 0.49% 132 98167 0.51% 133 101318 0.52% 134 105658 0.55% 135 109371 0.56% 136 114846 0.59% 137 120361 0.62% 138 123965 0.64% 139 128493 0.66% 140 132675 0.69% 141 143411 0.74% 142 154066 0.80% 143 165937 0.86% 144 185487 0.96% 145 213255 1.10% 146 255837 1.32% 147 333726 1.72% 148 490359 2.53% 149 955842 4.94% 150 4728071 24.42% 151 7937975 40.99% 19364815 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=21 prefix-density=0.88 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=30 fanout-score=34.64 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.5 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=12 prefix-density=0.71 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=97.52 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579220 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:40:09 Started mapping on | Dec 09 22:40:09 Finished on | Dec 09 22:42:30 Mapping speed, Million of reads per hour | 494.42 Number of input reads | 19364815 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 18253339 Uniquely mapped reads % | 94.26% Average mapped length | 287.14 Number of splices: Total | 18642143 Number of splices: Annotated (sjdb) | 17625109 Number of splices: GT/AG | 18398024 Number of splices: GC/AG | 221462 Number of splices: AT/AC | 9027 Number of splices: Non-canonical | 13630 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284346 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 48273 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848416 848416 848416 N_multimapping 284346 284346 284346 N_noFeature 668264 17669367 897809 N_ambiguous 415484 2563 61354 UnstrandedReadsAssigned:17169591 PositiveStrandReadsAssigned:581409 NegativeStrandReadsAssigned:17294176 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5579220 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579220-trimmed-pair1.fastq SRR5579220-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,364,815 reads, 17,395,974 reads pseudoaligned [quant] estimated average fragment length: 237.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR5579220.ke.tsv 35125 SRR5579220.se.tsv 88098 total ==> SRR5579220.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.516 37.6906 4.38068 PNS24247 1044 807.962 35.4801 3.57537 PNS24249 1928 1691.96 72.4005 3.484 PNS24246 1044 807.962 35.4801 3.57537 PNS24248 1044 807.962 35.4801 3.57537 PNS24244 1471 1234.96 86.4686 5.70075 PNS24243 293 110.421 0 0 KQK14069 1603 1366.96 2476.31 147.494 KQK14071 474 257.039 77.2807 24.4793 ==> SRR5579220.se.tsv <== BRADI_1g14170v3 2857 BRADI_1g53295v3 50 BRADI_1g59795v3 695 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 2314 BRADI_1g74790v3 56 BRADI_1g09890v3 4 BRADI_1g77505v3 255 BRADI_1g48960v3 0 SRR5579220 completed mapping pipeline successfully